SlideShare uma empresa Scribd logo
Fundamentos de Biologia MolecularFundamentos de Biologia Molecular
Principais conceitos da GenéticaPrincipais conceitos da Genética
Professora Dra. Adriana Dantas
UERGS – Caxias do Sul , RS
O que é genética ?
– Ramo da Biologia que estuda as leis da
transmissão dos caracteres hereditários
nos indivíduos, e as propriedades das
partículas que asseguram essa
transmissão (dicionário Aurélio).
– Genética Clássica – Mendel (1856-1865)
– Genética Moderna – Watson e Crick (1953)
Species Plantarum - 1753
Origin of Species - 1859
• Classificação de organismos é um aspecto fundamental de biologia
• Noção consistente de classificação deveria refletir a ‘ordem natural '
• Darwin - ordenação compartilhado com antepassados comuns
Carl Linnaeus introduziu
o binômio
(gênero-espécies)
sistema de classificação-
“ad majorem Dei gloriam”
(para a maior glória de
Deus)
Classificação de planta
baseado
somente em órgãos
sexuais
Taxonomia e evoluçãoTaxonomia e evolução
Hereditariedade
- Genética Clássica  unidade fundamental
da hereditariedade.
- O processo da hereditariedade, ao mesmo tempo
em que mantém semelhanças, também originam
mudanças.
- Indivíduos de uma espécie são “semelhantes” com
“diferenças” entre si também por causas genéticas
- Genética Moderna  pedaço de DNA que
codifica uma proteína.
Textos antigos
No Mishnah (200 DC)
Relatada a decisão do Patriarca Rabbi-
Judah que isenta o terceiro filho de uma
mulher de ser circuncidado, quando os seus
dois primeiros filhos morreram de
hemorragia depois da circuncisão.
Os rabinos constataram que tais
hemorragias ocorriam unicamente em certas
famílias.
Antes de 1860
O período que souberam que as “células
vinham de células” e da descoberta do
núcleo
– A descoberta da célula (30 x)
1665 – Robert Hook
– A descoberta do microscópio óptico (200 x)
1680 – Anton van Leeuwenhock. Analisando gotas de chuva
descobriram protozoas e bactérias
– A descoberta do núcleo
1833 – Robert Brown
– Descrição da mitose
1835 a 1839 - Hugo von Mohl
– A queda da teoria da “Geração expontânea”
1858 (término da era) Rudolf Wirchow “omnis cellula e cellula”
idem Pasteur
– A publicação do livro “Origem das Espécies”
1859 – Charles Darwin
1860 – 1900
A publicação do trabalho de Mendel à
descoberta dos cromossomos e seu
comportamento
– É publicado o trabalho "Experimentos em Hibridação de
Plantas”.
1865 (distribuído em 1866) - Gregor Mendel
– A fusão do esperma e do ovo e a formação do zigoto é
descrita
1879 a 1885 - O. Hertwig
– É descrito o corpúsculo cromossomo
(W. Flemming) notados por C. com Nägeli em 1842
– Os corpúsculos (cromossomos) dentro do núcleo eram os
portadores dos fatores hereditários
1883 - Wilhelm Roux
1860 – 1900
– Haviam estruturas individuais (cromossomos) passados de
uma geração para outra a despeito do seu
"desaparecimento" entre a divisão celulares
1880s - Theodor Boveri, K. Rabl e E. van Breden
– “A hereditariedade está baseada exclusivamente no
núcleo". Em 1887 previu a ocorrência da divisão
reducional, hoje chamada de "meiose“
1885 - August Weismann
– Foi usado o termo "cromossomo"
1888 - W. Waldeyer
O Tamanho das células
Formas e Funções
Célula vegetal
Célula bacteriana
Célula animal
1900 – 1944
O florescimento da genética.
O desenvolvimento da teoria cromossômica.
Bases da teoria da evolução
Avanço da genética molecular
– Redescoberta dos trabalhos de Gregor Mendel
1900 – (publicado em 1866), por Hugo de Vries, Carl Corens
e Erich von TschermaK
– 1903 – Walter Sutton justifica as “Leis de Mendel” e daí
para a descoberta de que os genes estão nos cromossomos.
– Criação do primeiro “mapa gênico”
1913 – Alfred Sturtevant estudando drosófilas
– Cunhada a palavra “gene”
– W. L. Johansen (1857 – 1927): um elemento físico
(partícula),
– determinava o desenvolvimento de uma característica
específica
– os indivíduos possuem aos pares (um herdado do pai e
outro da mãe) e os transmitem aos seus filhos.
1900 – 1944
(cont.)
– Mutação induzida
– 1927 – L. Stadler e H.J. Müller “Os genes podem
ser mutados artificialmente usando-se raios X”
– Métodos quantitativos aplicados à genética
– 1930 – 1932 R.A. Fisher; S. Wright e J.B.S.
Haldane: desenvolveram as bases algébricas para
a nossa compreensão de como ocorre o processo
evolutivo
– Bactérias como objetos de estudo
– 1943 – S. Luria e M. Delbrück demonstraram que
bactérias seguem padrões normais em termos
genéticos
1944 – Presente
É a era da “genética molecular”.
Tecnologia do DNA recombinante
Terapia genética
GENOMA (estrutural e funcional)
PROTEÔMA METABÔLOMA, OUTRAS OMAS
– O DNA como material genético
1944 – O. T. Avery, C.M. McLeod e M. McCarty. Demonstraram que o
componente transformante das Bactérias Diplococcus pneumoniae era o
DNA
– Definição da estrutura do DNA
1953 – James Watson e Francis Crick
– Descrição da endonucleases
1968 – 1973 W. Arbert, H. Smith, D. Nathans e colaboradores descreveram
“as enzimas que abriram as portas para a manipulação do DNA” que levou
a tecnologia do DNA recombinante.
– Formação do primeiro DNA recombinante
1972 – Paul Berg
Conceito Gerais
• Gene: fragmento de DNA que pode ser transcrito na síntese de
proteínas.
• Locus (Loco): local, no cromossomo, onde se encontra o gene.
• Alelos: genes que ocupam o mesmo locus em cromossomos
homólogos.
• Homólogos: cromossomos que possuem genes para as mesmas
características.
• Genótipo: conjunto de genes de um indivíduo.
• Fenótipo: características observáveis de uma espécie, que são
determinadas por genes e que podem ser alteradas pelo
Fenótipo x Genótipo
– Constituição gênica do indivíduo, isto é, são os genes que ele
possui em suas células e que foram herdados dos seus pais.
– Representado por letras. Ex.: A, z, T, b ...
– Os avanços da revolução verde (produção é fenótipo) não se
devem apenas à genética (genótipo), mas também à
mecanização, fertilização, uso dos “cidas”, irrigação, nutrição
animal, sanidade, etc.(ambiente).
Fenótipo = genótipo + ambiente
e o que se observa é fenótipo !
FENÓTIPO
– São as características manifestadas por um indivíduo.
– São características morfológicas, fisiológicas ou
comportamentais.
– É determinado pelo fenótipo, mas pode ser modificado
pelo ambiente.
FenótipoFenótipo
F = G + AF = G + A
(Fenótipo é igual ao genótipo do indivíduo mais a(Fenótipo é igual ao genótipo do indivíduo mais a
ação do ambiente).ação do ambiente).
Ex.: cor de pele, textura do cabelo, tipoEx.: cor de pele, textura do cabelo, tipo
sangüíneo, etc.sangüíneo, etc.
Cromossomos HomólogosCromossomos Homólogos
São cromossomos que apresentam genesSão cromossomos que apresentam genes
para as mesmas características para aspara as mesmas características para as
mesmas posições.mesmas posições.
Um homólogo veio do pai e outro da mãe.Um homólogo veio do pai e outro da mãe.
Óvulo  n
Espermatozóide  n
Zigoto  2n
Tamanho
do Pé
Cor de
Cabelo
Tipo
Sanguíneo
Temperamento
Tamanho
do Pé
Cor de
Cabelo
Tipo
Sanguíneo
Temperamento
P
c
IA
a
P
C
IB
a
Genes
alelos
Alelos - Genes presentes nos mesmos locais nos cromossomos homólogos
• Os caracteres biológicos são determinados por
GENES ou FATORES ( segundo Mendel )
existentes nos CROMOSSOMOS e são
transmitidos de uma geração para outra por
meio dos GAMETAS durante a reprodução.
• Os genes que o indivíduo possui para uma
determinada característica constituem o
GENÓTIPO, e o referido CARÁTER em
interação com o meio constitui o FENÓTIPO.
Homozigose
– Seres diplóides apresentam duas cópias de cada
gene  cada um em um cromossomo homólogo.
– O indivíduo homozigoto apresenta dois alelos de
um gene iguais, sejam eles genes dominantes ou
recessivos.
– Ex: AA, bb, ZZ, pp....
Heterozigose
– Indivíduos que apresentam dois alelos
DIFERENTES de um gene são chamados
heterozigotos.
– Ex.: Aa, Bb, Pp, IA
IB
, Zz......
Dominância
– Alelos que se expressam da mesma forma
nas condições homozigótica e
heterozigótica são chamados dominantes.
– Ex: Indivíduos RR e Rr para o fator Rh são
Rh+.
Recessividade
– Alelos que não se expressam na condição
heterozigótica são denominados
recessivos.
– Ex.: o alelo r, uma vez que um indivíduo rr
é Rh-
.
Produção de GametasProdução de Gametas
Que tipo de gametas um indivíduo Aa pode produzir?
A a
Diploide (2n)
A
a
Que tipo de gametas os indivíduos abaixoQue tipo de gametas os indivíduos abaixo
podem produzir?podem produzir?
AAAA
BbBb
BbBb
AABBAABB
aabbaabb
AAbbAAbb
AaBbAaBb
Qual é a probabilidade de:Qual é a probabilidade de:
Um indivíduo homozigoto dominanteUm indivíduo homozigoto dominante
formar um gameta A?formar um gameta A?
Um indivíduo heterozigoto formar umUm indivíduo heterozigoto formar um
gameta A?gameta A?
A partir dos cruzamentos os geneticistas podem
prever a transmissão dos genes em uma família.
É utilizado o “quadro de Punnett”.
Gametas
produzidos
pelo pai
Gametas
produzidos pela
mãe
Cruzamento
Quadrado de Punnet
A a
A AA Aa
a Aa aa
MODELO DO DNAMODELO DO DNA
Watson e Crick propuseram, em 1953, um
modelo de molécula de DNA, que seria em
DUPLA HÉLICE e em ESPIRAL, com duas
cadeias de nucleotídeos ligados por
PONTES DE HIDROGÊNIO.
1- a molécula de DNA era grande, longa, fina e
composta de nucleotídeos: adenina; guanina;
timina e citosina;
2- Os estudos de difração de raios X,
realizados por Maurice King e Rosalind
Franklin sugeriam a forma helicoidal;
3- Linus Pauling (1950), descreveu a estrutura
helicoidal com um filamento mantida por
pontes de hidrogênio em proteínas e sugeriu
que o mesmo pudesse ocorrer com o DNA;
4- Erwin Chargaff havia demonstrado que a
proporção entre os nucleotídeos A e T era
de 1:1, o mesmo acontecendo entre G e C.
Difração de Raios-X
34A
Estrutura Molecular
Modelo de molécula
de DNA, que seria
em DUPLA HÉLICE e
em ESPIRAL, com
duas cadeias de
nucleotídeos ligados
por PONTES DE
HIDROGÊNIO.
DNA
O Ácido Desoxirribonucléico é
um polinucleotídeo formado
por duas“fitas” ou hélices
ligadasentre si por pontes de
hidrogênio entre asbases
nitrogenadas.
O pareamento dasbases
sempre segue a mesma ordem:
Adenina com Timina e Guanina
com Citosina.
igações entre Nucleotídeos
Polímero longoPolímero longo
1. A ligação entre a base nitrogenada e
a pentose é feita covalentemente
através de uma ligação N-glicosídica
com a hidroxila ligada ao carbono-1 da
pentose.
•2. Os nucleotídeos são unidos por
ligações fosfodiéster covalentes que
ligar o carbono 5´de um grupo
desoxirribose (pentose + base) ao
carbono 3´do próximo
Base
Pentose
1
2
4
1
2
Bases Nitrogenadas
GuaninaAdenina
Purinas
Citosina Timina Uracil
Pirimidinas
1. Transportar muita informação, de célula para célula e de
geração para geração;
2. Capacidade de produzir cópias exatas de si mesmo, pois os
cromossomos são copiados em cada divisão celular;
3. Capacidade de “replicar erros” de cópia, como se fossem o
gene original;
4. Apresenta mecanismo de decodificação da informação
armazenada, traduzindo-as através da produção de
enzimas/proteínas;
A Importância do DNAA Importância do DNA
A molécula da vida
1. O DNA é chamado de “molécula da vida” pois
contém o código pra construção das proteínas em
todos os seres vivos;
2. Nos eucariontes, o DNA é encontrado no núcleo
celular formando os cromossomos e também nas
mitocôndrias e nos cloroplastos;
3. Nos procariontes encontra-se uma molécula de
DNA circular (cromossomo bacteriano) e outras
moléculas circulares chamadas plasmídeos;
Wilkins, Perutz, Crick, Steinbeck, Watson, Kendrew
aa aa aa aa aa aa aa aa
Proteína
CTC ATT GTG CTT GAA TTT TTG GTG
DNA
GAG UAA CAC GAA CUU AAA AAC CAC
mRNA
• O que são os
cromossomos?
• O que eles contém?
DNA constituído por nucleotídeos
CCTGATGGATCGCGTACGTTGTACGCACAGTGTCGAAAAAG
CATACGGGGACTGCACGTACACGTAGCACGGCGTCGATTTT
GACGTGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTG
CAGCGTGTGTACCCATGCGCGAAGTATGT
C
T
G
G
A
C
T
CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTG
TCGAAAAAGCATACGGGGACTGCACGTACACGTAGCAC
GGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGT
GAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAA
GTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTG
TCGAACAAGCATACGGGGACTGCACCCCGATGTAGCAC
GGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCT
GAGTGAAGGATCAGTGCAGCGTGGAGCGCGCATGAAAA
CACACATTGTATCGACAGTTGTACGCACAGTGTCGAGG
GCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTC
GCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGA
AGGATCAGTGCAGCGGGCAGATGTAATATATATGATTT
GATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGA
CACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
CCTGATGGATCGCGTACGTTGTACGCACAGTGTCGAAA
AAGCATACGGGGACTGCACGTACACGTAGCACGGCGTC
GATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGA
CACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
Homem
GTGGATGGATCGCGGCAGTTGTACGCACAGTGTCGAAC
AAGCATACGGGGACTGCACCCCGATGTAGCACGGCGTC
GATTTTGACGTGCACGTGTCAGTGCGAAATCTGAGTGA
AGGATCAGTGCAGCGTGGAGCGCGCATGAAAAATAGGA
Bactéria
CACACATTGTATCGACAGTTGTACGCACAGTGTCGAGG
GCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTC
GCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGA
AGGATCAGTGCAGCGGGCAGATGTAATATATATGATTT
Vírus
CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTG
TCGAAAAAGCATACGGGGACTGCACGTACACGTAGCAC
GGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGT
GAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAA
GTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTG
TCGAACAAGCATACGGGGACTGCACCCCGATGTAGCAC
GGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCT
GAGTGAAGGATCAGTGCAGCGTGGAGCGCGCATGAAAA
CACACATTGTATCGACAGTTGTACGCACAGTGTCGAGG
GCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTC
GCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGA
AGGATCAGTGCAGCGGGCAGATGTAATATATATGATTT
GATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGA
CACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTG
TCGAAAAAGCATACGGGGACTGCACGTACACGTAGCAC
GGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGT
GAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAA
GTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTG
TCGAACAAGCATACGGGGACTGCACCCCGATGTAGCAC
GGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCT
GAGTGAAGGATCAGTGCAGCGTGGAGCGCGCATGAAAA
CACACATTGTATCGACAGTTGTACGCACAGTGTCGAGG
GCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTC
GCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGA
AGGATCAGTGCAGCGGGCAGATGTAATATATATGATTT
GATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGA
CACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTG
TCGAAAAAGCATACGGGGACTGCACGTACACGTAGCAC
GGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGT
GAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAA
GTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTG
TCGAACAAGCATACGGGGACTGCACCCCGATGTAGCAC
GGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCT
GAGTGAAGGATCAGTGCAGCGTGGAGCGCGCATGAAAA
CACACATTGTATCGACAGTTGTACGCACAGTGTCGAGG
GCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTC
GCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGA
AGGATCAGTGCAGCGGGCAGATGTAATATATATGATTT
GATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGA
CACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTG
TCGAAAAAGCATACGGGGACTGCACGTACACGTAGCAC
GGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGT
GAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAA
GTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTG
TCGAACAAGCATACGGGGACTGCACCCCGATGTAGCAC
GGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCT
GAGTGAAGGATCAGTAGGTCGTGGAGCGCGCATGAAAA
CACACATTGTATCGACAGTTGTACGCACAGTGTCGAGG
GCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTC
GCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGA
AGGATCAGTGCAGCGGGCAGATGTAATATATATGATTT
GATTTTGACGTGCACGTGTCAGTGCGATGAAGGAGTGA
CACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTG
TCGAAAAAGCATACGGGGACTGCACGTACACGTAGCAC
GGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGT
GAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAA
GTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTG
TCGAACAAGCATACGGGGACTGCACCCCGATGTAGCAC
GGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCT
GAGTGAAGGATCAGTAGGTCGTGGAGCGCGCATGAAAA
CACACATTGTATCGACAGTTGTACGCACAGTGTCGAGG
GCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTC
GCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGA
AGGATCAGTGCAGCGGGCAGATGTAATATATATGATTT
GATTTTGACGTGCACGTGTCAGTGCGATGAAGGAGTGA
CACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
ORGANIZAÇÃO GENÔMICA DE
EUCARIONTES
Formação de proteínas
Código genético
TraduçãoTradução
Molécula de mRNA
A U G G C A U G C G A C G A A U U C G G A C A C A U A
Cys
Met
Ala
5’ 3’
Asp
Glu
Phe
His
Direção do avanço do ribossomo
Ribossomo
Proteína
tRNA
AA livre
codon
Gly
Cada códon é traduzido num AA específico
G A C G A A U U C G G A C A C A U A A A A U U A A U G
Met
Met
Ala
Cys
Asp
Glu
Phe
Gly
His
Ile
Lys
Leu
5’ 3’
Asn
A U A A A A U U A A U G A A C C C A C A A U A A T A C
Ala Cys Asp Glu Phe
Met Gly
His
Ile
Gln Lys
Pro Leu
Asn Met
5’ 3’
RNAm será degradado
Ala Cys Asp Glu Phe
Met Gly
His
Ile
Gln Lys
Pro Leu
Asn Met
PROTEÍNA NORMALPROTEÍNA NORMAL
Organismos modelo usado em estudos
de genética
Mais usadosMais usados
Arabidopsis thalianaArabidopsis thaliana
Drosofila melanogasterDrosofila melanogaster
Escherichia coliEscherichia coli
VírusVírus
RetrovírusRetrovírus
MilhoMilho
LevedurasLeveduras
OutrosOutros
Porquinhos-da-índiaPorquinhos-da-índia
GatosGatos
GalinhasGalinhas
Guppy (Guppy (Poecilia reticulataPoecilia reticulata))
Peixes elétricosPeixes elétricos
ErvilhasErvilhas
HomemHomem 3.200.000.000 bases3.200.000.000 bases
RatoRato 3.000.000.000 bases3.000.000.000 bases
DrosophilaDrosophila 160.000.000 bases160.000.000 bases
ArabidopsisArabidopsis 135.000.000 bases135.000.000 bases
S. cerevisaeS. cerevisae 13.000.000 bases13.000.000 bases
X. fastidiosaX. fastidiosa 2.679.572 bases2.679.572 bases
H. influenzaeH. influenzae 1.830.000 bases1.830.000 bases
M. pneumoniaeM. pneumoniae 810.000 bases810.000 bases
HTLV-IIHTLV-II 8.952 bases8.952 bases
TAMANHO DO GENOMATAMANHO DO GENOMA
Tamanho do
genoma
Número de genes
- Os cromossomos das mitocôndrias e
dos cloroplastos apresentam padrão
de organização e herança bem
diferente dos cromossomos
nucleares;
- Os genes extranucleares também
chamados genes citoplasmáticos;
Genoma Mitocondrial
- A maioria das proteínas das mitocôndrias e dos
cloroplastos são codificadas pelo DNA nuclear e
importados do citosol para s organelas;
- O DNA das organelas celulares são circulares;
- São relativamente pequenas e simples;
- Não ocorre recombinação (somente mutação);
- Herança não-mendedliana (citoplasmática, herança
da mãe) Marcador de linhagem materna.
O genoma cloroplasto
– Sequencia no genoma varia de
70kb - 201kb
– 100-250 genes:
– Gene expressos
– Fotossíntese – 20 genes
– Metabolismo
Sequenciamento completo:
Tabaco - 155,844 pb;
Arroz -134,525 pb
GENOMA MITOCONDRIALGENOMA MITOCONDRIAL
• Análise maternal
• Filogenia Sistemática
•Genética de populações
•Teste forensi (maternal ID)
• Tamanho do mtDNA
Humanos e outrros vertebrados ~16 kb
(todos genes mtDNA codificam produtos)
Leveduras ~80 kb
Plantas ~100 kb to 2 Mb
(muitos genes mtDNA não codificam produtos)
Marchantia polymorpha – 121Kb
136 genes: 4 rRNA, 29tRNA
90 genes codificadores de proteínas - destes 20 estão envolvidas no
transporte de elétrons durante a fotossíntese
Genômica?
• Genômica é estudo de todos os genes
em um organismo……..
• Proteômica é estudo de todas as
proteínas…..
• Metabolômica sé o estudo de todas as
vias metabólicas…
Cultivares antigas domesticadas
A diversidade humana
Drosofila melanogaster
Escherichia coli
Plantas Modelos
• Arabidiopsis thaliana
--modelo florescimento e dicotiledônea
• Oryza sativa (rice)
--modelo monocotiledônea
• Medicago truncatula (barrel medic)
--modelo leguminosas
• Lycopersicon esculentum (tomato)
--modelo de frutificação
Também, milho, tabaco, trigo, etc.…
Arabidopsis thalianaArabidopsis thaliana
Rapido crescimento
Brassicaceae
Genome: 125 Mb ( muito pequeno )
Cromossomos: 5
Genes: 25.498
Website: http://www.arabidopsis.org
Oryza sativa
Genome: 430 Mb (1/8 do genoma humano)
Um dos menores genomas de gramíneas
Cromossomos: 12
Genes: ~ 50,000 (mais do que genoma humano)
http://www.usricegenome.org
Do arroz (Oryza sativa) tem se seqüenciado
duas variedades e seu genoma é quase 4 vezes
maior que o de A. thaliana e compreendem de
32.000 a 55.615 genes.
AS ÁREAS DA GENÉTICA
ClássicaClássica MolecularMolecular EvolutivaEvolutiva
-Os Princípios de-Os Princípios de
MendelMendel
-Meiose e Mitose-Meiose e Mitose
-Determinação do-Determinação do
SexoSexo
-Herança Ligada ao-Herança Ligada ao
SexoSexo
-Mapeamento-Mapeamento
CromossômicoCromossômico
-Citogenética-Citogenética
(mudanças(mudanças
cromossômicas)cromossômicas)
-Estrutura do DNA-Estrutura do DNA
-Química do DNA-Química do DNA
-Transcrição-Transcrição
-Tradução-Tradução
-Clonagem do DNA-Clonagem do DNA
-Controle da Expressão-Controle da Expressão
GênicaGênica
-Mutação do DNA e-Mutação do DNA e
ReparoReparo
-Heranças-Heranças
ExtracromossômicaExtracromossômica
-Genética Quantitativa-Genética Quantitativa
-O equilíbrio de Hardy-O equilíbrio de Hardy
& Weinberg& Weinberg
-Pressuposições para-Pressuposições para
o Equilíbrio de H&Wo Equilíbrio de H&W
-Evolução-Evolução
-Especiação-Especiação
As áreas de estudo
Hoje em dia, os limites entre estas 3 áreas estão sendo permeabilizados
pelas técnicas de genética molecular
ClássicaClássica MolecularMolecular EvolutivaEvolutiva
Relativa a teoriaRelativa a teoria
cromossômica dacromossômica da
hereditariedade. Ohereditariedade. O
conceito de queconceito de que
genes estãogenes estão
alocados em formaalocados em forma
linear noslinear nos
cromossomos ecromossomos e
que a sua posiçãoque a sua posição
relativa pode serrelativa pode ser
avaliada em funçãoavaliada em função
da sua frequênciada sua frequência
nas progênies.nas progênies.
É o estudo doÉ o estudo do
material genético emmaterial genético em
si, sua estrutura,si, sua estrutura,
replicação ereplicação e
expressão. Tambémexpressão. Também
aborda os estudosaborda os estudos
emanados daemanados da
tecnologia do DNAtecnologia do DNA
recombinante (eng.recombinante (eng.
Genética).Genética).
É o estudo dosÉ o estudo dos
mecanismos demecanismos de
evolução. Osevolução. Os
mecanismos dasmecanismos das
mudanças demudanças de
freqüências nasfreqüências nas
populações.populações.
Como (in)gerir as novas
conquistas da genética ?
– Bioética: bios (vida) + ethos (relativo à ética)
– O progresso técnico deve ser controlado segundo a
consciência da humanidade para que as novas descobertas
e suas aplicações não tenham efeitos desastrosos no
mundo, na sociedade ou sejam postos a serviço de
interesse escusos.

Mais conteúdo relacionado

Mais procurados

Genética: Noções de Hereditariedade
Genética: Noções de HereditariedadeGenética: Noções de Hereditariedade
Genética: Noções de Hereditariedade
Governo do Estado do Rio Grande do Sul
 
Evolução biológica
Evolução biológicaEvolução biológica
Evolução biológica
César Milani
 
Caracteristicas gerais dos seres vivos
Caracteristicas gerais dos seres vivosCaracteristicas gerais dos seres vivos
Caracteristicas gerais dos seres vivos
César Milani
 
Biotecnologia
Biotecnologia Biotecnologia
Núcleo celular
Núcleo celularNúcleo celular
Núcleo celular
César Milani
 
Slides da aula de Biologia (Marcelo) sobre Genética
Slides da aula de Biologia (Marcelo) sobre GenéticaSlides da aula de Biologia (Marcelo) sobre Genética
Slides da aula de Biologia (Marcelo) sobre Genética
Turma Olímpica
 
Reprodução Humana
Reprodução HumanaReprodução Humana
Reprodução Humana
Sérgio Luiz
 
Genetica hereditariedade
Genetica hereditariedadeGenetica hereditariedade
Genetica hereditariedade
Adrianne Mendonça
 
Aulão a origem da vida
Aulão a origem da vidaAulão a origem da vida
Aulão a origem da vida
César Milani
 
Biologia- Virus
Biologia- VirusBiologia- Virus
Biologia- Virus
Slides de Tudo
 
2ª lei de mendel
2ª lei de mendel2ª lei de mendel
2ª lei de mendel
Iuri Fretta Wiggers
 
Nutrientes
NutrientesNutrientes
Nutrientes
cn2012
 
Slide Genética
Slide GenéticaSlide Genética
Genetica
GeneticaGenetica
Genetica
emanuel
 
(5) 2008-2009 - 9º ano - noções básicas de hereditariedade
(5)   2008-2009 - 9º ano - noções básicas de hereditariedade(5)   2008-2009 - 9º ano - noções básicas de hereditariedade
(5) 2008-2009 - 9º ano - noções básicas de hereditariedade
Hugo Martins
 
Bactérias e Vírus
Bactérias e VírusBactérias e Vírus
Bactérias e Vírus
Isabel Lopes
 
Células
CélulasCélulas
Células
Cláudia Moura
 
Reprodução assexuada e sexuada
Reprodução assexuada  e sexuadaReprodução assexuada  e sexuada
Reprodução assexuada e sexuada
Matheus Faria do Valle
 
Aula de genética 1 lei de mendel
Aula de genética   1 lei de mendelAula de genética   1 lei de mendel
Aula de genética 1 lei de mendel
Marcionedes De Souza
 
Aula relações ecológicas
Aula relações ecológicasAula relações ecológicas
Aula relações ecológicas
Gabriela de Lima
 

Mais procurados (20)

Genética: Noções de Hereditariedade
Genética: Noções de HereditariedadeGenética: Noções de Hereditariedade
Genética: Noções de Hereditariedade
 
Evolução biológica
Evolução biológicaEvolução biológica
Evolução biológica
 
Caracteristicas gerais dos seres vivos
Caracteristicas gerais dos seres vivosCaracteristicas gerais dos seres vivos
Caracteristicas gerais dos seres vivos
 
Biotecnologia
Biotecnologia Biotecnologia
Biotecnologia
 
Núcleo celular
Núcleo celularNúcleo celular
Núcleo celular
 
Slides da aula de Biologia (Marcelo) sobre Genética
Slides da aula de Biologia (Marcelo) sobre GenéticaSlides da aula de Biologia (Marcelo) sobre Genética
Slides da aula de Biologia (Marcelo) sobre Genética
 
Reprodução Humana
Reprodução HumanaReprodução Humana
Reprodução Humana
 
Genetica hereditariedade
Genetica hereditariedadeGenetica hereditariedade
Genetica hereditariedade
 
Aulão a origem da vida
Aulão a origem da vidaAulão a origem da vida
Aulão a origem da vida
 
Biologia- Virus
Biologia- VirusBiologia- Virus
Biologia- Virus
 
2ª lei de mendel
2ª lei de mendel2ª lei de mendel
2ª lei de mendel
 
Nutrientes
NutrientesNutrientes
Nutrientes
 
Slide Genética
Slide GenéticaSlide Genética
Slide Genética
 
Genetica
GeneticaGenetica
Genetica
 
(5) 2008-2009 - 9º ano - noções básicas de hereditariedade
(5)   2008-2009 - 9º ano - noções básicas de hereditariedade(5)   2008-2009 - 9º ano - noções básicas de hereditariedade
(5) 2008-2009 - 9º ano - noções básicas de hereditariedade
 
Bactérias e Vírus
Bactérias e VírusBactérias e Vírus
Bactérias e Vírus
 
Células
CélulasCélulas
Células
 
Reprodução assexuada e sexuada
Reprodução assexuada  e sexuadaReprodução assexuada  e sexuada
Reprodução assexuada e sexuada
 
Aula de genética 1 lei de mendel
Aula de genética   1 lei de mendelAula de genética   1 lei de mendel
Aula de genética 1 lei de mendel
 
Aula relações ecológicas
Aula relações ecológicasAula relações ecológicas
Aula relações ecológicas
 

Semelhante a Introdução a genetica

Herança Genética
Herança GenéticaHerança Genética
Herança Genética
Grazi Grazi
 
Introduçao a genetica
Introduçao a geneticaIntroduçao a genetica
Introduçao a genetica
emibio
 
8 ano GENÉTICA BÁSICA
8 ano GENÉTICA BÁSICA8 ano GENÉTICA BÁSICA
8 ano GENÉTICA BÁSICA
Sarah Lemes
 
Hereditariedade
HereditariedadeHereditariedade
Hereditariedade
claudiaromao
 
(2) património genético
(2) património genético(2) património genético
(2) património genético
Hugo Martins
 
Conceitos basicos de Genetica ppt.pdf
Conceitos basicos de Genetica ppt.pdfConceitos basicos de Genetica ppt.pdf
Conceitos basicos de Genetica ppt.pdf
ErickSilva623305
 
9_ano_atividade_de_ciencias_007.pdf
9_ano_atividade_de_ciencias_007.pdf9_ano_atividade_de_ciencias_007.pdf
9_ano_atividade_de_ciencias_007.pdf
ssuserfae471
 
Conceitos básicos de genética aula 2 2012.2 eja
Conceitos básicos de genética   aula 2 2012.2 ejaConceitos básicos de genética   aula 2 2012.2 eja
Conceitos básicos de genética aula 2 2012.2 eja
Hélida Mesquita
 
3 genetica
3   genetica3   genetica
3 genetica
Henrique Vieira
 
Genética
GenéticaGenética
Biologia genética
Biologia  genéticaBiologia  genética
Biologia genética
Keilla Lima
 
Genética
GenéticaGenética
Genética
JordanCoutinho
 
Hereditariedade.pptx
Hereditariedade.pptxHereditariedade.pptx
Hereditariedade.pptx
thaismachado57
 
9º 4.1
9º 4.19º 4.1
9º 4.1
Nuno Coelho
 
Introdução à genética
Introdução à genéticaIntrodução à genética
Introdução à genética
Andrey Moreira
 
genetica conceitos basicos (2020_03_19 15_11_22 UTC).ppt
genetica conceitos  basicos (2020_03_19 15_11_22 UTC).pptgenetica conceitos  basicos (2020_03_19 15_11_22 UTC).ppt
genetica conceitos basicos (2020_03_19 15_11_22 UTC).ppt
HerminioMendes3
 
Hereditariedade
HereditariedadeHereditariedade
Hereditariedade
tigsilva
 
Aula 21 e_22
Aula 21 e_22Aula 21 e_22
Aula 21 e_22
Maria Pires
 
Genetica conceitos basicos
Genetica conceitos  basicosGenetica conceitos  basicos
Genetica conceitos basicos
JosEzequiel2
 
1. Aula-Princípios de Genética - GENETICA CLASSICA E MODERNA.pptx
1. Aula-Princípios de Genética - GENETICA CLASSICA E MODERNA.pptx1. Aula-Princípios de Genética - GENETICA CLASSICA E MODERNA.pptx
1. Aula-Princípios de Genética - GENETICA CLASSICA E MODERNA.pptx
RailsonLima8
 

Semelhante a Introdução a genetica (20)

Herança Genética
Herança GenéticaHerança Genética
Herança Genética
 
Introduçao a genetica
Introduçao a geneticaIntroduçao a genetica
Introduçao a genetica
 
8 ano GENÉTICA BÁSICA
8 ano GENÉTICA BÁSICA8 ano GENÉTICA BÁSICA
8 ano GENÉTICA BÁSICA
 
Hereditariedade
HereditariedadeHereditariedade
Hereditariedade
 
(2) património genético
(2) património genético(2) património genético
(2) património genético
 
Conceitos basicos de Genetica ppt.pdf
Conceitos basicos de Genetica ppt.pdfConceitos basicos de Genetica ppt.pdf
Conceitos basicos de Genetica ppt.pdf
 
9_ano_atividade_de_ciencias_007.pdf
9_ano_atividade_de_ciencias_007.pdf9_ano_atividade_de_ciencias_007.pdf
9_ano_atividade_de_ciencias_007.pdf
 
Conceitos básicos de genética aula 2 2012.2 eja
Conceitos básicos de genética   aula 2 2012.2 ejaConceitos básicos de genética   aula 2 2012.2 eja
Conceitos básicos de genética aula 2 2012.2 eja
 
3 genetica
3   genetica3   genetica
3 genetica
 
Genética
GenéticaGenética
Genética
 
Biologia genética
Biologia  genéticaBiologia  genética
Biologia genética
 
Genética
GenéticaGenética
Genética
 
Hereditariedade.pptx
Hereditariedade.pptxHereditariedade.pptx
Hereditariedade.pptx
 
9º 4.1
9º 4.19º 4.1
9º 4.1
 
Introdução à genética
Introdução à genéticaIntrodução à genética
Introdução à genética
 
genetica conceitos basicos (2020_03_19 15_11_22 UTC).ppt
genetica conceitos  basicos (2020_03_19 15_11_22 UTC).pptgenetica conceitos  basicos (2020_03_19 15_11_22 UTC).ppt
genetica conceitos basicos (2020_03_19 15_11_22 UTC).ppt
 
Hereditariedade
HereditariedadeHereditariedade
Hereditariedade
 
Aula 21 e_22
Aula 21 e_22Aula 21 e_22
Aula 21 e_22
 
Genetica conceitos basicos
Genetica conceitos  basicosGenetica conceitos  basicos
Genetica conceitos basicos
 
1. Aula-Princípios de Genética - GENETICA CLASSICA E MODERNA.pptx
1. Aula-Princípios de Genética - GENETICA CLASSICA E MODERNA.pptx1. Aula-Princípios de Genética - GENETICA CLASSICA E MODERNA.pptx
1. Aula-Princípios de Genética - GENETICA CLASSICA E MODERNA.pptx
 

Mais de UERGS

Aula 1 - Biodiversidade e os Recursos Genéticos [Salvo automaticamente].pptx
Aula 1 - Biodiversidade e os Recursos Genéticos [Salvo automaticamente].pptxAula 1 - Biodiversidade e os Recursos Genéticos [Salvo automaticamente].pptx
Aula 1 - Biodiversidade e os Recursos Genéticos [Salvo automaticamente].pptx
UERGS
 
Nutrigenômica e nutrigenética
Nutrigenômica e nutrigenéticaNutrigenômica e nutrigenética
Nutrigenômica e nutrigenética
UERGS
 
Princípios gerais da conservação de alimentos
Princípios gerais da conservação de alimentosPrincípios gerais da conservação de alimentos
Princípios gerais da conservação de alimentos
UERGS
 
Definição, classificação, composição e conservação aula 2
Definição, classificação, composição e conservação aula 2Definição, classificação, composição e conservação aula 2
Definição, classificação, composição e conservação aula 2
UERGS
 
Conservação por utilização de temperaturas
Conservação por utilização de temperaturasConservação por utilização de temperaturas
Conservação por utilização de temperaturas
UERGS
 
Conservação pelo uso do frio
Conservação pelo uso do frioConservação pelo uso do frio
Conservação pelo uso do frio
UERGS
 
Tópicos especiais biodiesel
Tópicos especiais   biodieselTópicos especiais   biodiesel
Tópicos especiais biodiesel
UERGS
 
Bioquimica de alimentos proteases
Bioquimica de alimentos   proteasesBioquimica de alimentos   proteases
Bioquimica de alimentos proteases
UERGS
 
Bioquimica da maturação das frutas
Bioquimica da maturação das frutasBioquimica da maturação das frutas
Bioquimica da maturação das frutas
UERGS
 
Controle do amadurecimento e senescência dos frutos
Controle do amadurecimento e senescência dos frutosControle do amadurecimento e senescência dos frutos
Controle do amadurecimento e senescência dos frutos
UERGS
 
Instrumentos óticos
Instrumentos óticosInstrumentos óticos
Instrumentos óticos
UERGS
 
Analise espectro eletromagnética
Analise espectro eletromagnéticaAnalise espectro eletromagnética
Analise espectro eletromagnética
UERGS
 
Bioquímica de alimentos - Carboidrases
Bioquímica de alimentos - CarboidrasesBioquímica de alimentos - Carboidrases
Bioquímica de alimentos - Carboidrases
UERGS
 
Enzimas
EnzimasEnzimas
Enzimas
UERGS
 
Recuperação de áreas degradadas
Recuperação de áreas degradadasRecuperação de áreas degradadas
Recuperação de áreas degradadas
UERGS
 
Segurança alimentar e ogms
Segurança alimentar e ogmsSegurança alimentar e ogms
Segurança alimentar e ogms
UERGS
 
Impacto ambiental, analise de riscos
Impacto ambiental, analise de riscosImpacto ambiental, analise de riscos
Impacto ambiental, analise de riscos
UERGS
 
Impacto ambiental dos resíduos agroindustriais
Impacto ambiental dos resíduos agroindustriaisImpacto ambiental dos resíduos agroindustriais
Impacto ambiental dos resíduos agroindustriais
UERGS
 
Resíduos agroindustriais
Resíduos agroindustriaisResíduos agroindustriais
Resíduos agroindustriais
UERGS
 
Meio ambiente – as 17 leis ambientais do
Meio ambiente – as 17 leis ambientais doMeio ambiente – as 17 leis ambientais do
Meio ambiente – as 17 leis ambientais do
UERGS
 

Mais de UERGS (20)

Aula 1 - Biodiversidade e os Recursos Genéticos [Salvo automaticamente].pptx
Aula 1 - Biodiversidade e os Recursos Genéticos [Salvo automaticamente].pptxAula 1 - Biodiversidade e os Recursos Genéticos [Salvo automaticamente].pptx
Aula 1 - Biodiversidade e os Recursos Genéticos [Salvo automaticamente].pptx
 
Nutrigenômica e nutrigenética
Nutrigenômica e nutrigenéticaNutrigenômica e nutrigenética
Nutrigenômica e nutrigenética
 
Princípios gerais da conservação de alimentos
Princípios gerais da conservação de alimentosPrincípios gerais da conservação de alimentos
Princípios gerais da conservação de alimentos
 
Definição, classificação, composição e conservação aula 2
Definição, classificação, composição e conservação aula 2Definição, classificação, composição e conservação aula 2
Definição, classificação, composição e conservação aula 2
 
Conservação por utilização de temperaturas
Conservação por utilização de temperaturasConservação por utilização de temperaturas
Conservação por utilização de temperaturas
 
Conservação pelo uso do frio
Conservação pelo uso do frioConservação pelo uso do frio
Conservação pelo uso do frio
 
Tópicos especiais biodiesel
Tópicos especiais   biodieselTópicos especiais   biodiesel
Tópicos especiais biodiesel
 
Bioquimica de alimentos proteases
Bioquimica de alimentos   proteasesBioquimica de alimentos   proteases
Bioquimica de alimentos proteases
 
Bioquimica da maturação das frutas
Bioquimica da maturação das frutasBioquimica da maturação das frutas
Bioquimica da maturação das frutas
 
Controle do amadurecimento e senescência dos frutos
Controle do amadurecimento e senescência dos frutosControle do amadurecimento e senescência dos frutos
Controle do amadurecimento e senescência dos frutos
 
Instrumentos óticos
Instrumentos óticosInstrumentos óticos
Instrumentos óticos
 
Analise espectro eletromagnética
Analise espectro eletromagnéticaAnalise espectro eletromagnética
Analise espectro eletromagnética
 
Bioquímica de alimentos - Carboidrases
Bioquímica de alimentos - CarboidrasesBioquímica de alimentos - Carboidrases
Bioquímica de alimentos - Carboidrases
 
Enzimas
EnzimasEnzimas
Enzimas
 
Recuperação de áreas degradadas
Recuperação de áreas degradadasRecuperação de áreas degradadas
Recuperação de áreas degradadas
 
Segurança alimentar e ogms
Segurança alimentar e ogmsSegurança alimentar e ogms
Segurança alimentar e ogms
 
Impacto ambiental, analise de riscos
Impacto ambiental, analise de riscosImpacto ambiental, analise de riscos
Impacto ambiental, analise de riscos
 
Impacto ambiental dos resíduos agroindustriais
Impacto ambiental dos resíduos agroindustriaisImpacto ambiental dos resíduos agroindustriais
Impacto ambiental dos resíduos agroindustriais
 
Resíduos agroindustriais
Resíduos agroindustriaisResíduos agroindustriais
Resíduos agroindustriais
 
Meio ambiente – as 17 leis ambientais do
Meio ambiente – as 17 leis ambientais doMeio ambiente – as 17 leis ambientais do
Meio ambiente – as 17 leis ambientais do
 

Último

OS elementos de uma boa Redação para o ENEM.pdf
OS elementos de uma boa Redação para o ENEM.pdfOS elementos de uma boa Redação para o ENEM.pdf
OS elementos de uma boa Redação para o ENEM.pdf
AmiltonAparecido1
 
UFCD_4667_Preparação e confeção de molhos e fundos de cozinha_índice.pdf
UFCD_4667_Preparação e confeção de molhos e fundos de cozinha_índice.pdfUFCD_4667_Preparação e confeção de molhos e fundos de cozinha_índice.pdf
UFCD_4667_Preparação e confeção de molhos e fundos de cozinha_índice.pdf
Manuais Formação
 
Introdução à Sociologia: caça-palavras na escola
Introdução à Sociologia: caça-palavras na escolaIntrodução à Sociologia: caça-palavras na escola
Introdução à Sociologia: caça-palavras na escola
Professor Belinaso
 
Aula 2 - Revisando o significado de fração - Parte 2.pptx
Aula 2 - Revisando o significado de fração - Parte 2.pptxAula 2 - Revisando o significado de fração - Parte 2.pptx
Aula 2 - Revisando o significado de fração - Parte 2.pptx
LILIANPRESTESSCUDELE
 
497417426-conheca-os-principais-graficos-da-radiestesia-e-da-radionica.pdf
497417426-conheca-os-principais-graficos-da-radiestesia-e-da-radionica.pdf497417426-conheca-os-principais-graficos-da-radiestesia-e-da-radionica.pdf
497417426-conheca-os-principais-graficos-da-radiestesia-e-da-radionica.pdf
JoanaFigueira11
 
Testes + soluções_Mensagens12 )11111.pdf
Testes + soluções_Mensagens12 )11111.pdfTestes + soluções_Mensagens12 )11111.pdf
Testes + soluções_Mensagens12 )11111.pdf
lveiga112
 
AULA-001---AS-CELULAS_5546dad041b949bbb7b1f0fa841a6d1f.pdf
AULA-001---AS-CELULAS_5546dad041b949bbb7b1f0fa841a6d1f.pdfAULA-001---AS-CELULAS_5546dad041b949bbb7b1f0fa841a6d1f.pdf
AULA-001---AS-CELULAS_5546dad041b949bbb7b1f0fa841a6d1f.pdf
SthafaniHussin1
 
Treinamento NR 38 - CORPO PRINCIPAL da NORMA.pptx
Treinamento NR 38 - CORPO PRINCIPAL da NORMA.pptxTreinamento NR 38 - CORPO PRINCIPAL da NORMA.pptx
Treinamento NR 38 - CORPO PRINCIPAL da NORMA.pptx
MarcosPaulo777883
 
Rimas, Luís Vaz de Camões. pptx
Rimas, Luís Vaz de Camões.          pptxRimas, Luís Vaz de Camões.          pptx
Rimas, Luís Vaz de Camões. pptx
TomasSousa7
 
1_10_06_2024_Criança e Cultura Escrita, Ana Maria de Oliveira Galvão.pdf
1_10_06_2024_Criança e Cultura Escrita, Ana Maria de Oliveira Galvão.pdf1_10_06_2024_Criança e Cultura Escrita, Ana Maria de Oliveira Galvão.pdf
1_10_06_2024_Criança e Cultura Escrita, Ana Maria de Oliveira Galvão.pdf
SILVIAREGINANAZARECA
 
A SOCIOLOGIA E O TRABALHO: ANÁLISES E VIVÊNCIAS
A SOCIOLOGIA E O TRABALHO: ANÁLISES E VIVÊNCIASA SOCIOLOGIA E O TRABALHO: ANÁLISES E VIVÊNCIAS
A SOCIOLOGIA E O TRABALHO: ANÁLISES E VIVÊNCIAS
HisrelBlog
 
Telepsiquismo Utilize seu poder extrassensorial para atrair prosperidade (Jos...
Telepsiquismo Utilize seu poder extrassensorial para atrair prosperidade (Jos...Telepsiquismo Utilize seu poder extrassensorial para atrair prosperidade (Jos...
Telepsiquismo Utilize seu poder extrassensorial para atrair prosperidade (Jos...
fran0410
 
-Rudolf-Laban-e-a-teoria-do-movimento.ppt
-Rudolf-Laban-e-a-teoria-do-movimento.ppt-Rudolf-Laban-e-a-teoria-do-movimento.ppt
-Rudolf-Laban-e-a-teoria-do-movimento.ppt
fagnerlopes11
 
Redação e Leitura_7º ano_58_Produção de cordel .pptx
Redação e Leitura_7º ano_58_Produção de cordel .pptxRedação e Leitura_7º ano_58_Produção de cordel .pptx
Redação e Leitura_7º ano_58_Produção de cordel .pptx
DECIOMAURINARAMOS
 
A QUESTÃO ANTROPOLÓGICA: O QUE SOMOS OU QUEM SOMOS.pdf
A QUESTÃO ANTROPOLÓGICA: O QUE SOMOS OU QUEM SOMOS.pdfA QUESTÃO ANTROPOLÓGICA: O QUE SOMOS OU QUEM SOMOS.pdf
A QUESTÃO ANTROPOLÓGICA: O QUE SOMOS OU QUEM SOMOS.pdf
AurelianoFerreirades2
 
Aula Contrato Individual de Trabalho .pdf
Aula Contrato Individual de Trabalho .pdfAula Contrato Individual de Trabalho .pdf
Aula Contrato Individual de Trabalho .pdf
Pedro Luis Moraes
 
O Profeta Jeremias - A Biografia de Jeremias.pptx4
O Profeta Jeremias - A Biografia de Jeremias.pptx4O Profeta Jeremias - A Biografia de Jeremias.pptx4
O Profeta Jeremias - A Biografia de Jeremias.pptx4
DouglasMoraes54
 
Slide de biologia aula2 2 bimestre no ano de 2024
Slide de biologia aula2  2 bimestre no ano de 2024Slide de biologia aula2  2 bimestre no ano de 2024
Slide de biologia aula2 2 bimestre no ano de 2024
vinibolado86
 
JOGO DA VELHA FESTA JUNINA - ARQUIVO GRATUITO.pdf
JOGO DA VELHA FESTA JUNINA - ARQUIVO GRATUITO.pdfJOGO DA VELHA FESTA JUNINA - ARQUIVO GRATUITO.pdf
JOGO DA VELHA FESTA JUNINA - ARQUIVO GRATUITO.pdf
ClaudiaMainoth
 
As sequências didáticas: práticas educativas
As sequências didáticas: práticas educativasAs sequências didáticas: práticas educativas
As sequências didáticas: práticas educativas
rloureiro1
 

Último (20)

OS elementos de uma boa Redação para o ENEM.pdf
OS elementos de uma boa Redação para o ENEM.pdfOS elementos de uma boa Redação para o ENEM.pdf
OS elementos de uma boa Redação para o ENEM.pdf
 
UFCD_4667_Preparação e confeção de molhos e fundos de cozinha_índice.pdf
UFCD_4667_Preparação e confeção de molhos e fundos de cozinha_índice.pdfUFCD_4667_Preparação e confeção de molhos e fundos de cozinha_índice.pdf
UFCD_4667_Preparação e confeção de molhos e fundos de cozinha_índice.pdf
 
Introdução à Sociologia: caça-palavras na escola
Introdução à Sociologia: caça-palavras na escolaIntrodução à Sociologia: caça-palavras na escola
Introdução à Sociologia: caça-palavras na escola
 
Aula 2 - Revisando o significado de fração - Parte 2.pptx
Aula 2 - Revisando o significado de fração - Parte 2.pptxAula 2 - Revisando o significado de fração - Parte 2.pptx
Aula 2 - Revisando o significado de fração - Parte 2.pptx
 
497417426-conheca-os-principais-graficos-da-radiestesia-e-da-radionica.pdf
497417426-conheca-os-principais-graficos-da-radiestesia-e-da-radionica.pdf497417426-conheca-os-principais-graficos-da-radiestesia-e-da-radionica.pdf
497417426-conheca-os-principais-graficos-da-radiestesia-e-da-radionica.pdf
 
Testes + soluções_Mensagens12 )11111.pdf
Testes + soluções_Mensagens12 )11111.pdfTestes + soluções_Mensagens12 )11111.pdf
Testes + soluções_Mensagens12 )11111.pdf
 
AULA-001---AS-CELULAS_5546dad041b949bbb7b1f0fa841a6d1f.pdf
AULA-001---AS-CELULAS_5546dad041b949bbb7b1f0fa841a6d1f.pdfAULA-001---AS-CELULAS_5546dad041b949bbb7b1f0fa841a6d1f.pdf
AULA-001---AS-CELULAS_5546dad041b949bbb7b1f0fa841a6d1f.pdf
 
Treinamento NR 38 - CORPO PRINCIPAL da NORMA.pptx
Treinamento NR 38 - CORPO PRINCIPAL da NORMA.pptxTreinamento NR 38 - CORPO PRINCIPAL da NORMA.pptx
Treinamento NR 38 - CORPO PRINCIPAL da NORMA.pptx
 
Rimas, Luís Vaz de Camões. pptx
Rimas, Luís Vaz de Camões.          pptxRimas, Luís Vaz de Camões.          pptx
Rimas, Luís Vaz de Camões. pptx
 
1_10_06_2024_Criança e Cultura Escrita, Ana Maria de Oliveira Galvão.pdf
1_10_06_2024_Criança e Cultura Escrita, Ana Maria de Oliveira Galvão.pdf1_10_06_2024_Criança e Cultura Escrita, Ana Maria de Oliveira Galvão.pdf
1_10_06_2024_Criança e Cultura Escrita, Ana Maria de Oliveira Galvão.pdf
 
A SOCIOLOGIA E O TRABALHO: ANÁLISES E VIVÊNCIAS
A SOCIOLOGIA E O TRABALHO: ANÁLISES E VIVÊNCIASA SOCIOLOGIA E O TRABALHO: ANÁLISES E VIVÊNCIAS
A SOCIOLOGIA E O TRABALHO: ANÁLISES E VIVÊNCIAS
 
Telepsiquismo Utilize seu poder extrassensorial para atrair prosperidade (Jos...
Telepsiquismo Utilize seu poder extrassensorial para atrair prosperidade (Jos...Telepsiquismo Utilize seu poder extrassensorial para atrair prosperidade (Jos...
Telepsiquismo Utilize seu poder extrassensorial para atrair prosperidade (Jos...
 
-Rudolf-Laban-e-a-teoria-do-movimento.ppt
-Rudolf-Laban-e-a-teoria-do-movimento.ppt-Rudolf-Laban-e-a-teoria-do-movimento.ppt
-Rudolf-Laban-e-a-teoria-do-movimento.ppt
 
Redação e Leitura_7º ano_58_Produção de cordel .pptx
Redação e Leitura_7º ano_58_Produção de cordel .pptxRedação e Leitura_7º ano_58_Produção de cordel .pptx
Redação e Leitura_7º ano_58_Produção de cordel .pptx
 
A QUESTÃO ANTROPOLÓGICA: O QUE SOMOS OU QUEM SOMOS.pdf
A QUESTÃO ANTROPOLÓGICA: O QUE SOMOS OU QUEM SOMOS.pdfA QUESTÃO ANTROPOLÓGICA: O QUE SOMOS OU QUEM SOMOS.pdf
A QUESTÃO ANTROPOLÓGICA: O QUE SOMOS OU QUEM SOMOS.pdf
 
Aula Contrato Individual de Trabalho .pdf
Aula Contrato Individual de Trabalho .pdfAula Contrato Individual de Trabalho .pdf
Aula Contrato Individual de Trabalho .pdf
 
O Profeta Jeremias - A Biografia de Jeremias.pptx4
O Profeta Jeremias - A Biografia de Jeremias.pptx4O Profeta Jeremias - A Biografia de Jeremias.pptx4
O Profeta Jeremias - A Biografia de Jeremias.pptx4
 
Slide de biologia aula2 2 bimestre no ano de 2024
Slide de biologia aula2  2 bimestre no ano de 2024Slide de biologia aula2  2 bimestre no ano de 2024
Slide de biologia aula2 2 bimestre no ano de 2024
 
JOGO DA VELHA FESTA JUNINA - ARQUIVO GRATUITO.pdf
JOGO DA VELHA FESTA JUNINA - ARQUIVO GRATUITO.pdfJOGO DA VELHA FESTA JUNINA - ARQUIVO GRATUITO.pdf
JOGO DA VELHA FESTA JUNINA - ARQUIVO GRATUITO.pdf
 
As sequências didáticas: práticas educativas
As sequências didáticas: práticas educativasAs sequências didáticas: práticas educativas
As sequências didáticas: práticas educativas
 

Introdução a genetica