SlideShare uma empresa Scribd logo
1 de 47
ÁCIDOS NUCLÉICOS
RNA e DNA
Estruturas muito semelhantes
formados por
Polímeros de Nucleotídeos
Bases Púricas – Adenina e Guanina
Bases Pirimídicas – Citosina, Timina e Uracila
*O pareamento de bases é sempre entre uma
base Púrica e uma Pirimídica
A-T
C-G
Açúcar ( Ribose)
Bases Nitrogenadas
Grupamento Fosfato
Ligação fosfodiéster
Fita Simples - RNA
Fita Dupla - DNA
DNA RNA
Desoxirribose Ribose
Fita Dupla Fita Simples
Bases Nitrogenadas
A, G, C, T
Bases Nitrogenadas
A, G, C, U
Núcleo
Produzido no Núcleo.
Ativo no citoplasma.
Idêntico em todas as células
de um mesmo indivíduo
Varia entre os diferentes
tipos celulares ou fases do
desenvolvimento
Forma helicoidal
Dupla hélice do DNA
Mesmo conjunto de genes!
(Genoma igual...)
Diferentes genes que são expressos em
cada tipo celular!
EXPRESSÃO GÊNICA
DNA  Proteína (atividade funcional)
DNA
RNA
Proteína
TRANSCRIÇÃO
TRADUÇÃO
NÚCLEO
CITOPLASMA
TRANSCRIÇÃO
• No núcleo (Eucariotos), no Citoplasma (Procariotos)
• Não ocorre em todo o genoma
• Regiões determinadas  Genes
• Regulação específica (depende do gene, do tipo
celular, do estágio de desenvolvimento, etc...)
ORGANIZAÇÃO GENÔMICA
Regiões gênicas
Codificantes (mRNA Proteína)
rRNA e tRNA
(~25%)
Regiões regulatórias
Regiões sem função conhecida
(~75%)
Enzimas Importantes:
• RNA Polimerase:
adição de nucleotídeos (sentido 5’  3’)
• Helicase:
desnaturação do DNA (separação das fitas)
• DNA Girase
remoção de supertorções no DNA
Tipos de RNA:
• RNA mensageiro:
contém a sequência que determina a ordem de
adição dos aminoácidos na proteína
• RNA transportador:
relaciona o aminoácido correto à sequência
contida no mRNA
• RNA ribossomal:
constitui, juntamente com proteínas, a estrutura
do ribossomo
FORMAÇÃO DO RNA mensageiro
ESTRUTURA DO GENE
ESTRUTURA DO GENE
• Região Promotora:
local de ligação da RNA Polimerase
• Exons:
regiões codificantes – determinam a sequência dos
aminoácidos na proteína
• Íntrons:
regiões não-codificantes – são retiradas durante o
splicing
RNA transportador
Enzima importante:
• Aminoacil-tRNA-sintetase:
responsável por ligar o
aminoácido na extremidade
3’ do tRN
seleciona o aminoácido
com base na sequência do
anticodon
RNA ribossomal
RNA ribossomal
• Ribossomo:
catalisa a formação das proteínas durante a
tradução
promove a união de dois aminoácidos, de acordo
com a sequência de bases do mRNA
EXPRESSÃO GÊNICA
DNA  Proteína (atividade funcional)
DNA
RNA
Proteína
TRANSCRIÇÃO
TRADUÇÃO
NÚCLEO
CITOPLASMA
TRADUÇÃO
• No Citoplasma (Eucariotos e Procariotos)
• Realizada pelo RIBOSSOMO, que usa como molde o
mRNA
• Regulação específica (depende do gene, do tipo
celular, do estágio de desenvolvimento, etc...)
CÓDIGO GENÉTICO
ATCGCTTGATGAGCTGTCTGGATTAAATGCTATGA
AUCGCUGAUGAGCUGUCUGGAUUAAAUGCUAUGA
TAGCGAACTACTCGACAGACCTAATTTACGATACT
DNA
RNA
5’
3’
3’
5’
5’ 3’
AUCGCUGAUGAGCUGUCUGGAUUAAAUGCUAUGA
START CODON
(CÓDON DE INICIAÇÃO)
STOP CODON
(CÓDON DE TERMINAÇÃO)
5’ 3’
Transcrição e tradução

Mais conteúdo relacionado

Mais procurados

Classificação dos Seres Vivos
Classificação dos Seres VivosClassificação dos Seres Vivos
Classificação dos Seres Vivos
Juliana Mendes
 
Divisão Celular (Power Point)
Divisão Celular (Power Point)Divisão Celular (Power Point)
Divisão Celular (Power Point)
Bio
 
Mutações do material genético
Mutações do material genéticoMutações do material genético
Mutações do material genético
UERGS
 
Código genético
Código genéticoCódigo genético
Código genético
MARCIAMP
 
Aula biologia celular
Aula   biologia celularAula   biologia celular
Aula biologia celular
santhdalcin
 
Divisão celular mitose e meiose
Divisão celular  mitose e meioseDivisão celular  mitose e meiose
Divisão celular mitose e meiose
César Milani
 

Mais procurados (20)

duplicação do dna e rna
duplicação do dna  e rnaduplicação do dna  e rna
duplicação do dna e rna
 
Expressão gênica
Expressão gênicaExpressão gênica
Expressão gênica
 
Classificação dos Seres Vivos
Classificação dos Seres VivosClassificação dos Seres Vivos
Classificação dos Seres Vivos
 
Divisão Celular (Power Point)
Divisão Celular (Power Point)Divisão Celular (Power Point)
Divisão Celular (Power Point)
 
Ácidos nucléicos
Ácidos nucléicosÁcidos nucléicos
Ácidos nucléicos
 
Replicação do DNA
Replicação do DNAReplicação do DNA
Replicação do DNA
 
2ª lei de mendel
2ª lei de mendel2ª lei de mendel
2ª lei de mendel
 
Mutações do material genético
Mutações do material genéticoMutações do material genético
Mutações do material genético
 
Introdução a genetica
Introdução a geneticaIntrodução a genetica
Introdução a genetica
 
Código genético
Código genéticoCódigo genético
Código genético
 
Membrana plasmática slides COMPLETO
Membrana plasmática slides COMPLETOMembrana plasmática slides COMPLETO
Membrana plasmática slides COMPLETO
 
Organelas celulares
Organelas celularesOrganelas celulares
Organelas celulares
 
Aula biologia celular
Aula   biologia celularAula   biologia celular
Aula biologia celular
 
Aula Citologia
Aula CitologiaAula Citologia
Aula Citologia
 
Proteinas
ProteinasProteinas
Proteinas
 
Divisão celular mitose e meiose
Divisão celular  mitose e meioseDivisão celular  mitose e meiose
Divisão celular mitose e meiose
 
Nomenclatura taxonomia
Nomenclatura taxonomiaNomenclatura taxonomia
Nomenclatura taxonomia
 
Organização do cromossomo/DNA
Organização do cromossomo/DNAOrganização do cromossomo/DNA
Organização do cromossomo/DNA
 
Sintese de proteina 2
Sintese de proteina 2Sintese de proteina 2
Sintese de proteina 2
 
Biologia- Virus
Biologia- VirusBiologia- Virus
Biologia- Virus
 

Destaque

Tradução - síntese proteica
Tradução - síntese proteicaTradução - síntese proteica
Tradução - síntese proteica
ceap
 
Bioquímica síntese de proteínas
Bioquímica   síntese de proteínasBioquímica   síntese de proteínas
Bioquímica síntese de proteínas
amandaaangelina
 
Código Genético e Síntese Proteica
Código Genético e Síntese ProteicaCódigo Genético e Síntese Proteica
Código Genético e Síntese Proteica
guestdb5b7a
 
Dna, rna e síntese proteíca
Dna, rna e síntese proteícaDna, rna e síntese proteíca
Dna, rna e síntese proteíca
LarissaComparini
 
Transcripción y traducción del adn
Transcripción y traducción del adnTranscripción y traducción del adn
Transcripción y traducción del adn
inesjimenez96
 

Destaque (20)

Fisiologia
FisiologiaFisiologia
Fisiologia
 
Gimnospermas
GimnospermasGimnospermas
Gimnospermas
 
Folhetos embrionários
Folhetos embrionáriosFolhetos embrionários
Folhetos embrionários
 
Taxonomia
TaxonomiaTaxonomia
Taxonomia
 
Composição química da célula 2014
Composição química da célula 2014Composição química da célula 2014
Composição química da célula 2014
 
Aula 2 replicação, transcrição e tradução
Aula 2   replicação, transcrição e traduçãoAula 2   replicação, transcrição e tradução
Aula 2 replicação, transcrição e tradução
 
Transcrição gênica
Transcrição gênicaTranscrição gênica
Transcrição gênica
 
Botânica parte 1
Botânica parte 1Botânica parte 1
Botânica parte 1
 
Tradução - síntese proteica
Tradução - síntese proteicaTradução - síntese proteica
Tradução - síntese proteica
 
Síntese proteica
Síntese proteicaSíntese proteica
Síntese proteica
 
Bioquímica síntese de proteínas
Bioquímica   síntese de proteínasBioquímica   síntese de proteínas
Bioquímica síntese de proteínas
 
Transcrição gênica 2009.1 vera
Transcrição gênica 2009.1 veraTranscrição gênica 2009.1 vera
Transcrição gênica 2009.1 vera
 
Código Genético e Síntese Proteica
Código Genético e Síntese ProteicaCódigo Genético e Síntese Proteica
Código Genético e Síntese Proteica
 
Slide Genética
Slide GenéticaSlide Genética
Slide Genética
 
CóDigo GenéTico
CóDigo GenéTicoCóDigo GenéTico
CóDigo GenéTico
 
Transcrição e processamento do pré-mRNA
Transcrição e processamento do  pré-mRNATranscrição e processamento do  pré-mRNA
Transcrição e processamento do pré-mRNA
 
Dna, rna e síntese proteíca
Dna, rna e síntese proteícaDna, rna e síntese proteíca
Dna, rna e síntese proteíca
 
Transcripción y traducción del adn
Transcripción y traducción del adnTranscripción y traducción del adn
Transcripción y traducción del adn
 
Ejercicios de revisión
Ejercicios de revisiónEjercicios de revisión
Ejercicios de revisión
 
Preposiciones 05 de maio
Preposiciones 05 de maioPreposiciones 05 de maio
Preposiciones 05 de maio
 

Semelhante a Transcrição e tradução

ESPECÍFICA REPLIC TRANSC E TRAD
ESPECÍFICA REPLIC TRANSC E TRADESPECÍFICA REPLIC TRANSC E TRAD
ESPECÍFICA REPLIC TRANSC E TRAD
MARCIAMP
 
Aula duplicaçao do dna 2
Aula duplicaçao do dna 2Aula duplicaçao do dna 2
Aula duplicaçao do dna 2
Ilsoflavio
 
Metabolismo dos nucleotídeos
Metabolismo dos nucleotídeosMetabolismo dos nucleotídeos
Metabolismo dos nucleotídeos
Biomedicina
 
6 dogma central da biologia molecular transcrição
6 dogma central da biologia molecular   transcrição6 dogma central da biologia molecular   transcrição
6 dogma central da biologia molecular transcrição
Ingrid Iasmyn Amin
 
Bases genética da hereditariedade
Bases genética da hereditariedadeBases genética da hereditariedade
Bases genética da hereditariedade
Herivelto Carlotto
 

Semelhante a Transcrição e tradução (20)

ESPECÍFICA REPLIC TRANSC E TRAD
ESPECÍFICA REPLIC TRANSC E TRADESPECÍFICA REPLIC TRANSC E TRAD
ESPECÍFICA REPLIC TRANSC E TRAD
 
1 s äcidos nucl[eicos_maio 2012
1 s äcidos nucl[eicos_maio 20121 s äcidos nucl[eicos_maio 2012
1 s äcidos nucl[eicos_maio 2012
 
Acidosnucleicos
AcidosnucleicosAcidosnucleicos
Acidosnucleicos
 
1 s äcidos nucleicos_maio
1 s äcidos nucleicos_maio1 s äcidos nucleicos_maio
1 s äcidos nucleicos_maio
 
Aula3 sintese prtn
Aula3 sintese prtnAula3 sintese prtn
Aula3 sintese prtn
 
Ácidos nucleicos e a síntese proteicappt
Ácidos nucleicos e a síntese proteicapptÁcidos nucleicos e a síntese proteicappt
Ácidos nucleicos e a síntese proteicappt
 
Transcrição gênica
Transcrição gênicaTranscrição gênica
Transcrição gênica
 
Aula duplicaçao do dna 2
Aula duplicaçao do dna 2Aula duplicaçao do dna 2
Aula duplicaçao do dna 2
 
Transcrição gênica
Transcrição gênicaTranscrição gênica
Transcrição gênica
 
Metabolismo dos nucleotídeos
Metabolismo dos nucleotídeosMetabolismo dos nucleotídeos
Metabolismo dos nucleotídeos
 
6 dogma central da biologia molecular transcrição
6 dogma central da biologia molecular   transcrição6 dogma central da biologia molecular   transcrição
6 dogma central da biologia molecular transcrição
 
Biologia Celular: Dogma Central de Biologia
Biologia Celular: Dogma Central de BiologiaBiologia Celular: Dogma Central de Biologia
Biologia Celular: Dogma Central de Biologia
 
Ácidos Nucleicos
Ácidos Nucleicos  Ácidos Nucleicos
Ácidos Nucleicos
 
Genes apresentação
Genes   apresentaçãoGenes   apresentação
Genes apresentação
 
ácidos nucleicos
ácidos nucleicosácidos nucleicos
ácidos nucleicos
 
Biologia aula 04 ácidos nucleicos
Biologia aula 04   ácidos nucleicosBiologia aula 04   ácidos nucleicos
Biologia aula 04 ácidos nucleicos
 
ácidos nucléicos
ácidos nucléicosácidos nucléicos
ácidos nucléicos
 
Bases genética da hereditariedade
Bases genética da hereditariedadeBases genética da hereditariedade
Bases genética da hereditariedade
 
DNA e síntese proteica I.pptx
DNA e síntese proteica I.pptxDNA e síntese proteica I.pptx
DNA e síntese proteica I.pptx
 
áCidos nucleicos.1
áCidos nucleicos.1áCidos nucleicos.1
áCidos nucleicos.1
 

Mais de Centro de Educação e Cultura Pré-Vestibular Resgate Popular

Mais de Centro de Educação e Cultura Pré-Vestibular Resgate Popular (20)

Dançar tango em Porto Alegre
Dançar tango em Porto AlegreDançar tango em Porto Alegre
Dançar tango em Porto Alegre
 
A noite das mulheres cantoras
A noite das mulheres cantorasA noite das mulheres cantoras
A noite das mulheres cantoras
 
Vanguardas e Modernismo
Vanguardas e ModernismoVanguardas e Modernismo
Vanguardas e Modernismo
 
Memórias de um sargento de milícias
Memórias de um sargento de milíciasMemórias de um sargento de milícias
Memórias de um sargento de milícias
 
Romantismo romancistas
Romantismo romancistasRomantismo romancistas
Romantismo romancistas
 
Portas abertas 2014
Portas abertas 2014Portas abertas 2014
Portas abertas 2014
 
Romantismo contexto e poetas
Romantismo contexto e poetasRomantismo contexto e poetas
Romantismo contexto e poetas
 
Egito antigo
Egito antigo Egito antigo
Egito antigo
 
Artigos - espanhol
Artigos - espanholArtigos - espanhol
Artigos - espanhol
 
Arcadismo
ArcadismoArcadismo
Arcadismo
 
Luís vaz de camões
Luís vaz de camõesLuís vaz de camões
Luís vaz de camões
 
Gil vicente aula
Gil vicente aulaGil vicente aula
Gil vicente aula
 
Aula caminha
Aula caminhaAula caminha
Aula caminha
 
Aula arcadismo
Aula arcadismoAula arcadismo
Aula arcadismo
 
Aula barroco
Aula barrocoAula barroco
Aula barroco
 
Gregório de matos
Gregório de matosGregório de matos
Gregório de matos
 
Falsos cognatos
Falsos cognatosFalsos cognatos
Falsos cognatos
 
Pe antonio vieira
Pe antonio vieiraPe antonio vieira
Pe antonio vieira
 
Barroco
BarrocoBarroco
Barroco
 
As artes no renascimento
As artes no renascimentoAs artes no renascimento
As artes no renascimento
 

Último

Slide Licao 4 - 2T - 2024 - CPAD ADULTOS - Retangular.pptx
Slide Licao 4 - 2T - 2024 - CPAD ADULTOS - Retangular.pptxSlide Licao 4 - 2T - 2024 - CPAD ADULTOS - Retangular.pptx
Slide Licao 4 - 2T - 2024 - CPAD ADULTOS - Retangular.pptx
sfwsoficial
 

Último (20)

Enunciado_da_Avaliacao_1__Sistemas_de_Informacoes_Gerenciais_(IL60106).pdf
Enunciado_da_Avaliacao_1__Sistemas_de_Informacoes_Gerenciais_(IL60106).pdfEnunciado_da_Avaliacao_1__Sistemas_de_Informacoes_Gerenciais_(IL60106).pdf
Enunciado_da_Avaliacao_1__Sistemas_de_Informacoes_Gerenciais_(IL60106).pdf
 
ufcd_9649_Educação Inclusiva e Necessidades Educativas Especificas_índice.pdf
ufcd_9649_Educação Inclusiva e Necessidades Educativas Especificas_índice.pdfufcd_9649_Educação Inclusiva e Necessidades Educativas Especificas_índice.pdf
ufcd_9649_Educação Inclusiva e Necessidades Educativas Especificas_índice.pdf
 
Nós Propomos! Sertã 2024 - Geografia C - 12º ano
Nós Propomos! Sertã 2024 - Geografia C - 12º anoNós Propomos! Sertã 2024 - Geografia C - 12º ano
Nós Propomos! Sertã 2024 - Geografia C - 12º ano
 
Nós Propomos! Canil/Gatil na Sertã - Amigos dos Animais
Nós Propomos! Canil/Gatil na Sertã - Amigos dos AnimaisNós Propomos! Canil/Gatil na Sertã - Amigos dos Animais
Nós Propomos! Canil/Gatil na Sertã - Amigos dos Animais
 
As Mil Palavras Mais Usadas No Inglês (Robert de Aquino) (Z-Library).pdf
As Mil Palavras Mais Usadas No Inglês (Robert de Aquino) (Z-Library).pdfAs Mil Palavras Mais Usadas No Inglês (Robert de Aquino) (Z-Library).pdf
As Mil Palavras Mais Usadas No Inglês (Robert de Aquino) (Z-Library).pdf
 
"Nós Propomos! Escola Secundária em Pedrógão Grande"
"Nós Propomos! Escola Secundária em Pedrógão Grande""Nós Propomos! Escola Secundária em Pedrógão Grande"
"Nós Propomos! Escola Secundária em Pedrógão Grande"
 
Poema - Aedes Aegypt.
Poema - Aedes Aegypt.Poema - Aedes Aegypt.
Poema - Aedes Aegypt.
 
Unidade 4 (Texto poético) (Teste sem correção) (2).docx
Unidade 4 (Texto poético) (Teste sem correção) (2).docxUnidade 4 (Texto poético) (Teste sem correção) (2).docx
Unidade 4 (Texto poético) (Teste sem correção) (2).docx
 
Nós Propomos! Infraestruturas em Proença-a-Nova
Nós Propomos! Infraestruturas em Proença-a-NovaNós Propomos! Infraestruturas em Proença-a-Nova
Nós Propomos! Infraestruturas em Proença-a-Nova
 
livro para educação infantil conceitos sensorial
livro para educação infantil conceitos sensoriallivro para educação infantil conceitos sensorial
livro para educação infantil conceitos sensorial
 
HISTORIA DA XILOGRAVURA A SUA IMPORTANCIA
HISTORIA DA XILOGRAVURA A SUA IMPORTANCIAHISTORIA DA XILOGRAVURA A SUA IMPORTANCIA
HISTORIA DA XILOGRAVURA A SUA IMPORTANCIA
 
Slide Licao 4 - 2T - 2024 - CPAD ADULTOS - Retangular.pptx
Slide Licao 4 - 2T - 2024 - CPAD ADULTOS - Retangular.pptxSlide Licao 4 - 2T - 2024 - CPAD ADULTOS - Retangular.pptx
Slide Licao 4 - 2T - 2024 - CPAD ADULTOS - Retangular.pptx
 
Alemanha vs União Soviética - Livro de Adolf Hitler
Alemanha vs União Soviética - Livro de Adolf HitlerAlemanha vs União Soviética - Livro de Adolf Hitler
Alemanha vs União Soviética - Livro de Adolf Hitler
 
Conteúdo sobre a formação e expansão persa
Conteúdo sobre a formação e expansão persaConteúdo sobre a formação e expansão persa
Conteúdo sobre a formação e expansão persa
 
Slides Lição 8, CPAD, Confessando e Abandonando o Pecado.pptx
Slides Lição 8, CPAD, Confessando e Abandonando o Pecado.pptxSlides Lição 8, CPAD, Confessando e Abandonando o Pecado.pptx
Slides Lição 8, CPAD, Confessando e Abandonando o Pecado.pptx
 
Planejamento 2024 - 1º ano - Matemática 38 a 62.pdf
Planejamento 2024 - 1º ano - Matemática  38 a 62.pdfPlanejamento 2024 - 1º ano - Matemática  38 a 62.pdf
Planejamento 2024 - 1º ano - Matemática 38 a 62.pdf
 
bem estar animal em proteção integrada componente animal
bem estar animal em proteção integrada componente animalbem estar animal em proteção integrada componente animal
bem estar animal em proteção integrada componente animal
 
Abuso Sexual da Criança e do adolescente
Abuso Sexual da Criança e do adolescenteAbuso Sexual da Criança e do adolescente
Abuso Sexual da Criança e do adolescente
 
08-05 - Atividade de língua Portuguesa.pdf
08-05 - Atividade de língua Portuguesa.pdf08-05 - Atividade de língua Portuguesa.pdf
08-05 - Atividade de língua Portuguesa.pdf
 
Livro infantil: A onda da raiva. pdf-crianças
Livro infantil: A onda da raiva. pdf-criançasLivro infantil: A onda da raiva. pdf-crianças
Livro infantil: A onda da raiva. pdf-crianças
 

Transcrição e tradução