SlideShare uma empresa Scribd logo
1 de 100
Ligação, permuta,
mapas genéticos
Prof. Dra. Adriana Dantas
UERGS Bento Gonçalves
Segregação independente
Descoberta da Ligação
• William Bateson e R.C. Punnett estudaram
  herança de dois genes:
• Um afetando a cor da flor
  • (P – púrpura; p – vermelho)
• Um afetando a forma dos grãos de pólen
  • (L – longo; l – redondo)
• Propuseram que a proximidade física entre
  alelos dominantes e entre alelos recessivos
  impedem a distribuição independente na F1.
Bateson e Punnet ~1906

          PPLL (purpura, longo) X ppll (vermelha, redondo)

                                 PpLl

               Fenótipos de ervilhas observados na F2

Fenótipo (genótipo)        Observado       Proporção esperada
                                             9:3:3:1
Purpura longo (P_L_)          4.831          3.911
Purpura, redondo (P_ll)         390          1.303
Vermelho, longa (ppL_)          393          1.303
Vermelho, redonda (ppll)      1.338            435
                              6.952          6.952
Bateson e Punnet ~1906
Cruzamento teste




                   Cis   Trans
Oque esta ocorrendo?
• Os fenótipos desviam da proporção esperada de
  9:3:3:1
• Não parece ser explicado pela proporção
  mendeliana
• Duas classes fenotípicas são maiores que o
  esperado: purpura longo e vermelha redondo.
• Presença de mais gametas PL e pl do que seria
  produzido na distribuição independente
Teoria Cromossômica da Herança
• Thomas Hunt Morgan em 1910, trouxe a primeira evidência
  para essa teoria.
• Foi obtida a partir de estudos em uma mosca da fruta, a
  Drosophila melanogaster.
• Adequado para estudos genéticos.
  •   pequeno tamanho
  •   baixo número de cromossomo
  •   fácil criação em pequenos espaços de laboratório
  •   cultura de manutenção econômica
  •   grande número de descendentes por geração
  •   grande número de gerações em pouco espaço de tempo
  •   possibilidade de se obter fêmeas virgens logo após a eclosão
      para efetuar cruzamentos precisos.
Ligação e padrão de segregação
Morgan ~1911
Experimento de Morgan
• Morgan cruzou moscas de linhagens puras com olhos vermelhos
  (gene dominante) e de olhos brancos.

• Entretanto nem toda a progênie era de olho vermelho.

• Quando cruzava machos de olho vermelho da geração F1 com suas
  irmãs fêmeas de olho vermelho produzia somente ¼ de
• machos de olho branco mas nenhuma fêmea de olho branco.

• Explicação desse resultado - a cor de olho nessa mosca deveria ser
  ligada ao sexo.

• Então existiriam cromossomos sexuais que carregariam genes como
  os da coloração de olhos.
Proporções desviadas
Conclusões de Morgan

• Valores observados se desviam muito da proporção
  mendeliana prevista 1:1:1:1 – INDICA LIGAÇÃO GÊNICA.
• Morgan chamou a combinação não-parental de genes
  ligados de recombinantes;
• Ele esperava 50% de fenótipos recombinantes se a
  segregação ocorresse independentemente;
• Morgan observou 900/2.441 (36,9%) de fenótipos
  recombinantes. Então, concluiu que os dois genes devem
  estar ligados.
• Observando essa características apresentava o
  mesmo padrão de segregação em Drosophila:
  asas pequenas (Miniature), cor de corpo amarela
  (Yelow)

• Morgan trouxe, portanto, como evidência da
  Teoria Cromossômica da Herança, os padrões de
  segregação dos genes ligados aos cromossomos
  sexuais em Drosophila.
Autossomos ligados

            P                       X


                    pr+pr+ vg+vg+             prpr vgvg

          Gametas     pr+ vg+                  pr vg




            F1


                                pr+pr vg+vg



As duas maiores classes são as combinações pr+vg+ e prvg, originalmente
introduzidas pelas linhagens parentais homozigotas.
Herança dos gametas
 Na herança dos genes ligados, a freqüência dos gametas de
  um heterozigoto depende da taxa de crossing-over ou taxa
  de recombinação que ocorre entre os cromossomos
  homólogos.

 Os Gametas Parentais são formados mesmo que não haja
  recombinação e aparecem em maior quantidade.

 Os Gametas Recombinantes são formados apenas se houver
  permuta e aparecem em menor quantidade.

 A Taxa de Crossing é expressa em porcentagem e
  corresponde a freqüência de gametas recombinantes
  formados na gametogênese.
Cruzamento teste
• Um dos genitores (o testador) contribui com
  gametas que só possuem alelos recessivos
• Os fenótipos da prole revelam a contribuição
  gamética do outro, o genitor duplamente
  heterozigoto
• Analisador se concentra na meiose de um
  genitor e esquece o outro
• Analise da prole F1 autofecundada, apresenta
  dois conjuntos de meiose a ser considerada: um
  genitor masculino e genitor feminino
Autossomos ligados
            P                                 X




           F1


                 pr+pr vg+vg   pr+pr vgvg         prpr vg+vg     prpr vgvg

                    1339           151                154          1195



                    Parental   Recombinante       Recombinante    Parental




Cruzamento teste revela a aproximação de uma proporção 1:1 entre os dois tipos
parentais e também entre os dois tipos não parentais
F1 usado em cruzamento
teste
• pr+pr+ vgvg X prpr vg+vg+

• F1       pr+pr vg+vg  X prpr vgvg

• F2         pr+vg+      157
                                Desvio da proporção
       prvg        146          mendeliana de 1:1:1:1
                                Classes maiores são
       pr+vg       965           as que tem um alelo
                                      dominante
       prvg+       1.067
Herança simples de dois pares de alelos
situados no mesmo par cromossomico
• Duas situações:
  • Alelos dominantes se repelem – REPULSÃO
     • Um dominante e um recessivo em cada
       cromossomo            pr+      vg

                            pr+       vg
  • Alelos dominantes estão grudados – LIGAÇÃO
     • Num cromossomo estão ligados os alelos
       dominantes dos dois genes ou dos recessivos
                             pr+       vg+

                             pr        vg
Posição dos genes
 Na vinculação gênica a posição dos genes no
  heterozigoto (AaBb) pode ser Cis ou Trans.

 Estas posições também podem ser utilizadas para se
  definir quem são os gametas parentais e os
  recombinantes.
      A                 B          A               b

      a                 b           a              B


          Posição CIS                   Posição TRANS
Genes Ligados - Linkage
 Quando dois ou mais genes,
  responsáveis por diferentes
  características, estão localizados em
  um mesmo cromossomo, a herança
  é chamada de Vinculação Gênica.

 Nestes casos a quantidade de gametas
  e portanto a freqüência da
  descendência apresentarão diferenças
  em relação ao diibridismo.

 Crossing-Over ou permuta é a troca de
  partes entre cromossomos homólogos
  durante a meiose e é um dos
  principais fatores para a variabilidade
  genética.
Entendendo a recombinação




• As disposições originais de alelos nos dois cromossomos são chamados
  combinações parentais
• As duas novas combinações são chamadas de produtos do crossing ou
  recombinantes
Crossing-over
• A ligação entre os genes pode ser incompleta,
  pois durante a prófase I da meiose, quando os
  cromossomos homólogos estão pareados,
  ocorrem trocas de partes entre as cromátides
  irmãs, num processo chamado crossing-over ou
  permutação.
• Essas trocas resultam na formação de gametas
  recombinantes, que são cromossomos com
  novas combinações de alelos.
Recombinação
intercromossômica
                • Distribuição mendeliana
                  independente causa
                  recombinação
                  intercromossômica
                • As duas classes
                  recombinantes
                  constituem 50% da
                  prole, isto é 25% de cada
                  tipo recombinante na
                  prole.
                • Os dois genes estão em
                  pares separados de
                  cromossomos
Ligação gênica
• Se não houvesse recombinação nesses genes, a proporção de
 gametas formados por um duplo heterozigoto seria 50% AB e
 50% ab.


• No processo de segregação independente, um indivíduo AaBb
 produz 4 tipos de gametas, na proporção de 25% cada.


• Quando ocorre um caso de ligação gênica, o indivíduo AaBb
 produz apenas gametas AB e ab, na proporção de 50% cada.
Recombinação
intracromossômica
                • O crossing-over produz
                  recombinação
                  intracromossomica
                • Duas cromátides não-irmas
                  podem fazer crossing
                • Não há crossing entre dois genes
                  específicos em todas as meioses,
                  mas qdo há, metade dos
                  produtos desta meiose são
                  recombinantes
                • A meiose sem crossing entre os
                  genes em estudo só produz
                  genótipos parentais.
                • Sinal de recombinação
                  intracromossômica é menos de
                  50% - genes ligados
                • Com 50% - não ligados – genes
                  em cromossomos separados
Ligação gênica
• Quando há recombinação, observa-se na
  descendência uma pequena proporção de
  recombinantes, por exemplo:
    40% – AB (parental)
    40% – ab (parental)
    10% – Ab (recombinante)
    10% – aB (recombinante)
• Quanto mais afastado um gene estiver do outro,
  maior será a taxa de recombinação.
Formação de Gametas
                                   Tetrade
                              A    s         B
                                                           Cromátides irmãs
Cromossomos                   A              B
Homólogos                     a              b
                                                           Cromátides irmãs
                              a              b
                              A              B
                                                         Quiasma: estrutura de
                              A              b
                                                         recombinação entre
                              a              B
                                                         cromátides não-irmãs
                              a              b

       Primeira divisão meiótica
              A          B                           a             B
              A          b                           a             b

       Segunda divisão meiótica
      A       B           A         b            a   B         a       b

                        Quatro gametas haplóides
Crossing Over e Recombinação




  Permuta simples
Permutas duplas envolvendo 2 cromátides




  Permutas duplas envolvendo 3 cromátides
Permutas duplas envolvendo 4 cromátides
Crossing over
Mapas de ligação
•Morgan observava que a proporção de prole recombinante
variava, dependente de quais genes ligados estavam sendo
estudados
•Variações na frequência de crossing-over refletem a distancia
real que separa os genes do cromossomos
•A porcentagem de recombinantes genéticos produzidos num
cruzamento teste reflete a relação de ligação entre os genes.
•Stutervant desenvolveu um método para descrever a
diferença de separação espacial dos genes, onde as
variações de recombinantes determinaria as sequencias na
dimensão linear de um cromossomo
Postulado de Sturtevant
• Quanto maior a distancia entre os genes ligados,
  maior a probabilidade de as cromátides não-
  irmãs se cruzarem na região entre os genes e, e
  portanto, maior a proporção de recombinantes
  que seriam produzidos
• Assim obtendo a frequência de recombinantes,
  obtemos uma medida de distancia do mapa
  genético de ligação entre os genes
Unidade de mapa (u.m.)
• A partir da frequência de recombinação é possível construir o
  mapa gênico de um cromossomo.
• Definição – é a distancia entre os genes para a qual um
  produto de meiose em 100 é recombinante.
• Uma frequência de recombinação (FR) de 0,01 (ou 1%) é
  definida como 1 u.m.
• Uma unidade de mapa é chamada centimorgan (cM)
• As unidades são medidas em unidades de recombinação (UR),
  morgan ou centimorgan
  • uma UR corresponde a 1% da taxa de recombinação
Distância de mapa
                                        A                         B
Mapa baseado na recombinação A-B


                                                    5 u.m.
                                        A                     C
 Mapa baseado na recombinação A-C

                                                3 u.m.

                                        A                     C   B

    Mapas com                                        5 u.m.
  genes combinados
     possiveis
                                    C       A                         B


                                                8 u.m.
Locus gênico (loci)
• Local onde o gene esta situado no
  cromossomo
• Locus do gene cor de olho e locus do gene
  para comprimento de asa estao separados
  em 11 u.m.
            pr    11.0     vg
Analise em três caracteres
O macho é triplo homozigoto recessivo abc/abc
A femea é tripla heterozigota dominante ABC/ABC
Geraram 1000 descendentes
Frequência de recombinantes
A–B          367/1000 = 36,7% = 36,7 Cm
B–c          107/1000 = 10,7% = 10, 7 cM
A–C          450/1000 = 45,0% = 45,0 cM
Podemos construir um mapa genético a partir destes dados
Teste de dois pontos

            415



            92



            88



            405
Parentais         820

                             Freqüência de             180
                                                     _____
Recombinantes     180                            =
                             recombinação             1.000

Total           1.000




        vg         18 u.m.                   b
Teste dos três pontos
sc   9,1   ec   10,5   cv
Mapas gênico em Drosofila
• Em drosófilas, encontraram as seguintes taxas de
  recombinação e mapearam os genes p, v e r:




                         Taxa de
     Genes            recombinação             Distância
      p–v                   17%                  17 UR
      p–r                    9%                      9 UR
      r–v                    8%                      8 UR
Problema

• Em Drosophila melanogaster, asa selvagem (normal)
 é dominante sobre asa miniatura; olho selvagem
 (marrom-avermelhado) é dominante sobre olho
 vermelho. Fêmeas selvagens puras foram cruzadas
 com machos de asa miniatura e olhos vermelhos. As
 fêmeas da geração F1 foram cruzadas com machos
 recessivos, produzindo a seguinte descendência:
Problema

     48,5 % asa selvagem / olho selvagem
     48,5 % asa miniatura / olho vermelho
     1,5 % asa selvagem / olho vermelho
     1,5 % asa miniatura / olho selvagem


 Pergunta-se:

  a) Qual é a evidência de que se trata de um caso de ligação gênica?
  b)Qual é a distância relativa entre os loci considerados?
Solução

a) Como se trata de um cruzamento-teste, o
   fenótipo da descendência é determinado pelo
   genótipo dos gametas produzidos pelo
   indivíduo com características dominantes.
   Assim, os tipos de óvulos que geraram cada
   uma das classes de descendentes são:
Solução
  Fenótipos da         Genótipo dos    Porcentagem
  descendência            óvulos
selvagem / selvagem        MV             48,5 %
miniatura / vermelho       mv             48,5 %
selvagem / vermelho        Mv              1,5 %
miniatura / selvagem       mV              1,5 %


  Percebe-se que não se trata de segregação
  independente porque os gametas femininos não
  ocorrem na proporção de 1:1:1:1 (25 % de cada tipo)
Solução

 Trata-se, portanto, de um caso de ligação gênica
 incompleta, pois se formaram quatro classes
 fenotípicas, duas em maior frequência (classes
 parentes) e duas em menor frequência (classes
 recombinantes)
Solução

a) Estimamos a distância relativa entre os dois loci
   gênicos a partir da frequência de permutação
   entre eles.

   A frequência de permutação é igual à soma das
   frequências das classes recombinantes, ou seja,
   3 % (1,5 % + 1,5 %). Assim, a distância entre
   esses dois loci é de 3 UR ou 3 centimorgans.
Mapeamento gênico em
eucariotos
• Genes sobre cromossomos não homólogos segregam
  independentemente.
• Genes sobre o mesmo cromossomo (sintênicos) estão fisicamente
  ligados (grupo de ligação) e podem ser herdados juntos.
Objetivo:
• Analisar a freqüência de recombinação alélica em cruzamentos;
• Novas combinações de alelos parentais são produzidos por
  recombinação (“crossing-over” durante a meiose I);
• Cruzamentos-teste são usados para determinar quais genes estão
  ligados e criar um mapa de ligação (mapa genético de cada
  cromossomo).
Mapeamento Genético
 Mapa genético ou cromossômico é a representação da posição dos
  genes no cromossomo.
 Está diretamente relacionada a taxa de crossing.
 Unidades de Recombinação (U.R.) ou Morganídeos (M) são as
  unidades usadas para determinar a posição dos genes no cromossomo e
  correspondem a taxa de crossing.

 Exemplo: Em um cromossomo há a seguinte frequência de
  recombinação entre os genes A,B,C e D:

             A-B  45%       A-C  20%      C-B  25%
             B-D  5%        C-D  20%      A-D  40%
Qual a posição dos genes no
cromossomo?

       20M               20M       5M

  A            C               D        B



             40M

                   45M
Grupo de Ligação
Populações de Mapeamento
Aplicação dos mapas geneticos
 Guia para o sequenciamento de genomas, pois mostra a
 posição de genes e dos e marcadores genéticos

 Tipos de mapas: Mapa Genético de ligação e Mapa Físico


• Identificar genes relacionados a doenças herdadas


• Analisar uma série de marcadores polimórficos em famílias
  com o gene de interesse.
Como se faz?
• Cromossomos individuais em muitas espécies animais tendem a
  ter cerca de 100 cM de comprimento (100 x 106 pb)

• Assim, ocorre um “crossing over” por cromossomo por geração.

• Marcadores localizados em cromossomos diferentes têm 50% de
  chance de “co-segregarem”, estando a 50 cM de distância.

• 50 cM é o limite mínimo para se caracterizar dois marcadores
  como pertencentes ao grupo de ligação (“linkage group”) – ou ao
  mesmo cromossomo.
Marcadores que co-segregam
• Ainda assim, é possível, dois marcadores que se recombinem
  em 50% das vezes podem estar no mesmo grupo de ligação,
  desde que estejam relacionados a um terceiro marcador que
  mostre menos de 50% de recombinação com cada um dois
  primeiros marcadores
RAPD
                                            Dominante



                                                        DNA



        100 - 1,500 bases



Primers são separados em pouca distância,
        fragmento É AMPLIFICADO
RAPD
    (Random Amplified Polymorphic DNA)




    A                              B

A       B
Marcadores “dominantes”




  A1A1    A1A2    A2A2
Marcadores “dominantes”



     01   02   03 04   05   06   07   08   09   10   Ind.   L1   L2   L3   L4   L5   L6   L7   L8
                                                     01     0    1    0    1    1    0    1    1
                                                     02     1    0    0    0    1    1    0    1
                                                     03     0    0    1    1    1    0    0    1
L1
L2                                                   04     0    1    1    1    0    1    0    1
L3                                                   05     1    1    0    0    1    1    0    1
L4
                                                     06     0    0    1    0    1    0    0    1
L5
                                                     07     0    1    1    0    1    0    0    0
L6                                                   08     0    1    0    1    0    1    0    1
L7                                                   09     1    0    1    0    0    0    0    1
L8                                                   10     0    1    0    1    1    0    0    1
Análise em gel de RAPD




QUAIS AS POLIMÓRFICAS?
                         QUAIS AS (CO)SEGREGANTES?
Onde estão localizados no genoma os
            marcadores?
                              Genoma

             Genes e sequências              DNA extragênico
                relacionadas


         DNA codificante    DNA não         DNA repetitivo
                           codificante


RAPDs                     Introns    Repetições em           Repetições
                       Fragmentos de    tandem                dispersas
AFLPs                      genes

outros
                                                         Transposons
                                     Satélites      Sequências de inserção
                                  Microssatélites
                                  Minissatélites
Microsatélites
• SSR – Simple Sequence Repeats
  • Pequenas sequências (“sequence motif”) com 1 a 4 nucleotídeos
    repetidos em tandem - Amplificados via PCR
  • Classe de marcadores moleculares mais polimórficos
Sinonímias
SSR (Simple Sequence Repeats);
STMS (Sequence Tagged Microsatellites);
SSLP (Single Sequence Length Polymorphisms);

Onde são encontrados ???
Mamíferos: (CA)n ( 50.000 a 100.000 vezes no genoma)
Plantas: (AT)n
Mitocôndrias
Cloroplastos
M




                             homozigoto
                                          heterozigoto



     Marcador co-dominante




    Marcador multialélico
Marcadores “co-dominantes”




    A1 A1   A1 A2   A2 A2
Marcadores “co-dominantes”


                                                     Ind.   L1
                                                     01     1/3
                                                     02     3/4
     01   02   03 04   05   06   07   08   09   10   03     2/3
                                                     04     3/3
                                                     05     1/3
                                                     06     1/1
1
                                                     07     1/3
2
3
                                                     08     1/4
                                                     09     3/3
4
                                                     10     1/2
Sequenciamento de regiões microssatélites
Mapeamento genético de ligação
• Identificar marcadores genéticos ligados aos genes de interesse,
nos respectivos cromossomos;
•Disponibilizados para as principais espécies de importância
agronômica;
•QTLs e/ou QRLs rastreados e etiquetados,
 visando uma melhoria na eficiência da seleção.
                                                                          AFLP




                                                  Gene Vf
                                                  (Sarna)




                                                            Xu & Korban, 2000
CARACTERIZAÇÃO BIOLÓGICA
    Fenotipagem (Locos de resistência)




•   Melrose x Gala – 86 plantas
•   M13/91 x Gala - 129 plantas
•   M13/91 x M46/94 -185 plantas
M9 x Marubakaido - 85 F1 (QTLs - loci quantitativos)




               A      B




                          Perfilhos uniformes
pulgão         espinhos         tipo spur       Perfilhos uniformes
Marcas segregantes


Progênie F1 (Santa Rosa x Chatard)
                                     S C M
840
marcadores:
475 AFLPs
235 RAPDs
129 SSRs
Caracterização molecular
Identificação de marcas candidatas
Desenvolvimento de um SCAR
          (Sequence characterized amplified RAPD)


•   identificação de um iniciador que confere polimorfismo
    a dois bulks de DNA com fenótipos contrastantes,
•    o isolamento e a clonagem do fragmento amplificado
    em um vetor (plasmideo),
•   sequenciamento do fragmento isolado,
•   desenho dos iniciadores de tamanho maior que os
    decâmeros,
•   teste final em plantas.
Validação das Marcas – Desenvolvimentos de
marcadores específicos (Clonagem por mapeamento)
Marcador         Primer                                  Gene   Referencia
                    RAPDS
                    OPM18900         CACCATCCGT                              Vf     Koller et al.,1994
                    OPU01400         ACGGACGTA                               Vf     Koller et al.,1994
                    OPD20500         ACCCGGTCAC                              Vf     Yang & Kruger, 1994
                    OPC081100        TGGACCGGTG                              Vf     Tartarini 1996
                    OPC09900         CTCACCGTCC                              Vf     Tartarini 1996
                    OPAL07580        CCGTCCATCC                              Vf     Tartarini 1996
                    OPAM192200       CCAGGTCTTC                              Vf     Tartarini 1996
                    OPA15900         TTCCGAACCC                              Vf     Durham and Korban 1994
                    OPO141700        AGCATGGCTC                              Vf     King et al. 1998
                    OPAF132000       CCGAGGTGAC                              Vf     King et al. 1998
                    OPAG051900       CCCACTAGAC                              Vf     King et al. 1998
                    OPAG12800        CTCCCAGGGT                              Vf     King et al. 1998
                    SSR
                    CH05e03          For:CGAATATTTTCACTCTGACTGGG             Vbj    M.Gygax (Frey et al.,2004)
                                     Rev:CAAGTTGTTGTACTGCTCCGA
                    CH02B10          For: CAAGGAAATCATCAAAGATTCAAG           Vr     Hemmat et al.,2002
                                     Rev: CAAGTGGCTTCGGATAGT
                    CHVf1            For: ATCACCACCAGCAGCAAAG                Vf     C.Gessler (Frey et al.,2004)
                                     Rev: CATACAAATCAAAGCACAACCC
                    CH02c06          For: TGACGAAATCCACTACTAATGCA            Vr     Baldi et al.,2004
                                     Rev: GATTGCGCGCTTTTTAACAT
                    CH02C02a         For: CTTCAAGTTCAGCATCAAGACAA            Vr2    Patocchi et al., 2003
                                     Rev: TAGGGCACACTTGCTGGTC
                    CH02B07          For: CCAGACAAGTCATCACAACACTC            Vd     Calenge et al., 2005
                                     Rev: ATGTCGATGTCGCTCTGTTG

                    Primers específicos Vf
                    Vfa1                   For: TCTATCTCAGTAGTTTCTATAATTCC   Vf     Xu & Korban (2002)
                                           Rev:GTAGTTACTCTCAAGATTAAGAACTT
                    Vfa2                   For: CTCAATCTCAGTAGTTTCTATGGA     Vf     Xu & Korban (2002)
                                           Rev: CCCCCGAGATTAAGAGTTG
                    Vfa3                   For:ATATTAGTAGTTTCTATAATCTGAAGG   Vf     Xu & Korban (2002)
                                           Rev:CCCCCGAGATTAAGAGATG
                    Vfa4                   For:TATCTCAATCTCAGTAGTAATAGTATC   Vf     Xu & Korban (2002)
                                           Rev:GACCTTGGAAACCACAATC
                    AL07/SCAR 450 464 For: TCCTTACTGAGGAGGAAACCAG                   Tartarini et al. (1999)
                                           Rev: CAAGGGAACTGATCTTTCGTTG
                    ARGH
                    ARGH 25/CH02B07 For:CAAACATCATCGTAATTTTGACG              Vd     Baldi et al.,2004
                                           Rev:CATACTCTTCATGAGGATAATTC
                    ARGH37                 For:TGCACGACATTAGCAACACTG         Vr2    Baldi et al.,2004
                                           Rev:GAAACAACTTCTTTTGAGAGTTC
                    ARGH17                 For:TTGCCGACGTTCGTGATGCT          Vr2    Baldi et al.,2004
                                           Rev:GATATCCTTTGTTTGGACAACC
                    ARGH 34/CHVf1          For:TGTATGACCAGCCGAAGGTG          Vf1    Baldi et al.,2004
                                           REv:CCAGGACAACAATGTACCTC




Seleção assistida por marcadores
              (SAM)
Proteínas
Atributos                Isoenzimas        de sementes         RFLPs           RAPDs         Microssatélites       AFLPs
Nível de                    baixo              alto           baixo-alto      baixo-alto       muito alto         muito alto
Polimorfismo
Estabilidade              moderada              alta             alta            alta              alta              alta
ambiental
Número de locos        moderado (<50)       baixo (<10)          alto           alto              alto              alto
Expressão genética      co-dominate        co-dominante      co-dominante     dominante       co-dominante        dominante
Número de alelos por        2-5             multialélico      multialélico       2             multialélico          2
loco
Distribuição no        regiões de cópia   regiões de cópia      várias         ao acaso         ao acaso           ao acaso
genoma                      única              única
Acessibilidade            muito alta         muito alta         média         muito alta       muito baixa          média
tecnológica
Aplicabilidade no          rápido,            rápido,           lento,       rápido, baixo   lento, custo alto   rápido, custo
melhoramento             baixo custo        baixo custo      custo médio         custo                               baixo

Identificação de            baixa              baixa             alta         muito alta        muito alta        muito alta
genótipos
Avaliação de               média               baixa             alta            alta              alta           muito alta
germoplasma
Mapeamento                  baixa           muito baixa          alta            alta           muito alta           alta
genético
Mapeamento de               baixa           inadequado          média         muito alta          média           muito alta
regiões específicas
Mapeamento                  baixa           inadequado        muito alta        baixa              alta             baixa
comparativo
Genética de                 baixa              baixa            média            alta           muito alta        muito alta
Autógamas
Genética de                média               baixa            média            alta           muito alta        muito alta
Alógamas
Análise Filogenética       média               baixa          muito alta        média              alta             média
Adaptado de Gepts (1993) e Ferreira & Grattapaglia (1995).
Mapas físicos
É a distância entre posições de seqüências definidas de DNA
expressa de kilo bases.
•O mapa físico final é a seqüência completa.
•Montagem de mapas físicos:
  • Alinhamento de clones isolados aleatórios com base em perfis de
    fragmentos de restrição.
  • Abordagem baseada em hibridizações: uma sonda comum é
    usada para identificar quais numa série de clones são
    provavelmente contíguos.
  • Sequenciamento de diferentes fragmentos de DNA e
    organização dos fragmentos pela análise de superposições
    (contigs)
  • Contigs podem ser estendidos pelo sequenciamento da
    extremidade de clones específicos, levando à identificação de
    “sequenced-tagged sites” – STSs.
5’..GTPyPuAC..3’
3’..CAPuPyTG..5’

5’..AAGCTT..3’
3’..TTCGAA..5’




          Mapa de restrição:
          duas moléculas de DNA com o mesmo mapa de restrição devem ser
          iguais.
Os diferentes fragmentos de DNA são sequenciados e a
partir
dos mesmos vão sendo contruídas as seqüências
contínuas
CONTIGS
Mapa físico


               Genoteca de
               BAC/YAC

Mapa
Mapa genético humano
O primeiro mapa genético humano de alta resolução
 foi publicado em 1994.
Em 2.000, mais de 1milhão de SNPs identificados.
 Um marcador polimórfico a cada ~2.000 pb.
Marcadores genéticos são geralmente considerados
 como atributos do DNA:
 uma seqüência específica identificada em um dado locus
  (sequence tags)
 repetições simples (microssatélites)
 polimorfismo de restrição
Mapas detalhados
de cromossomos



http://www.ncbi.nlm.nih.gov
Humanos



Arroz
Melhoramento molecular
  (molecular breeding)



Populações segregantes   Expressão gênica - RNAm



 Marcador molecular          Bibliotecas cDNA


     Polimorfismo
                            Banco de dados
 Mapeamento de QRL/
 QTL

 Seleção assistida          Proteôma

Mais conteúdo relacionado

Mais procurados

Genetica de populações
Genetica de populaçõesGenetica de populações
Genetica de populaçõesUERGS
 
Slides da aula de Biologia (Marcelo) sobre Genética
Slides da aula de Biologia (Marcelo) sobre GenéticaSlides da aula de Biologia (Marcelo) sobre Genética
Slides da aula de Biologia (Marcelo) sobre GenéticaTurma Olímpica
 
Replicacao e transcriçao DNA procariotos
Replicacao e transcriçao DNA procariotosReplicacao e transcriçao DNA procariotos
Replicacao e transcriçao DNA procariotosUERGS
 
Biologia noções de probabilidade aplicadas à genética
Biologia    noções de probabilidade aplicadas à genéticaBiologia    noções de probabilidade aplicadas à genética
Biologia noções de probabilidade aplicadas à genéticaAdrianne Mendonça
 
A herança autossômica monogênica
A herança autossômica monogênica A herança autossômica monogênica
A herança autossômica monogênica SEMED de Santarém/PA
 
Genética – leis de mendel slides
Genética – leis de mendel slidesGenética – leis de mendel slides
Genética – leis de mendel slidesFabiano Reis
 
Genética de populações
Genética de populaçõesGenética de populações
Genética de populaçõesGabriele Melo
 
Interaçao genica
Interaçao genica Interaçao genica
Interaçao genica UERGS
 
Genética introdução
Genética introduçãoGenética introdução
Genética introduçãoDalu Barreto
 
Ppt Hereditariedade
Ppt   HereditariedadePpt   Hereditariedade
Ppt Hereditariedadestique
 
Divisão celular mitose e meiose
Divisão celular  mitose e meioseDivisão celular  mitose e meiose
Divisão celular mitose e meioseCésar Milani
 
Genética de populações
Genética de populaçõesGenética de populações
Genética de populaçõesCésar Milani
 
Conceitos basicos em genetica
 Conceitos basicos em genetica Conceitos basicos em genetica
Conceitos basicos em geneticaAdrianne Mendonça
 
Genética introdução
Genética introduçãoGenética introdução
Genética introduçãoDalu Barreto
 

Mais procurados (20)

Genetica de populações
Genetica de populaçõesGenetica de populações
Genetica de populações
 
Slides da aula de Biologia (Marcelo) sobre Genética
Slides da aula de Biologia (Marcelo) sobre GenéticaSlides da aula de Biologia (Marcelo) sobre Genética
Slides da aula de Biologia (Marcelo) sobre Genética
 
Replicacao e transcriçao DNA procariotos
Replicacao e transcriçao DNA procariotosReplicacao e transcriçao DNA procariotos
Replicacao e transcriçao DNA procariotos
 
Genética 2 e
Genética 2 eGenética 2 e
Genética 2 e
 
Biologia noções de probabilidade aplicadas à genética
Biologia    noções de probabilidade aplicadas à genéticaBiologia    noções de probabilidade aplicadas à genética
Biologia noções de probabilidade aplicadas à genética
 
A herança autossômica monogênica
A herança autossômica monogênica A herança autossômica monogênica
A herança autossômica monogênica
 
Genética – leis de mendel slides
Genética – leis de mendel slidesGenética – leis de mendel slides
Genética – leis de mendel slides
 
Genética de populações
Genética de populaçõesGenética de populações
Genética de populações
 
Mitose e Meiose
Mitose e MeioseMitose e Meiose
Mitose e Meiose
 
Transcrição gênica
Transcrição gênicaTranscrição gênica
Transcrição gênica
 
Interaçao genica
Interaçao genica Interaçao genica
Interaçao genica
 
Genética: Noções de Hereditariedade
Genética: Noções de HereditariedadeGenética: Noções de Hereditariedade
Genética: Noções de Hereditariedade
 
Genética introdução
Genética introduçãoGenética introdução
Genética introdução
 
Ppt Hereditariedade
Ppt   HereditariedadePpt   Hereditariedade
Ppt Hereditariedade
 
Divisão celular mitose e meiose
Divisão celular  mitose e meioseDivisão celular  mitose e meiose
Divisão celular mitose e meiose
 
2ª lei de mendel
2ª lei de mendel2ª lei de mendel
2ª lei de mendel
 
Genética de populações
Genética de populaçõesGenética de populações
Genética de populações
 
Conceitos basicos em genetica
 Conceitos basicos em genetica Conceitos basicos em genetica
Conceitos basicos em genetica
 
Genética introdução
Genética introduçãoGenética introdução
Genética introdução
 
duplicação do dna e rna
duplicação do dna  e rnaduplicação do dna  e rna
duplicação do dna e rna
 

Destaque

Recombinação e Mapa de Ligação
Recombinação e Mapa de LigaçãoRecombinação e Mapa de Ligação
Recombinação e Mapa de LigaçãoRodrigo Vianna
 
Recombinação genetica
Recombinação geneticaRecombinação genetica
Recombinação geneticaUERGS
 
Ferramentas de Gerência de Projetos
Ferramentas de Gerência de ProjetosFerramentas de Gerência de Projetos
Ferramentas de Gerência de ProjetosCloves Moreira Junior
 
FunçãO Do 1º E 2º Grau Autor Antonio Carlos Carneiro Barroso
FunçãO Do 1º  E 2º Grau Autor Antonio Carlos Carneiro BarrosoFunçãO Do 1º  E 2º Grau Autor Antonio Carlos Carneiro Barroso
FunçãO Do 1º E 2º Grau Autor Antonio Carlos Carneiro BarrosoAntonio Carneiro
 
Snc 2º ano - 2012
Snc   2º ano - 2012Snc   2º ano - 2012
Snc 2º ano - 2012Maria Costa
 
Curso oficial iso 27002 versão 2013 foundation
Curso oficial iso 27002   versão 2013 foundationCurso oficial iso 27002   versão 2013 foundation
Curso oficial iso 27002 versão 2013 foundationAdriano Martins Antonio
 
Usos del misoprostol adriana moncayo
Usos del misoprostol   adriana moncayoUsos del misoprostol   adriana moncayo
Usos del misoprostol adriana moncayoAdriana L. Moncayo
 
Acto administrativo Modulo II
Acto administrativo   Modulo IIActo administrativo   Modulo II
Acto administrativo Modulo IIDiplomada2010
 
Certificação ITIL e Curso ITIL Virtual
Certificação ITIL e Curso ITIL VirtualCertificação ITIL e Curso ITIL Virtual
Certificação ITIL e Curso ITIL VirtualFernando Palma
 
Conhecimentos bancários curso completo Slides com Questões
Conhecimentos bancários   curso completo Slides com QuestõesConhecimentos bancários   curso completo Slides com Questões
Conhecimentos bancários curso completo Slides com QuestõesMiriameDouglas Luiz
 
Timeline e historia do design
Timeline e historia do designTimeline e historia do design
Timeline e historia do designMarcio Duarte
 
AULA DE TRIGONOMETRIA
AULA DE TRIGONOMETRIAAULA DE TRIGONOMETRIA
AULA DE TRIGONOMETRIACECIERJ
 
Técnicas para o Desenvolvimento de Cronogramas
Técnicas para o Desenvolvimento de CronogramasTécnicas para o Desenvolvimento de Cronogramas
Técnicas para o Desenvolvimento de CronogramasPeter Mello
 
Cirugia preprotesica
Cirugia preprotesicaCirugia preprotesica
Cirugia preprotesicailivamo
 
VegetaçãO Brasileira - Ensino Fundamental 4º e 5º ano
VegetaçãO Brasileira - Ensino Fundamental 4º e 5º anoVegetaçãO Brasileira - Ensino Fundamental 4º e 5º ano
VegetaçãO Brasileira - Ensino Fundamental 4º e 5º anoCoraci Machado Araújo
 

Destaque (20)

Recombinação e Mapa de Ligação
Recombinação e Mapa de LigaçãoRecombinação e Mapa de Ligação
Recombinação e Mapa de Ligação
 
Recombinação genetica
Recombinação geneticaRecombinação genetica
Recombinação genetica
 
Ferramentas de Gerência de Projetos
Ferramentas de Gerência de ProjetosFerramentas de Gerência de Projetos
Ferramentas de Gerência de Projetos
 
FunçãO Do 1º E 2º Grau Autor Antonio Carlos Carneiro Barroso
FunçãO Do 1º  E 2º Grau Autor Antonio Carlos Carneiro BarrosoFunçãO Do 1º  E 2º Grau Autor Antonio Carlos Carneiro Barroso
FunçãO Do 1º E 2º Grau Autor Antonio Carlos Carneiro Barroso
 
Snc 2º ano - 2012
Snc   2º ano - 2012Snc   2º ano - 2012
Snc 2º ano - 2012
 
Plano de Negócios Hinode 2014
Plano de Negócios Hinode 2014Plano de Negócios Hinode 2014
Plano de Negócios Hinode 2014
 
Curso oficial iso 27002 versão 2013 foundation
Curso oficial iso 27002   versão 2013 foundationCurso oficial iso 27002   versão 2013 foundation
Curso oficial iso 27002 versão 2013 foundation
 
Usos del misoprostol adriana moncayo
Usos del misoprostol   adriana moncayoUsos del misoprostol   adriana moncayo
Usos del misoprostol adriana moncayo
 
Acto administrativo Modulo II
Acto administrativo   Modulo IIActo administrativo   Modulo II
Acto administrativo Modulo II
 
Certificação ITIL e Curso ITIL Virtual
Certificação ITIL e Curso ITIL VirtualCertificação ITIL e Curso ITIL Virtual
Certificação ITIL e Curso ITIL Virtual
 
Marketing na Igreja
Marketing na IgrejaMarketing na Igreja
Marketing na Igreja
 
VisãO Geral da Filosofia
VisãO Geral da FilosofiaVisãO Geral da Filosofia
VisãO Geral da Filosofia
 
Hebreus, FeníCios E Persas 1
Hebreus, FeníCios E Persas 1Hebreus, FeníCios E Persas 1
Hebreus, FeníCios E Persas 1
 
Conhecimentos bancários curso completo Slides com Questões
Conhecimentos bancários   curso completo Slides com QuestõesConhecimentos bancários   curso completo Slides com Questões
Conhecimentos bancários curso completo Slides com Questões
 
Hipertension JNC VII
Hipertension JNC VIIHipertension JNC VII
Hipertension JNC VII
 
Timeline e historia do design
Timeline e historia do designTimeline e historia do design
Timeline e historia do design
 
AULA DE TRIGONOMETRIA
AULA DE TRIGONOMETRIAAULA DE TRIGONOMETRIA
AULA DE TRIGONOMETRIA
 
Técnicas para o Desenvolvimento de Cronogramas
Técnicas para o Desenvolvimento de CronogramasTécnicas para o Desenvolvimento de Cronogramas
Técnicas para o Desenvolvimento de Cronogramas
 
Cirugia preprotesica
Cirugia preprotesicaCirugia preprotesica
Cirugia preprotesica
 
VegetaçãO Brasileira - Ensino Fundamental 4º e 5º ano
VegetaçãO Brasileira - Ensino Fundamental 4º e 5º anoVegetaçãO Brasileira - Ensino Fundamental 4º e 5º ano
VegetaçãO Brasileira - Ensino Fundamental 4º e 5º ano
 

Semelhante a Ligação, permuta, mapas genéticos 2010

Mapeamento genomico
Mapeamento genomicoMapeamento genomico
Mapeamento genomicoUERGS
 
Mapeamento genomico
Mapeamento genomicoMapeamento genomico
Mapeamento genomicoUERGS
 
Transmisso de-caractersticas-hereditrias-1193889302144183-2
Transmisso de-caractersticas-hereditrias-1193889302144183-2Transmisso de-caractersticas-hereditrias-1193889302144183-2
Transmisso de-caractersticas-hereditrias-1193889302144183-2Pelo Siro
 
genetica conceitos basicos (2020_03_19 15_11_22 UTC).ppt
genetica conceitos  basicos (2020_03_19 15_11_22 UTC).pptgenetica conceitos  basicos (2020_03_19 15_11_22 UTC).ppt
genetica conceitos basicos (2020_03_19 15_11_22 UTC).pptHerminioMendes3
 
2ª Lei de Mendel e heranças ligadas ao sexo.pptx
2ª Lei de Mendel e heranças ligadas ao sexo.pptx2ª Lei de Mendel e heranças ligadas ao sexo.pptx
2ª Lei de Mendel e heranças ligadas ao sexo.pptxJessicaCarolinadaCos1
 
Genetica conceitos basicos
Genetica conceitos  basicosGenetica conceitos  basicos
Genetica conceitos basicosJosEzequiel2
 
Aulão genética 3 em
Aulão genética 3 emAulão genética 3 em
Aulão genética 3 emCésar Milani
 
Transmissão de características hereditárias
Transmissão de características hereditáriasTransmissão de características hereditárias
Transmissão de características hereditáriasCatir
 
2º lei de mendel aprofundamento
2º lei de mendel aprofundamento2º lei de mendel aprofundamento
2º lei de mendel aprofundamentoletyap
 
Materialgenetico 1
Materialgenetico  1 Materialgenetico  1
Materialgenetico 1 NetCultus
 
GENÉTICA - 1ª LEI DE MENDEL- CIENCIAS/BIOLOGIA
GENÉTICA - 1ª LEI DE MENDEL- CIENCIAS/BIOLOGIAGENÉTICA - 1ª LEI DE MENDEL- CIENCIAS/BIOLOGIA
GENÉTICA - 1ª LEI DE MENDEL- CIENCIAS/BIOLOGIAPauloLerissonCardoso
 
Revisão de genética (versão para aula)
Revisão de genética (versão para aula)Revisão de genética (versão para aula)
Revisão de genética (versão para aula)Mario Leonel Rodrigues
 
Aula 13 lei da segregação
Aula 13   lei da segregaçãoAula 13   lei da segregação
Aula 13 lei da segregaçãoJonatas Carlos
 

Semelhante a Ligação, permuta, mapas genéticos 2010 (20)

Mapeamento genomico
Mapeamento genomicoMapeamento genomico
Mapeamento genomico
 
Mapeamento genomico
Mapeamento genomicoMapeamento genomico
Mapeamento genomico
 
Transmisso de-caractersticas-hereditrias-1193889302144183-2
Transmisso de-caractersticas-hereditrias-1193889302144183-2Transmisso de-caractersticas-hereditrias-1193889302144183-2
Transmisso de-caractersticas-hereditrias-1193889302144183-2
 
genetica conceitos basicos (2020_03_19 15_11_22 UTC).ppt
genetica conceitos  basicos (2020_03_19 15_11_22 UTC).pptgenetica conceitos  basicos (2020_03_19 15_11_22 UTC).ppt
genetica conceitos basicos (2020_03_19 15_11_22 UTC).ppt
 
2ª Lei de Mendel e heranças ligadas ao sexo.pptx
2ª Lei de Mendel e heranças ligadas ao sexo.pptx2ª Lei de Mendel e heranças ligadas ao sexo.pptx
2ª Lei de Mendel e heranças ligadas ao sexo.pptx
 
Genetica conceitos basicos
Genetica conceitos  basicosGenetica conceitos  basicos
Genetica conceitos basicos
 
Aulão genética 3 em
Aulão genética 3 emAulão genética 3 em
Aulão genética 3 em
 
Transmissão de características hereditárias
Transmissão de características hereditáriasTransmissão de características hereditárias
Transmissão de características hereditárias
 
2º lei de mendel aprofundamento
2º lei de mendel aprofundamento2º lei de mendel aprofundamento
2º lei de mendel aprofundamento
 
Materialgenetico 1
Materialgenetico  1 Materialgenetico  1
Materialgenetico 1
 
Aula 12 - Ligação Gênica.pdf
Aula 12 - Ligação Gênica.pdfAula 12 - Ligação Gênica.pdf
Aula 12 - Ligação Gênica.pdf
 
Genética
GenéticaGenética
Genética
 
GENÉTICA - 1ª LEI DE MENDEL- CIENCIAS/BIOLOGIA
GENÉTICA - 1ª LEI DE MENDEL- CIENCIAS/BIOLOGIAGENÉTICA - 1ª LEI DE MENDEL- CIENCIAS/BIOLOGIA
GENÉTICA - 1ª LEI DE MENDEL- CIENCIAS/BIOLOGIA
 
Genetica
GeneticaGenetica
Genetica
 
Genética 1 aula
Genética 1 aulaGenética 1 aula
Genética 1 aula
 
Revisão de genética (versão para aula)
Revisão de genética (versão para aula)Revisão de genética (versão para aula)
Revisão de genética (versão para aula)
 
Aula 13 lei da segregação
Aula 13   lei da segregaçãoAula 13   lei da segregação
Aula 13 lei da segregação
 
Genética 2 e-3e
Genética 2 e-3eGenética 2 e-3e
Genética 2 e-3e
 
Segunda Lei de Mendel
Segunda Lei de MendelSegunda Lei de Mendel
Segunda Lei de Mendel
 
Genetica ii
Genetica iiGenetica ii
Genetica ii
 

Mais de UERGS

Aula 1 - Biodiversidade e os Recursos Genéticos [Salvo automaticamente].pptx
Aula 1 - Biodiversidade e os Recursos Genéticos [Salvo automaticamente].pptxAula 1 - Biodiversidade e os Recursos Genéticos [Salvo automaticamente].pptx
Aula 1 - Biodiversidade e os Recursos Genéticos [Salvo automaticamente].pptxUERGS
 
Nutrigenômica e nutrigenética
Nutrigenômica e nutrigenéticaNutrigenômica e nutrigenética
Nutrigenômica e nutrigenéticaUERGS
 
Princípios gerais da conservação de alimentos
Princípios gerais da conservação de alimentosPrincípios gerais da conservação de alimentos
Princípios gerais da conservação de alimentosUERGS
 
Definição, classificação, composição e conservação aula 2
Definição, classificação, composição e conservação aula 2Definição, classificação, composição e conservação aula 2
Definição, classificação, composição e conservação aula 2UERGS
 
Conservação por utilização de temperaturas
Conservação por utilização de temperaturasConservação por utilização de temperaturas
Conservação por utilização de temperaturasUERGS
 
Conservação pelo uso do frio
Conservação pelo uso do frioConservação pelo uso do frio
Conservação pelo uso do frioUERGS
 
Tópicos especiais biodiesel
Tópicos especiais   biodieselTópicos especiais   biodiesel
Tópicos especiais biodieselUERGS
 
Bioquimica de alimentos proteases
Bioquimica de alimentos   proteasesBioquimica de alimentos   proteases
Bioquimica de alimentos proteasesUERGS
 
Bioquimica da maturação das frutas
Bioquimica da maturação das frutasBioquimica da maturação das frutas
Bioquimica da maturação das frutasUERGS
 
Controle do amadurecimento e senescência dos frutos
Controle do amadurecimento e senescência dos frutosControle do amadurecimento e senescência dos frutos
Controle do amadurecimento e senescência dos frutosUERGS
 
Instrumentos óticos
Instrumentos óticosInstrumentos óticos
Instrumentos óticosUERGS
 
Analise espectro eletromagnética
Analise espectro eletromagnéticaAnalise espectro eletromagnética
Analise espectro eletromagnéticaUERGS
 
Bioquímica de alimentos - Carboidrases
Bioquímica de alimentos - CarboidrasesBioquímica de alimentos - Carboidrases
Bioquímica de alimentos - CarboidrasesUERGS
 
Enzimas
EnzimasEnzimas
EnzimasUERGS
 
Recuperação de áreas degradadas
Recuperação de áreas degradadasRecuperação de áreas degradadas
Recuperação de áreas degradadasUERGS
 
Segurança alimentar e ogms
Segurança alimentar e ogmsSegurança alimentar e ogms
Segurança alimentar e ogmsUERGS
 
Impacto ambiental, analise de riscos
Impacto ambiental, analise de riscosImpacto ambiental, analise de riscos
Impacto ambiental, analise de riscosUERGS
 
Impacto ambiental dos resíduos agroindustriais
Impacto ambiental dos resíduos agroindustriaisImpacto ambiental dos resíduos agroindustriais
Impacto ambiental dos resíduos agroindustriaisUERGS
 
Resíduos agroindustriais
Resíduos agroindustriaisResíduos agroindustriais
Resíduos agroindustriaisUERGS
 
Meio ambiente – as 17 leis ambientais do
Meio ambiente – as 17 leis ambientais doMeio ambiente – as 17 leis ambientais do
Meio ambiente – as 17 leis ambientais doUERGS
 

Mais de UERGS (20)

Aula 1 - Biodiversidade e os Recursos Genéticos [Salvo automaticamente].pptx
Aula 1 - Biodiversidade e os Recursos Genéticos [Salvo automaticamente].pptxAula 1 - Biodiversidade e os Recursos Genéticos [Salvo automaticamente].pptx
Aula 1 - Biodiversidade e os Recursos Genéticos [Salvo automaticamente].pptx
 
Nutrigenômica e nutrigenética
Nutrigenômica e nutrigenéticaNutrigenômica e nutrigenética
Nutrigenômica e nutrigenética
 
Princípios gerais da conservação de alimentos
Princípios gerais da conservação de alimentosPrincípios gerais da conservação de alimentos
Princípios gerais da conservação de alimentos
 
Definição, classificação, composição e conservação aula 2
Definição, classificação, composição e conservação aula 2Definição, classificação, composição e conservação aula 2
Definição, classificação, composição e conservação aula 2
 
Conservação por utilização de temperaturas
Conservação por utilização de temperaturasConservação por utilização de temperaturas
Conservação por utilização de temperaturas
 
Conservação pelo uso do frio
Conservação pelo uso do frioConservação pelo uso do frio
Conservação pelo uso do frio
 
Tópicos especiais biodiesel
Tópicos especiais   biodieselTópicos especiais   biodiesel
Tópicos especiais biodiesel
 
Bioquimica de alimentos proteases
Bioquimica de alimentos   proteasesBioquimica de alimentos   proteases
Bioquimica de alimentos proteases
 
Bioquimica da maturação das frutas
Bioquimica da maturação das frutasBioquimica da maturação das frutas
Bioquimica da maturação das frutas
 
Controle do amadurecimento e senescência dos frutos
Controle do amadurecimento e senescência dos frutosControle do amadurecimento e senescência dos frutos
Controle do amadurecimento e senescência dos frutos
 
Instrumentos óticos
Instrumentos óticosInstrumentos óticos
Instrumentos óticos
 
Analise espectro eletromagnética
Analise espectro eletromagnéticaAnalise espectro eletromagnética
Analise espectro eletromagnética
 
Bioquímica de alimentos - Carboidrases
Bioquímica de alimentos - CarboidrasesBioquímica de alimentos - Carboidrases
Bioquímica de alimentos - Carboidrases
 
Enzimas
EnzimasEnzimas
Enzimas
 
Recuperação de áreas degradadas
Recuperação de áreas degradadasRecuperação de áreas degradadas
Recuperação de áreas degradadas
 
Segurança alimentar e ogms
Segurança alimentar e ogmsSegurança alimentar e ogms
Segurança alimentar e ogms
 
Impacto ambiental, analise de riscos
Impacto ambiental, analise de riscosImpacto ambiental, analise de riscos
Impacto ambiental, analise de riscos
 
Impacto ambiental dos resíduos agroindustriais
Impacto ambiental dos resíduos agroindustriaisImpacto ambiental dos resíduos agroindustriais
Impacto ambiental dos resíduos agroindustriais
 
Resíduos agroindustriais
Resíduos agroindustriaisResíduos agroindustriais
Resíduos agroindustriais
 
Meio ambiente – as 17 leis ambientais do
Meio ambiente – as 17 leis ambientais doMeio ambiente – as 17 leis ambientais do
Meio ambiente – as 17 leis ambientais do
 

Ligação, permuta, mapas genéticos 2010

  • 1. Ligação, permuta, mapas genéticos Prof. Dra. Adriana Dantas UERGS Bento Gonçalves
  • 3.
  • 4.
  • 5. Descoberta da Ligação • William Bateson e R.C. Punnett estudaram herança de dois genes: • Um afetando a cor da flor • (P – púrpura; p – vermelho) • Um afetando a forma dos grãos de pólen • (L – longo; l – redondo) • Propuseram que a proximidade física entre alelos dominantes e entre alelos recessivos impedem a distribuição independente na F1.
  • 6. Bateson e Punnet ~1906 PPLL (purpura, longo) X ppll (vermelha, redondo) PpLl Fenótipos de ervilhas observados na F2 Fenótipo (genótipo) Observado Proporção esperada 9:3:3:1 Purpura longo (P_L_) 4.831 3.911 Purpura, redondo (P_ll) 390 1.303 Vermelho, longa (ppL_) 393 1.303 Vermelho, redonda (ppll) 1.338 435 6.952 6.952
  • 8. Cruzamento teste Cis Trans
  • 9. Oque esta ocorrendo? • Os fenótipos desviam da proporção esperada de 9:3:3:1 • Não parece ser explicado pela proporção mendeliana • Duas classes fenotípicas são maiores que o esperado: purpura longo e vermelha redondo. • Presença de mais gametas PL e pl do que seria produzido na distribuição independente
  • 10. Teoria Cromossômica da Herança • Thomas Hunt Morgan em 1910, trouxe a primeira evidência para essa teoria. • Foi obtida a partir de estudos em uma mosca da fruta, a Drosophila melanogaster. • Adequado para estudos genéticos. • pequeno tamanho • baixo número de cromossomo • fácil criação em pequenos espaços de laboratório • cultura de manutenção econômica • grande número de descendentes por geração • grande número de gerações em pouco espaço de tempo • possibilidade de se obter fêmeas virgens logo após a eclosão para efetuar cruzamentos precisos.
  • 11. Ligação e padrão de segregação
  • 13. Experimento de Morgan • Morgan cruzou moscas de linhagens puras com olhos vermelhos (gene dominante) e de olhos brancos. • Entretanto nem toda a progênie era de olho vermelho. • Quando cruzava machos de olho vermelho da geração F1 com suas irmãs fêmeas de olho vermelho produzia somente ¼ de • machos de olho branco mas nenhuma fêmea de olho branco. • Explicação desse resultado - a cor de olho nessa mosca deveria ser ligada ao sexo. • Então existiriam cromossomos sexuais que carregariam genes como os da coloração de olhos.
  • 15. Conclusões de Morgan • Valores observados se desviam muito da proporção mendeliana prevista 1:1:1:1 – INDICA LIGAÇÃO GÊNICA. • Morgan chamou a combinação não-parental de genes ligados de recombinantes; • Ele esperava 50% de fenótipos recombinantes se a segregação ocorresse independentemente; • Morgan observou 900/2.441 (36,9%) de fenótipos recombinantes. Então, concluiu que os dois genes devem estar ligados.
  • 16.
  • 17. • Observando essa características apresentava o mesmo padrão de segregação em Drosophila: asas pequenas (Miniature), cor de corpo amarela (Yelow) • Morgan trouxe, portanto, como evidência da Teoria Cromossômica da Herança, os padrões de segregação dos genes ligados aos cromossomos sexuais em Drosophila.
  • 18. Autossomos ligados P X pr+pr+ vg+vg+ prpr vgvg Gametas pr+ vg+ pr vg F1 pr+pr vg+vg As duas maiores classes são as combinações pr+vg+ e prvg, originalmente introduzidas pelas linhagens parentais homozigotas.
  • 19. Herança dos gametas  Na herança dos genes ligados, a freqüência dos gametas de um heterozigoto depende da taxa de crossing-over ou taxa de recombinação que ocorre entre os cromossomos homólogos.  Os Gametas Parentais são formados mesmo que não haja recombinação e aparecem em maior quantidade.  Os Gametas Recombinantes são formados apenas se houver permuta e aparecem em menor quantidade.  A Taxa de Crossing é expressa em porcentagem e corresponde a freqüência de gametas recombinantes formados na gametogênese.
  • 20. Cruzamento teste • Um dos genitores (o testador) contribui com gametas que só possuem alelos recessivos • Os fenótipos da prole revelam a contribuição gamética do outro, o genitor duplamente heterozigoto • Analisador se concentra na meiose de um genitor e esquece o outro • Analise da prole F1 autofecundada, apresenta dois conjuntos de meiose a ser considerada: um genitor masculino e genitor feminino
  • 21. Autossomos ligados P X F1 pr+pr vg+vg pr+pr vgvg prpr vg+vg prpr vgvg 1339 151 154 1195 Parental Recombinante Recombinante Parental Cruzamento teste revela a aproximação de uma proporção 1:1 entre os dois tipos parentais e também entre os dois tipos não parentais
  • 22. F1 usado em cruzamento teste • pr+pr+ vgvg X prpr vg+vg+ • F1 pr+pr vg+vg  X prpr vgvg • F2 pr+vg+ 157 Desvio da proporção prvg 146 mendeliana de 1:1:1:1 Classes maiores são pr+vg 965 as que tem um alelo dominante prvg+ 1.067
  • 23. Herança simples de dois pares de alelos situados no mesmo par cromossomico • Duas situações: • Alelos dominantes se repelem – REPULSÃO • Um dominante e um recessivo em cada cromossomo pr+ vg pr+ vg • Alelos dominantes estão grudados – LIGAÇÃO • Num cromossomo estão ligados os alelos dominantes dos dois genes ou dos recessivos pr+ vg+ pr vg
  • 24. Posição dos genes  Na vinculação gênica a posição dos genes no heterozigoto (AaBb) pode ser Cis ou Trans.  Estas posições também podem ser utilizadas para se definir quem são os gametas parentais e os recombinantes. A B A b a b a B Posição CIS Posição TRANS
  • 25. Genes Ligados - Linkage  Quando dois ou mais genes, responsáveis por diferentes características, estão localizados em um mesmo cromossomo, a herança é chamada de Vinculação Gênica.  Nestes casos a quantidade de gametas e portanto a freqüência da descendência apresentarão diferenças em relação ao diibridismo.  Crossing-Over ou permuta é a troca de partes entre cromossomos homólogos durante a meiose e é um dos principais fatores para a variabilidade genética.
  • 26. Entendendo a recombinação • As disposições originais de alelos nos dois cromossomos são chamados combinações parentais • As duas novas combinações são chamadas de produtos do crossing ou recombinantes
  • 27. Crossing-over • A ligação entre os genes pode ser incompleta, pois durante a prófase I da meiose, quando os cromossomos homólogos estão pareados, ocorrem trocas de partes entre as cromátides irmãs, num processo chamado crossing-over ou permutação. • Essas trocas resultam na formação de gametas recombinantes, que são cromossomos com novas combinações de alelos.
  • 28. Recombinação intercromossômica • Distribuição mendeliana independente causa recombinação intercromossômica • As duas classes recombinantes constituem 50% da prole, isto é 25% de cada tipo recombinante na prole. • Os dois genes estão em pares separados de cromossomos
  • 29. Ligação gênica • Se não houvesse recombinação nesses genes, a proporção de gametas formados por um duplo heterozigoto seria 50% AB e 50% ab. • No processo de segregação independente, um indivíduo AaBb produz 4 tipos de gametas, na proporção de 25% cada. • Quando ocorre um caso de ligação gênica, o indivíduo AaBb produz apenas gametas AB e ab, na proporção de 50% cada.
  • 30. Recombinação intracromossômica • O crossing-over produz recombinação intracromossomica • Duas cromátides não-irmas podem fazer crossing • Não há crossing entre dois genes específicos em todas as meioses, mas qdo há, metade dos produtos desta meiose são recombinantes • A meiose sem crossing entre os genes em estudo só produz genótipos parentais. • Sinal de recombinação intracromossômica é menos de 50% - genes ligados • Com 50% - não ligados – genes em cromossomos separados
  • 31. Ligação gênica • Quando há recombinação, observa-se na descendência uma pequena proporção de recombinantes, por exemplo: 40% – AB (parental) 40% – ab (parental) 10% – Ab (recombinante) 10% – aB (recombinante) • Quanto mais afastado um gene estiver do outro, maior será a taxa de recombinação.
  • 32. Formação de Gametas Tetrade A s B Cromátides irmãs Cromossomos A B Homólogos a b Cromátides irmãs a b A B Quiasma: estrutura de A b recombinação entre a B cromátides não-irmãs a b Primeira divisão meiótica A B a B A b a b Segunda divisão meiótica A B A b a B a b Quatro gametas haplóides
  • 33. Crossing Over e Recombinação Permuta simples
  • 34. Permutas duplas envolvendo 2 cromátides Permutas duplas envolvendo 3 cromátides
  • 35. Permutas duplas envolvendo 4 cromátides
  • 37. Mapas de ligação •Morgan observava que a proporção de prole recombinante variava, dependente de quais genes ligados estavam sendo estudados •Variações na frequência de crossing-over refletem a distancia real que separa os genes do cromossomos •A porcentagem de recombinantes genéticos produzidos num cruzamento teste reflete a relação de ligação entre os genes. •Stutervant desenvolveu um método para descrever a diferença de separação espacial dos genes, onde as variações de recombinantes determinaria as sequencias na dimensão linear de um cromossomo
  • 38. Postulado de Sturtevant • Quanto maior a distancia entre os genes ligados, maior a probabilidade de as cromátides não- irmãs se cruzarem na região entre os genes e, e portanto, maior a proporção de recombinantes que seriam produzidos • Assim obtendo a frequência de recombinantes, obtemos uma medida de distancia do mapa genético de ligação entre os genes
  • 39. Unidade de mapa (u.m.) • A partir da frequência de recombinação é possível construir o mapa gênico de um cromossomo. • Definição – é a distancia entre os genes para a qual um produto de meiose em 100 é recombinante. • Uma frequência de recombinação (FR) de 0,01 (ou 1%) é definida como 1 u.m. • Uma unidade de mapa é chamada centimorgan (cM) • As unidades são medidas em unidades de recombinação (UR), morgan ou centimorgan • uma UR corresponde a 1% da taxa de recombinação
  • 40. Distância de mapa A B Mapa baseado na recombinação A-B 5 u.m. A C Mapa baseado na recombinação A-C 3 u.m. A C B Mapas com 5 u.m. genes combinados possiveis C A B 8 u.m.
  • 41. Locus gênico (loci) • Local onde o gene esta situado no cromossomo • Locus do gene cor de olho e locus do gene para comprimento de asa estao separados em 11 u.m. pr 11.0 vg
  • 42. Analise em três caracteres O macho é triplo homozigoto recessivo abc/abc A femea é tripla heterozigota dominante ABC/ABC Geraram 1000 descendentes
  • 43. Frequência de recombinantes A–B 367/1000 = 36,7% = 36,7 Cm B–c 107/1000 = 10,7% = 10, 7 cM A–C 450/1000 = 45,0% = 45,0 cM Podemos construir um mapa genético a partir destes dados
  • 44. Teste de dois pontos 415 92 88 405
  • 45. Parentais 820 Freqüência de 180 _____ Recombinantes 180 = recombinação 1.000 Total 1.000 vg 18 u.m. b
  • 46. Teste dos três pontos
  • 47. sc 9,1 ec 10,5 cv
  • 48.
  • 49.
  • 50. Mapas gênico em Drosofila • Em drosófilas, encontraram as seguintes taxas de recombinação e mapearam os genes p, v e r: Taxa de Genes recombinação Distância p–v 17% 17 UR p–r 9% 9 UR r–v 8% 8 UR
  • 51. Problema • Em Drosophila melanogaster, asa selvagem (normal) é dominante sobre asa miniatura; olho selvagem (marrom-avermelhado) é dominante sobre olho vermelho. Fêmeas selvagens puras foram cruzadas com machos de asa miniatura e olhos vermelhos. As fêmeas da geração F1 foram cruzadas com machos recessivos, produzindo a seguinte descendência:
  • 52. Problema  48,5 % asa selvagem / olho selvagem  48,5 % asa miniatura / olho vermelho  1,5 % asa selvagem / olho vermelho  1,5 % asa miniatura / olho selvagem  Pergunta-se: a) Qual é a evidência de que se trata de um caso de ligação gênica? b)Qual é a distância relativa entre os loci considerados?
  • 53. Solução a) Como se trata de um cruzamento-teste, o fenótipo da descendência é determinado pelo genótipo dos gametas produzidos pelo indivíduo com características dominantes. Assim, os tipos de óvulos que geraram cada uma das classes de descendentes são:
  • 54. Solução Fenótipos da Genótipo dos Porcentagem descendência óvulos selvagem / selvagem MV 48,5 % miniatura / vermelho mv 48,5 % selvagem / vermelho Mv 1,5 % miniatura / selvagem mV 1,5 % Percebe-se que não se trata de segregação independente porque os gametas femininos não ocorrem na proporção de 1:1:1:1 (25 % de cada tipo)
  • 55. Solução Trata-se, portanto, de um caso de ligação gênica incompleta, pois se formaram quatro classes fenotípicas, duas em maior frequência (classes parentes) e duas em menor frequência (classes recombinantes)
  • 56. Solução a) Estimamos a distância relativa entre os dois loci gênicos a partir da frequência de permutação entre eles. A frequência de permutação é igual à soma das frequências das classes recombinantes, ou seja, 3 % (1,5 % + 1,5 %). Assim, a distância entre esses dois loci é de 3 UR ou 3 centimorgans.
  • 57. Mapeamento gênico em eucariotos • Genes sobre cromossomos não homólogos segregam independentemente. • Genes sobre o mesmo cromossomo (sintênicos) estão fisicamente ligados (grupo de ligação) e podem ser herdados juntos. Objetivo: • Analisar a freqüência de recombinação alélica em cruzamentos; • Novas combinações de alelos parentais são produzidos por recombinação (“crossing-over” durante a meiose I); • Cruzamentos-teste são usados para determinar quais genes estão ligados e criar um mapa de ligação (mapa genético de cada cromossomo).
  • 58. Mapeamento Genético  Mapa genético ou cromossômico é a representação da posição dos genes no cromossomo.  Está diretamente relacionada a taxa de crossing.  Unidades de Recombinação (U.R.) ou Morganídeos (M) são as unidades usadas para determinar a posição dos genes no cromossomo e correspondem a taxa de crossing.  Exemplo: Em um cromossomo há a seguinte frequência de recombinação entre os genes A,B,C e D: A-B  45% A-C  20% C-B  25% B-D  5% C-D  20% A-D  40%
  • 59. Qual a posição dos genes no cromossomo? 20M 20M 5M A C D B 40M 45M
  • 62. Aplicação dos mapas geneticos Guia para o sequenciamento de genomas, pois mostra a posição de genes e dos e marcadores genéticos Tipos de mapas: Mapa Genético de ligação e Mapa Físico • Identificar genes relacionados a doenças herdadas • Analisar uma série de marcadores polimórficos em famílias com o gene de interesse.
  • 63. Como se faz? • Cromossomos individuais em muitas espécies animais tendem a ter cerca de 100 cM de comprimento (100 x 106 pb) • Assim, ocorre um “crossing over” por cromossomo por geração. • Marcadores localizados em cromossomos diferentes têm 50% de chance de “co-segregarem”, estando a 50 cM de distância. • 50 cM é o limite mínimo para se caracterizar dois marcadores como pertencentes ao grupo de ligação (“linkage group”) – ou ao mesmo cromossomo.
  • 64.
  • 65. Marcadores que co-segregam • Ainda assim, é possível, dois marcadores que se recombinem em 50% das vezes podem estar no mesmo grupo de ligação, desde que estejam relacionados a um terceiro marcador que mostre menos de 50% de recombinação com cada um dois primeiros marcadores
  • 66. RAPD Dominante DNA 100 - 1,500 bases Primers são separados em pouca distância, fragmento É AMPLIFICADO
  • 67. RAPD (Random Amplified Polymorphic DNA) A B A B
  • 68.
  • 69. Marcadores “dominantes” A1A1 A1A2 A2A2
  • 70. Marcadores “dominantes” 01 02 03 04 05 06 07 08 09 10 Ind. L1 L2 L3 L4 L5 L6 L7 L8 01 0 1 0 1 1 0 1 1 02 1 0 0 0 1 1 0 1 03 0 0 1 1 1 0 0 1 L1 L2 04 0 1 1 1 0 1 0 1 L3 05 1 1 0 0 1 1 0 1 L4 06 0 0 1 0 1 0 0 1 L5 07 0 1 1 0 1 0 0 0 L6 08 0 1 0 1 0 1 0 1 L7 09 1 0 1 0 0 0 0 1 L8 10 0 1 0 1 1 0 0 1
  • 71. Análise em gel de RAPD QUAIS AS POLIMÓRFICAS? QUAIS AS (CO)SEGREGANTES?
  • 72. Onde estão localizados no genoma os marcadores? Genoma Genes e sequências DNA extragênico relacionadas DNA codificante DNA não DNA repetitivo codificante RAPDs Introns Repetições em Repetições Fragmentos de tandem dispersas AFLPs genes outros Transposons Satélites Sequências de inserção Microssatélites Minissatélites
  • 73. Microsatélites • SSR – Simple Sequence Repeats • Pequenas sequências (“sequence motif”) com 1 a 4 nucleotídeos repetidos em tandem - Amplificados via PCR • Classe de marcadores moleculares mais polimórficos Sinonímias SSR (Simple Sequence Repeats); STMS (Sequence Tagged Microsatellites); SSLP (Single Sequence Length Polymorphisms); Onde são encontrados ??? Mamíferos: (CA)n ( 50.000 a 100.000 vezes no genoma) Plantas: (AT)n Mitocôndrias Cloroplastos
  • 74. M homozigoto heterozigoto Marcador co-dominante Marcador multialélico
  • 75.
  • 76. Marcadores “co-dominantes” A1 A1 A1 A2 A2 A2
  • 77. Marcadores “co-dominantes” Ind. L1 01 1/3 02 3/4 01 02 03 04 05 06 07 08 09 10 03 2/3 04 3/3 05 1/3 06 1/1 1 07 1/3 2 3 08 1/4 09 3/3 4 10 1/2
  • 78. Sequenciamento de regiões microssatélites
  • 79.
  • 80.
  • 81. Mapeamento genético de ligação • Identificar marcadores genéticos ligados aos genes de interesse, nos respectivos cromossomos; •Disponibilizados para as principais espécies de importância agronômica; •QTLs e/ou QRLs rastreados e etiquetados, visando uma melhoria na eficiência da seleção. AFLP Gene Vf (Sarna) Xu & Korban, 2000
  • 82. CARACTERIZAÇÃO BIOLÓGICA Fenotipagem (Locos de resistência) • Melrose x Gala – 86 plantas • M13/91 x Gala - 129 plantas • M13/91 x M46/94 -185 plantas
  • 83. M9 x Marubakaido - 85 F1 (QTLs - loci quantitativos) A B Perfilhos uniformes pulgão espinhos tipo spur Perfilhos uniformes
  • 84. Marcas segregantes Progênie F1 (Santa Rosa x Chatard) S C M
  • 86.
  • 88. Desenvolvimento de um SCAR (Sequence characterized amplified RAPD) • identificação de um iniciador que confere polimorfismo a dois bulks de DNA com fenótipos contrastantes, • o isolamento e a clonagem do fragmento amplificado em um vetor (plasmideo), • sequenciamento do fragmento isolado, • desenho dos iniciadores de tamanho maior que os decâmeros, • teste final em plantas.
  • 89. Validação das Marcas – Desenvolvimentos de marcadores específicos (Clonagem por mapeamento)
  • 90. Marcador Primer Gene Referencia RAPDS OPM18900 CACCATCCGT Vf Koller et al.,1994 OPU01400 ACGGACGTA Vf Koller et al.,1994 OPD20500 ACCCGGTCAC Vf Yang & Kruger, 1994 OPC081100 TGGACCGGTG Vf Tartarini 1996 OPC09900 CTCACCGTCC Vf Tartarini 1996 OPAL07580 CCGTCCATCC Vf Tartarini 1996 OPAM192200 CCAGGTCTTC Vf Tartarini 1996 OPA15900 TTCCGAACCC Vf Durham and Korban 1994 OPO141700 AGCATGGCTC Vf King et al. 1998 OPAF132000 CCGAGGTGAC Vf King et al. 1998 OPAG051900 CCCACTAGAC Vf King et al. 1998 OPAG12800 CTCCCAGGGT Vf King et al. 1998 SSR CH05e03 For:CGAATATTTTCACTCTGACTGGG Vbj M.Gygax (Frey et al.,2004) Rev:CAAGTTGTTGTACTGCTCCGA CH02B10 For: CAAGGAAATCATCAAAGATTCAAG Vr Hemmat et al.,2002 Rev: CAAGTGGCTTCGGATAGT CHVf1 For: ATCACCACCAGCAGCAAAG Vf C.Gessler (Frey et al.,2004) Rev: CATACAAATCAAAGCACAACCC CH02c06 For: TGACGAAATCCACTACTAATGCA Vr Baldi et al.,2004 Rev: GATTGCGCGCTTTTTAACAT CH02C02a For: CTTCAAGTTCAGCATCAAGACAA Vr2 Patocchi et al., 2003 Rev: TAGGGCACACTTGCTGGTC CH02B07 For: CCAGACAAGTCATCACAACACTC Vd Calenge et al., 2005 Rev: ATGTCGATGTCGCTCTGTTG Primers específicos Vf Vfa1 For: TCTATCTCAGTAGTTTCTATAATTCC Vf Xu & Korban (2002) Rev:GTAGTTACTCTCAAGATTAAGAACTT Vfa2 For: CTCAATCTCAGTAGTTTCTATGGA Vf Xu & Korban (2002) Rev: CCCCCGAGATTAAGAGTTG Vfa3 For:ATATTAGTAGTTTCTATAATCTGAAGG Vf Xu & Korban (2002) Rev:CCCCCGAGATTAAGAGATG Vfa4 For:TATCTCAATCTCAGTAGTAATAGTATC Vf Xu & Korban (2002) Rev:GACCTTGGAAACCACAATC AL07/SCAR 450 464 For: TCCTTACTGAGGAGGAAACCAG Tartarini et al. (1999) Rev: CAAGGGAACTGATCTTTCGTTG ARGH ARGH 25/CH02B07 For:CAAACATCATCGTAATTTTGACG Vd Baldi et al.,2004 Rev:CATACTCTTCATGAGGATAATTC ARGH37 For:TGCACGACATTAGCAACACTG Vr2 Baldi et al.,2004 Rev:GAAACAACTTCTTTTGAGAGTTC ARGH17 For:TTGCCGACGTTCGTGATGCT Vr2 Baldi et al.,2004 Rev:GATATCCTTTGTTTGGACAACC ARGH 34/CHVf1 For:TGTATGACCAGCCGAAGGTG Vf1 Baldi et al.,2004 REv:CCAGGACAACAATGTACCTC Seleção assistida por marcadores (SAM)
  • 91. Proteínas Atributos Isoenzimas de sementes RFLPs RAPDs Microssatélites AFLPs Nível de baixo alto baixo-alto baixo-alto muito alto muito alto Polimorfismo Estabilidade moderada alta alta alta alta alta ambiental Número de locos moderado (<50) baixo (<10) alto alto alto alto Expressão genética co-dominate co-dominante co-dominante dominante co-dominante dominante Número de alelos por 2-5 multialélico multialélico 2 multialélico 2 loco Distribuição no regiões de cópia regiões de cópia várias ao acaso ao acaso ao acaso genoma única única Acessibilidade muito alta muito alta média muito alta muito baixa média tecnológica Aplicabilidade no rápido, rápido, lento, rápido, baixo lento, custo alto rápido, custo melhoramento baixo custo baixo custo custo médio custo baixo Identificação de baixa baixa alta muito alta muito alta muito alta genótipos Avaliação de média baixa alta alta alta muito alta germoplasma Mapeamento baixa muito baixa alta alta muito alta alta genético Mapeamento de baixa inadequado média muito alta média muito alta regiões específicas Mapeamento baixa inadequado muito alta baixa alta baixa comparativo Genética de baixa baixa média alta muito alta muito alta Autógamas Genética de média baixa média alta muito alta muito alta Alógamas Análise Filogenética média baixa muito alta média alta média Adaptado de Gepts (1993) e Ferreira & Grattapaglia (1995).
  • 92. Mapas físicos É a distância entre posições de seqüências definidas de DNA expressa de kilo bases. •O mapa físico final é a seqüência completa. •Montagem de mapas físicos: • Alinhamento de clones isolados aleatórios com base em perfis de fragmentos de restrição. • Abordagem baseada em hibridizações: uma sonda comum é usada para identificar quais numa série de clones são provavelmente contíguos. • Sequenciamento de diferentes fragmentos de DNA e organização dos fragmentos pela análise de superposições (contigs) • Contigs podem ser estendidos pelo sequenciamento da extremidade de clones específicos, levando à identificação de “sequenced-tagged sites” – STSs.
  • 93. 5’..GTPyPuAC..3’ 3’..CAPuPyTG..5’ 5’..AAGCTT..3’ 3’..TTCGAA..5’ Mapa de restrição: duas moléculas de DNA com o mesmo mapa de restrição devem ser iguais.
  • 94. Os diferentes fragmentos de DNA são sequenciados e a partir dos mesmos vão sendo contruídas as seqüências contínuas CONTIGS
  • 95. Mapa físico Genoteca de BAC/YAC Mapa
  • 96. Mapa genético humano O primeiro mapa genético humano de alta resolução foi publicado em 1994. Em 2.000, mais de 1milhão de SNPs identificados. Um marcador polimórfico a cada ~2.000 pb. Marcadores genéticos são geralmente considerados como atributos do DNA: uma seqüência específica identificada em um dado locus (sequence tags) repetições simples (microssatélites) polimorfismo de restrição
  • 98.
  • 100. Melhoramento molecular (molecular breeding) Populações segregantes Expressão gênica - RNAm Marcador molecular Bibliotecas cDNA Polimorfismo Banco de dados Mapeamento de QRL/ QTL Seleção assistida Proteôma