SlideShare uma empresa Scribd logo
ÁCIDOS NUCLÉICOS
RNA e DNA
Estruturas muito semelhantes
formados por
Polímeros de Nucleotídeos
Bases Púricas – Adenina e Guanina
Bases Pirimídicas – Citosina, Timina e Uracila
*O pareamento de bases é sempre entre uma
base Púrica e uma Pirimídica
A-T
C-G
Açúcar ( Ribose)
Bases Nitrogenadas
Grupamento Fosfato
Ligação fosfodiéster
Fita Simples - RNA
Fita Dupla - DNA
DNA RNA
Desoxirribose Ribose
Fita Dupla Fita Simples
Bases Nitrogenadas
A, G, C, T
Bases Nitrogenadas
A, G, C, U
Núcleo
Produzido no Núcleo.
Ativo no citoplasma.
Idêntico em todas as células
de um mesmo indivíduo
Varia entre os diferentes
tipos celulares ou fases do
desenvolvimento
Forma helicoidal
Dupla hélice do DNA
Mesmo conjunto de genes!
(Genoma igual...)
Diferentes genes que são expressos em
cada tipo celular!
EXPRESSÃO GÊNICA
DNA  Proteína (atividade funcional)
DNA
RNA
Proteína
TRANSCRIÇÃO
TRADUÇÃO
NÚCLEO
CITOPLASMA
TRANSCRIÇÃO
• No núcleo (Eucariotos), no Citoplasma (Procariotos)
• Não ocorre em todo o genoma
• Regiões determinadas  Genes
• Regulação específica (depende do gene, do tipo
celular, do estágio de desenvolvimento, etc...)
ORGANIZAÇÃO GENÔMICA
Regiões gênicas
Codificantes (mRNA Proteína)
rRNA e tRNA
(~25%)
Regiões regulatórias
Regiões sem função conhecida
(~75%)
Enzimas Importantes:
• RNA Polimerase:
adição de nucleotídeos (sentido 5’  3’)
• Helicase:
desnaturação do DNA (separação das fitas)
• DNA Girase
remoção de supertorções no DNA
Tipos de RNA:
• RNA mensageiro:
contém a sequência que determina a ordem de
adição dos aminoácidos na proteína
• RNA transportador:
relaciona o aminoácido correto à sequência
contida no mRNA
• RNA ribossomal:
constitui, juntamente com proteínas, a estrutura
do ribossomo
FORMAÇÃO DO RNA mensageiro
ESTRUTURA DO GENE
ESTRUTURA DO GENE
• Região Promotora:
local de ligação da RNA Polimerase
• Exons:
regiões codificantes – determinam a sequência dos
aminoácidos na proteína
• Íntrons:
regiões não-codificantes – são retiradas durante o
splicing
RNA transportador
Enzima importante:
• Aminoacil-tRNA-sintetase:
responsável por ligar o
aminoácido na extremidade
3’ do tRN
seleciona o aminoácido
com base na sequência do
anticodon
RNA ribossomal
RNA ribossomal
• Ribossomo:
catalisa a formação das proteínas durante a
tradução
promove a união de dois aminoácidos, de acordo
com a sequência de bases do mRNA
EXPRESSÃO GÊNICA
DNA  Proteína (atividade funcional)
DNA
RNA
Proteína
TRANSCRIÇÃO
TRADUÇÃO
NÚCLEO
CITOPLASMA
TRADUÇÃO
• No Citoplasma (Eucariotos e Procariotos)
• Realizada pelo RIBOSSOMO, que usa como molde o
mRNA
• Regulação específica (depende do gene, do tipo
celular, do estágio de desenvolvimento, etc...)
CÓDIGO GENÉTICO
ATCGCTTGATGAGCTGTCTGGATTAAATGCTATGA
AUCGCUGAUGAGCUGUCUGGAUUAAAUGCUAUGA
TAGCGAACTACTCGACAGACCTAATTTACGATACT
DNA
RNA
5’
3’
3’
5’
5’ 3’
AUCGCUGAUGAGCUGUCUGGAUUAAAUGCUAUGA
START CODON
(CÓDON DE INICIAÇÃO)
STOP CODON
(CÓDON DE TERMINAÇÃO)
5’ 3’
Transcrição e tradução

Mais conteúdo relacionado

Mais procurados

Genetica hereditariedade
Genetica hereditariedadeGenetica hereditariedade
Genetica hereditariedade
Adrianne Mendonça
 
Membrana plasmática slides COMPLETO
Membrana plasmática slides COMPLETOMembrana plasmática slides COMPLETO
Membrana plasmática slides COMPLETO
Sheila Cassenotte
 
Aula - introdução à genética molecular
Aula - introdução à genética molecularAula - introdução à genética molecular
Aula - introdução à genética molecular
Kristian Wessman
 
Aula 9 - Metabolismo energético - Respiração celular e Fermentação
Aula 9 - Metabolismo energético - Respiração celular e FermentaçãoAula 9 - Metabolismo energético - Respiração celular e Fermentação
Aula 9 - Metabolismo energético - Respiração celular e Fermentação
Fernando Mori Miyazawa
 
Aula 11 - Ácidos nucleicos - DNA e RNA
Aula 11 - Ácidos nucleicos - DNA e RNAAula 11 - Ácidos nucleicos - DNA e RNA
Aula 11 - Ácidos nucleicos - DNA e RNA
Fernando Mori Miyazawa
 
Divisão celular mitose e meiose
Divisão celular  mitose e meioseDivisão celular  mitose e meiose
Divisão celular mitose e meiose
César Milani
 
Ácidos nucléicos
Ácidos nucléicosÁcidos nucléicos
Ácidos nucléicos
Fatima Comiotto
 
Divisão Celular (Power Point)
Divisão Celular (Power Point)Divisão Celular (Power Point)
Divisão Celular (Power Point)
Bio
 
DNA
DNADNA
Vírus
VírusVírus
Vírus
profatatiana
 
14 o sistema nervoso
14   o sistema nervoso14   o sistema nervoso
14 o sistema nervoso
Rebeca Vale
 
Aula 1 origem e evolução das células
Aula 1   origem e evolução das célulasAula 1   origem e evolução das células
Aula 1 origem e evolução das células
Nayara de Queiroz
 
Slides da aula de Biologia (Marcelo) sobre Genética
Slides da aula de Biologia (Marcelo) sobre GenéticaSlides da aula de Biologia (Marcelo) sobre Genética
Slides da aula de Biologia (Marcelo) sobre Genética
Turma Olímpica
 
Reino protista algas
Reino protista   algasReino protista   algas
Reino protista algas
Adrianne Mendonça
 
Aula 8 ciclo celular mitose e meiose
Aula 8   ciclo celular mitose e meioseAula 8   ciclo celular mitose e meiose
Aula 8 ciclo celular mitose e meiose
MARCIAMP
 
EMBRIOLOGIA HUMANA
EMBRIOLOGIA HUMANAEMBRIOLOGIA HUMANA
EMBRIOLOGIA HUMANA
GabrielaSoares07
 
Ciclo celular e mitose
Ciclo celular e mitoseCiclo celular e mitose
Ciclo celular e mitose
emanuel
 
Tecido nervoso
Tecido nervosoTecido nervoso
Tecido nervoso
Andreza Campos
 
Evolução biológica
Evolução biológicaEvolução biológica
Evolução biológica
César Milani
 
Aula sistema imunologico
Aula sistema imunologicoAula sistema imunologico
Aula sistema imunologico
Thiago barreiros
 

Mais procurados (20)

Genetica hereditariedade
Genetica hereditariedadeGenetica hereditariedade
Genetica hereditariedade
 
Membrana plasmática slides COMPLETO
Membrana plasmática slides COMPLETOMembrana plasmática slides COMPLETO
Membrana plasmática slides COMPLETO
 
Aula - introdução à genética molecular
Aula - introdução à genética molecularAula - introdução à genética molecular
Aula - introdução à genética molecular
 
Aula 9 - Metabolismo energético - Respiração celular e Fermentação
Aula 9 - Metabolismo energético - Respiração celular e FermentaçãoAula 9 - Metabolismo energético - Respiração celular e Fermentação
Aula 9 - Metabolismo energético - Respiração celular e Fermentação
 
Aula 11 - Ácidos nucleicos - DNA e RNA
Aula 11 - Ácidos nucleicos - DNA e RNAAula 11 - Ácidos nucleicos - DNA e RNA
Aula 11 - Ácidos nucleicos - DNA e RNA
 
Divisão celular mitose e meiose
Divisão celular  mitose e meioseDivisão celular  mitose e meiose
Divisão celular mitose e meiose
 
Ácidos nucléicos
Ácidos nucléicosÁcidos nucléicos
Ácidos nucléicos
 
Divisão Celular (Power Point)
Divisão Celular (Power Point)Divisão Celular (Power Point)
Divisão Celular (Power Point)
 
DNA
DNADNA
DNA
 
Vírus
VírusVírus
Vírus
 
14 o sistema nervoso
14   o sistema nervoso14   o sistema nervoso
14 o sistema nervoso
 
Aula 1 origem e evolução das células
Aula 1   origem e evolução das célulasAula 1   origem e evolução das células
Aula 1 origem e evolução das células
 
Slides da aula de Biologia (Marcelo) sobre Genética
Slides da aula de Biologia (Marcelo) sobre GenéticaSlides da aula de Biologia (Marcelo) sobre Genética
Slides da aula de Biologia (Marcelo) sobre Genética
 
Reino protista algas
Reino protista   algasReino protista   algas
Reino protista algas
 
Aula 8 ciclo celular mitose e meiose
Aula 8   ciclo celular mitose e meioseAula 8   ciclo celular mitose e meiose
Aula 8 ciclo celular mitose e meiose
 
EMBRIOLOGIA HUMANA
EMBRIOLOGIA HUMANAEMBRIOLOGIA HUMANA
EMBRIOLOGIA HUMANA
 
Ciclo celular e mitose
Ciclo celular e mitoseCiclo celular e mitose
Ciclo celular e mitose
 
Tecido nervoso
Tecido nervosoTecido nervoso
Tecido nervoso
 
Evolução biológica
Evolução biológicaEvolução biológica
Evolução biológica
 
Aula sistema imunologico
Aula sistema imunologicoAula sistema imunologico
Aula sistema imunologico
 

Destaque

Fisiologia
FisiologiaFisiologia
Gimnospermas
GimnospermasGimnospermas
Folhetos embrionários
Folhetos embrionáriosFolhetos embrionários
Taxonomia
TaxonomiaTaxonomia
Composição química da célula 2014
Composição química da célula 2014Composição química da célula 2014
Aula 2 replicação, transcrição e tradução
Aula 2   replicação, transcrição e traduçãoAula 2   replicação, transcrição e tradução
Aula 2 replicação, transcrição e tradução
Fabio Artesanatos
 
Transcrição gênica
Transcrição gênicaTranscrição gênica
Transcrição gênica
Alpha Colégio e Vestibulares
 
Botânica parte 1
Botânica parte 1Botânica parte 1
Tradução - síntese proteica
Tradução - síntese proteicaTradução - síntese proteica
Tradução - síntese proteica
ceap
 
Síntese proteica
Síntese proteicaSíntese proteica
Síntese proteica
Ana Arsénio
 
Bioquímica síntese de proteínas
Bioquímica   síntese de proteínasBioquímica   síntese de proteínas
Bioquímica síntese de proteínas
amandaaangelina
 
Transcrição gênica 2009.1 vera
Transcrição gênica 2009.1 veraTranscrição gênica 2009.1 vera
Transcrição gênica 2009.1 vera
djvillela
 
Código Genético e Síntese Proteica
Código Genético e Síntese ProteicaCódigo Genético e Síntese Proteica
Código Genético e Síntese Proteica
guestdb5b7a
 
Slide Genética
Slide GenéticaSlide Genética
CóDigo GenéTico
CóDigo GenéTicoCóDigo GenéTico
CóDigo GenéTico
tuxnator
 
Transcrição e processamento do pré-mRNA
Transcrição e processamento do  pré-mRNATranscrição e processamento do  pré-mRNA
Transcrição e processamento do pré-mRNA
Priscila Rodrigues
 
Dna, rna e síntese proteíca
Dna, rna e síntese proteícaDna, rna e síntese proteíca
Dna, rna e síntese proteíca
LarissaComparini
 
Transcripción y traducción del adn
Transcripción y traducción del adnTranscripción y traducción del adn
Transcripción y traducción del adn
inesjimenez96
 
Ejercicios de revisión
Ejercicios de revisiónEjercicios de revisión
Preposiciones 05 de maio
Preposiciones 05 de maioPreposiciones 05 de maio

Destaque (20)

Fisiologia
FisiologiaFisiologia
Fisiologia
 
Gimnospermas
GimnospermasGimnospermas
Gimnospermas
 
Folhetos embrionários
Folhetos embrionáriosFolhetos embrionários
Folhetos embrionários
 
Taxonomia
TaxonomiaTaxonomia
Taxonomia
 
Composição química da célula 2014
Composição química da célula 2014Composição química da célula 2014
Composição química da célula 2014
 
Aula 2 replicação, transcrição e tradução
Aula 2   replicação, transcrição e traduçãoAula 2   replicação, transcrição e tradução
Aula 2 replicação, transcrição e tradução
 
Transcrição gênica
Transcrição gênicaTranscrição gênica
Transcrição gênica
 
Botânica parte 1
Botânica parte 1Botânica parte 1
Botânica parte 1
 
Tradução - síntese proteica
Tradução - síntese proteicaTradução - síntese proteica
Tradução - síntese proteica
 
Síntese proteica
Síntese proteicaSíntese proteica
Síntese proteica
 
Bioquímica síntese de proteínas
Bioquímica   síntese de proteínasBioquímica   síntese de proteínas
Bioquímica síntese de proteínas
 
Transcrição gênica 2009.1 vera
Transcrição gênica 2009.1 veraTranscrição gênica 2009.1 vera
Transcrição gênica 2009.1 vera
 
Código Genético e Síntese Proteica
Código Genético e Síntese ProteicaCódigo Genético e Síntese Proteica
Código Genético e Síntese Proteica
 
Slide Genética
Slide GenéticaSlide Genética
Slide Genética
 
CóDigo GenéTico
CóDigo GenéTicoCóDigo GenéTico
CóDigo GenéTico
 
Transcrição e processamento do pré-mRNA
Transcrição e processamento do  pré-mRNATranscrição e processamento do  pré-mRNA
Transcrição e processamento do pré-mRNA
 
Dna, rna e síntese proteíca
Dna, rna e síntese proteícaDna, rna e síntese proteíca
Dna, rna e síntese proteíca
 
Transcripción y traducción del adn
Transcripción y traducción del adnTranscripción y traducción del adn
Transcripción y traducción del adn
 
Ejercicios de revisión
Ejercicios de revisiónEjercicios de revisión
Ejercicios de revisión
 
Preposiciones 05 de maio
Preposiciones 05 de maioPreposiciones 05 de maio
Preposiciones 05 de maio
 

Semelhante a Transcrição e tradução

ESPECÍFICA REPLIC TRANSC E TRAD
ESPECÍFICA REPLIC TRANSC E TRADESPECÍFICA REPLIC TRANSC E TRAD
ESPECÍFICA REPLIC TRANSC E TRAD
MARCIAMP
 
1 s äcidos nucl[eicos_maio 2012
1 s äcidos nucl[eicos_maio 20121 s äcidos nucl[eicos_maio 2012
1 s äcidos nucl[eicos_maio 2012
CotucaAmbiental
 
Acidosnucleicos
AcidosnucleicosAcidosnucleicos
Acidosnucleicos
Iuri Fretta Wiggers
 
1 s äcidos nucleicos_maio
1 s äcidos nucleicos_maio1 s äcidos nucleicos_maio
1 s äcidos nucleicos_maio
Ionara Urrutia Moura
 
Aula3 sintese prtn
Aula3 sintese prtnAula3 sintese prtn
Aula3 sintese prtn
Adila Trubat
 
Ácidos nucleicos e a síntese proteicappt
Ácidos nucleicos e a síntese proteicapptÁcidos nucleicos e a síntese proteicappt
Ácidos nucleicos e a síntese proteicappt
WellisonBrito1
 
Transcrição gênica
Transcrição gênicaTranscrição gênica
Transcrição gênica
Alpha Colégio e Vestibulares
 
Aula duplicaçao do dna 2
Aula duplicaçao do dna 2Aula duplicaçao do dna 2
Aula duplicaçao do dna 2
Ilsoflavio
 
Transcrição gênica
Transcrição gênicaTranscrição gênica
Transcrição gênica
Alpha Colégio e Vestibulares
 
Metabolismo dos nucleotídeos
Metabolismo dos nucleotídeosMetabolismo dos nucleotídeos
Metabolismo dos nucleotídeos
Biomedicina
 
6 dogma central da biologia molecular transcrição
6 dogma central da biologia molecular   transcrição6 dogma central da biologia molecular   transcrição
6 dogma central da biologia molecular transcrição
Ingrid Iasmyn Amin
 
Biologia Celular: Dogma Central de Biologia
Biologia Celular: Dogma Central de BiologiaBiologia Celular: Dogma Central de Biologia
Biologia Celular: Dogma Central de Biologia
natboy51
 
Ácidos Nucleicos
Ácidos Nucleicos  Ácidos Nucleicos
Ácidos Nucleicos
CristinaBrandao
 
Genes apresentação
Genes   apresentaçãoGenes   apresentação
Genes apresentação
Turma Olímpica
 
Biologia aula 04 ácidos nucleicos
Biologia aula 04   ácidos nucleicosBiologia aula 04   ácidos nucleicos
Biologia aula 04 ácidos nucleicos
Alpha Colégio e Vestibulares
 
ácidos nucleicos
ácidos nucleicosácidos nucleicos
ácidos nucléicos
ácidos nucléicosácidos nucléicos
ácidos nucléicos
Yuri Almeida
 
Bases genética da hereditariedade
Bases genética da hereditariedadeBases genética da hereditariedade
Bases genética da hereditariedade
Herivelto Carlotto
 
DNA e síntese proteica I.pptx
DNA e síntese proteica I.pptxDNA e síntese proteica I.pptx
DNA e síntese proteica I.pptx
mariagrave
 
áCidos nucleicos.1
áCidos nucleicos.1áCidos nucleicos.1
áCidos nucleicos.1
Alpha Colégio e Vestibulares
 

Semelhante a Transcrição e tradução (20)

ESPECÍFICA REPLIC TRANSC E TRAD
ESPECÍFICA REPLIC TRANSC E TRADESPECÍFICA REPLIC TRANSC E TRAD
ESPECÍFICA REPLIC TRANSC E TRAD
 
1 s äcidos nucl[eicos_maio 2012
1 s äcidos nucl[eicos_maio 20121 s äcidos nucl[eicos_maio 2012
1 s äcidos nucl[eicos_maio 2012
 
Acidosnucleicos
AcidosnucleicosAcidosnucleicos
Acidosnucleicos
 
1 s äcidos nucleicos_maio
1 s äcidos nucleicos_maio1 s äcidos nucleicos_maio
1 s äcidos nucleicos_maio
 
Aula3 sintese prtn
Aula3 sintese prtnAula3 sintese prtn
Aula3 sintese prtn
 
Ácidos nucleicos e a síntese proteicappt
Ácidos nucleicos e a síntese proteicapptÁcidos nucleicos e a síntese proteicappt
Ácidos nucleicos e a síntese proteicappt
 
Transcrição gênica
Transcrição gênicaTranscrição gênica
Transcrição gênica
 
Aula duplicaçao do dna 2
Aula duplicaçao do dna 2Aula duplicaçao do dna 2
Aula duplicaçao do dna 2
 
Transcrição gênica
Transcrição gênicaTranscrição gênica
Transcrição gênica
 
Metabolismo dos nucleotídeos
Metabolismo dos nucleotídeosMetabolismo dos nucleotídeos
Metabolismo dos nucleotídeos
 
6 dogma central da biologia molecular transcrição
6 dogma central da biologia molecular   transcrição6 dogma central da biologia molecular   transcrição
6 dogma central da biologia molecular transcrição
 
Biologia Celular: Dogma Central de Biologia
Biologia Celular: Dogma Central de BiologiaBiologia Celular: Dogma Central de Biologia
Biologia Celular: Dogma Central de Biologia
 
Ácidos Nucleicos
Ácidos Nucleicos  Ácidos Nucleicos
Ácidos Nucleicos
 
Genes apresentação
Genes   apresentaçãoGenes   apresentação
Genes apresentação
 
Biologia aula 04 ácidos nucleicos
Biologia aula 04   ácidos nucleicosBiologia aula 04   ácidos nucleicos
Biologia aula 04 ácidos nucleicos
 
ácidos nucleicos
ácidos nucleicosácidos nucleicos
ácidos nucleicos
 
ácidos nucléicos
ácidos nucléicosácidos nucléicos
ácidos nucléicos
 
Bases genética da hereditariedade
Bases genética da hereditariedadeBases genética da hereditariedade
Bases genética da hereditariedade
 
DNA e síntese proteica I.pptx
DNA e síntese proteica I.pptxDNA e síntese proteica I.pptx
DNA e síntese proteica I.pptx
 
áCidos nucleicos.1
áCidos nucleicos.1áCidos nucleicos.1
áCidos nucleicos.1
 

Mais de Centro de Educação e Cultura Pré-Vestibular Resgate Popular

Dançar tango em Porto Alegre
Dançar tango em Porto AlegreDançar tango em Porto Alegre
A noite das mulheres cantoras
A noite das mulheres cantorasA noite das mulheres cantoras
Vanguardas e Modernismo
Vanguardas e ModernismoVanguardas e Modernismo
Memórias de um sargento de milícias
Memórias de um sargento de milíciasMemórias de um sargento de milícias
Romantismo romancistas
Romantismo romancistasRomantismo romancistas
Portas abertas 2014
Portas abertas 2014Portas abertas 2014
Romantismo contexto e poetas
Romantismo contexto e poetasRomantismo contexto e poetas
Egito antigo
Egito antigo Egito antigo
Artigos - espanhol
Artigos - espanholArtigos - espanhol
Arcadismo
ArcadismoArcadismo
Luís vaz de camões
Luís vaz de camõesLuís vaz de camões
Gil vicente aula
Gil vicente aulaGil vicente aula
Aula caminha
Aula caminhaAula caminha
Aula arcadismo
Aula arcadismoAula arcadismo
Aula barroco
Aula barrocoAula barroco
Gregório de matos
Gregório de matosGregório de matos
Falsos cognatos
Falsos cognatosFalsos cognatos
Pe antonio vieira
Pe antonio vieiraPe antonio vieira
Barroco
BarrocoBarroco
As artes no renascimento
As artes no renascimentoAs artes no renascimento

Mais de Centro de Educação e Cultura Pré-Vestibular Resgate Popular (20)

Dançar tango em Porto Alegre
Dançar tango em Porto AlegreDançar tango em Porto Alegre
Dançar tango em Porto Alegre
 
A noite das mulheres cantoras
A noite das mulheres cantorasA noite das mulheres cantoras
A noite das mulheres cantoras
 
Vanguardas e Modernismo
Vanguardas e ModernismoVanguardas e Modernismo
Vanguardas e Modernismo
 
Memórias de um sargento de milícias
Memórias de um sargento de milíciasMemórias de um sargento de milícias
Memórias de um sargento de milícias
 
Romantismo romancistas
Romantismo romancistasRomantismo romancistas
Romantismo romancistas
 
Portas abertas 2014
Portas abertas 2014Portas abertas 2014
Portas abertas 2014
 
Romantismo contexto e poetas
Romantismo contexto e poetasRomantismo contexto e poetas
Romantismo contexto e poetas
 
Egito antigo
Egito antigo Egito antigo
Egito antigo
 
Artigos - espanhol
Artigos - espanholArtigos - espanhol
Artigos - espanhol
 
Arcadismo
ArcadismoArcadismo
Arcadismo
 
Luís vaz de camões
Luís vaz de camõesLuís vaz de camões
Luís vaz de camões
 
Gil vicente aula
Gil vicente aulaGil vicente aula
Gil vicente aula
 
Aula caminha
Aula caminhaAula caminha
Aula caminha
 
Aula arcadismo
Aula arcadismoAula arcadismo
Aula arcadismo
 
Aula barroco
Aula barrocoAula barroco
Aula barroco
 
Gregório de matos
Gregório de matosGregório de matos
Gregório de matos
 
Falsos cognatos
Falsos cognatosFalsos cognatos
Falsos cognatos
 
Pe antonio vieira
Pe antonio vieiraPe antonio vieira
Pe antonio vieira
 
Barroco
BarrocoBarroco
Barroco
 
As artes no renascimento
As artes no renascimentoAs artes no renascimento
As artes no renascimento
 

Último

347018542-PAULINA-CHIZIANE-Balada-de-Amor-ao-Vento-pdf.pdf
347018542-PAULINA-CHIZIANE-Balada-de-Amor-ao-Vento-pdf.pdf347018542-PAULINA-CHIZIANE-Balada-de-Amor-ao-Vento-pdf.pdf
347018542-PAULINA-CHIZIANE-Balada-de-Amor-ao-Vento-pdf.pdf
AntnioManuelAgdoma
 
O sentimento nacional brasiliero, segundo o historiador Jose Murlo de Carvalho
O sentimento nacional brasiliero, segundo o historiador Jose Murlo de CarvalhoO sentimento nacional brasiliero, segundo o historiador Jose Murlo de Carvalho
O sentimento nacional brasiliero, segundo o historiador Jose Murlo de Carvalho
analuisasesso
 
Leonardo da Vinci .pptx
Leonardo da Vinci                  .pptxLeonardo da Vinci                  .pptx
Leonardo da Vinci .pptx
TomasSousa7
 
educação inclusiva na atualidade como ela se estabelece atualmente
educação inclusiva na atualidade como ela se estabelece atualmenteeducação inclusiva na atualidade como ela se estabelece atualmente
educação inclusiva na atualidade como ela se estabelece atualmente
DeuzinhaAzevedo
 
A dinâmica da população mundial de acordo com as teorias populacionais.pptx
A dinâmica da população mundial de acordo com as teorias populacionais.pptxA dinâmica da população mundial de acordo com as teorias populacionais.pptx
A dinâmica da população mundial de acordo com as teorias populacionais.pptx
ReinaldoSouza57
 
- TEMPLATE DA PRATICA - Psicomotricidade.pptx
- TEMPLATE DA PRATICA - Psicomotricidade.pptx- TEMPLATE DA PRATICA - Psicomotricidade.pptx
- TEMPLATE DA PRATICA - Psicomotricidade.pptx
LucianaCristina58
 
Apresentação_Primeira_Guerra_Mundial 9 ANO-1.pptx
Apresentação_Primeira_Guerra_Mundial 9 ANO-1.pptxApresentação_Primeira_Guerra_Mundial 9 ANO-1.pptx
Apresentação_Primeira_Guerra_Mundial 9 ANO-1.pptx
JulianeMelo17
 
Vogais Ilustrados para alfabetização infantil
Vogais Ilustrados para alfabetização infantilVogais Ilustrados para alfabetização infantil
Vogais Ilustrados para alfabetização infantil
mamaeieby
 
Fernão Lopes. pptx
Fernão Lopes.                       pptxFernão Lopes.                       pptx
Fernão Lopes. pptx
TomasSousa7
 
.Template .padrao .slides .TCC .2024 ppt
.Template .padrao .slides .TCC .2024 ppt.Template .padrao .slides .TCC .2024 ppt
.Template .padrao .slides .TCC .2024 ppt
IslanderAndrade
 
socialização faculdade uniasselvi 2024 matea
socialização faculdade uniasselvi 2024 mateasocialização faculdade uniasselvi 2024 matea
socialização faculdade uniasselvi 2024 matea
ILDISONRAFAELBARBOSA
 
BULLYING NÃO É AMOR.pdf LIVRO PARA TRABALHAR COM ALUNOS ATRAVÉS DE PROJETOS...
BULLYING NÃO É AMOR.pdf LIVRO PARA TRABALHAR COM ALUNOS ATRAVÉS DE PROJETOS...BULLYING NÃO É AMOR.pdf LIVRO PARA TRABALHAR COM ALUNOS ATRAVÉS DE PROJETOS...
BULLYING NÃO É AMOR.pdf LIVRO PARA TRABALHAR COM ALUNOS ATRAVÉS DE PROJETOS...
Escola Municipal Jesus Cristo
 
Sócrates e os sofistas - apresentação de slides
Sócrates e os sofistas - apresentação de slidesSócrates e os sofistas - apresentação de slides
Sócrates e os sofistas - apresentação de slides
jbellas2
 
Slides Lição 11, CPAD, A Realidade Bíblica do Inferno, 2Tr24.pptx
Slides Lição 11, CPAD, A Realidade Bíblica do Inferno, 2Tr24.pptxSlides Lição 11, CPAD, A Realidade Bíblica do Inferno, 2Tr24.pptx
Slides Lição 11, CPAD, A Realidade Bíblica do Inferno, 2Tr24.pptx
LuizHenriquedeAlmeid6
 
Redação e Leitura_7º ano_58_Produção de cordel .pptx
Redação e Leitura_7º ano_58_Produção de cordel .pptxRedação e Leitura_7º ano_58_Produção de cordel .pptx
Redação e Leitura_7º ano_58_Produção de cordel .pptx
DECIOMAURINARAMOS
 
Aula 1 do livro de Ciências do aluno - sons
Aula 1 do livro de Ciências do aluno - sonsAula 1 do livro de Ciências do aluno - sons
Aula 1 do livro de Ciências do aluno - sons
Érika Rufo
 
Sistema de Bibliotecas UCS - Chronica do emperador Clarimundo, donde os reis ...
Sistema de Bibliotecas UCS - Chronica do emperador Clarimundo, donde os reis ...Sistema de Bibliotecas UCS - Chronica do emperador Clarimundo, donde os reis ...
Sistema de Bibliotecas UCS - Chronica do emperador Clarimundo, donde os reis ...
Biblioteca UCS
 
Caça-palavras - ortografia S, SS, X, C e Z
Caça-palavras - ortografia  S, SS, X, C e ZCaça-palavras - ortografia  S, SS, X, C e Z
Caça-palavras - ortografia S, SS, X, C e Z
Mary Alvarenga
 
Funções e Progressões - Livro completo prisma
Funções e Progressões - Livro completo prismaFunções e Progressões - Livro completo prisma
Funções e Progressões - Livro completo prisma
djincognito
 
Famílias Que Contribuíram Para O Crescimento Do Assaré
Famílias Que Contribuíram Para O Crescimento Do AssaréFamílias Que Contribuíram Para O Crescimento Do Assaré
Famílias Que Contribuíram Para O Crescimento Do Assaré
profesfrancleite
 

Último (20)

347018542-PAULINA-CHIZIANE-Balada-de-Amor-ao-Vento-pdf.pdf
347018542-PAULINA-CHIZIANE-Balada-de-Amor-ao-Vento-pdf.pdf347018542-PAULINA-CHIZIANE-Balada-de-Amor-ao-Vento-pdf.pdf
347018542-PAULINA-CHIZIANE-Balada-de-Amor-ao-Vento-pdf.pdf
 
O sentimento nacional brasiliero, segundo o historiador Jose Murlo de Carvalho
O sentimento nacional brasiliero, segundo o historiador Jose Murlo de CarvalhoO sentimento nacional brasiliero, segundo o historiador Jose Murlo de Carvalho
O sentimento nacional brasiliero, segundo o historiador Jose Murlo de Carvalho
 
Leonardo da Vinci .pptx
Leonardo da Vinci                  .pptxLeonardo da Vinci                  .pptx
Leonardo da Vinci .pptx
 
educação inclusiva na atualidade como ela se estabelece atualmente
educação inclusiva na atualidade como ela se estabelece atualmenteeducação inclusiva na atualidade como ela se estabelece atualmente
educação inclusiva na atualidade como ela se estabelece atualmente
 
A dinâmica da população mundial de acordo com as teorias populacionais.pptx
A dinâmica da população mundial de acordo com as teorias populacionais.pptxA dinâmica da população mundial de acordo com as teorias populacionais.pptx
A dinâmica da população mundial de acordo com as teorias populacionais.pptx
 
- TEMPLATE DA PRATICA - Psicomotricidade.pptx
- TEMPLATE DA PRATICA - Psicomotricidade.pptx- TEMPLATE DA PRATICA - Psicomotricidade.pptx
- TEMPLATE DA PRATICA - Psicomotricidade.pptx
 
Apresentação_Primeira_Guerra_Mundial 9 ANO-1.pptx
Apresentação_Primeira_Guerra_Mundial 9 ANO-1.pptxApresentação_Primeira_Guerra_Mundial 9 ANO-1.pptx
Apresentação_Primeira_Guerra_Mundial 9 ANO-1.pptx
 
Vogais Ilustrados para alfabetização infantil
Vogais Ilustrados para alfabetização infantilVogais Ilustrados para alfabetização infantil
Vogais Ilustrados para alfabetização infantil
 
Fernão Lopes. pptx
Fernão Lopes.                       pptxFernão Lopes.                       pptx
Fernão Lopes. pptx
 
.Template .padrao .slides .TCC .2024 ppt
.Template .padrao .slides .TCC .2024 ppt.Template .padrao .slides .TCC .2024 ppt
.Template .padrao .slides .TCC .2024 ppt
 
socialização faculdade uniasselvi 2024 matea
socialização faculdade uniasselvi 2024 mateasocialização faculdade uniasselvi 2024 matea
socialização faculdade uniasselvi 2024 matea
 
BULLYING NÃO É AMOR.pdf LIVRO PARA TRABALHAR COM ALUNOS ATRAVÉS DE PROJETOS...
BULLYING NÃO É AMOR.pdf LIVRO PARA TRABALHAR COM ALUNOS ATRAVÉS DE PROJETOS...BULLYING NÃO É AMOR.pdf LIVRO PARA TRABALHAR COM ALUNOS ATRAVÉS DE PROJETOS...
BULLYING NÃO É AMOR.pdf LIVRO PARA TRABALHAR COM ALUNOS ATRAVÉS DE PROJETOS...
 
Sócrates e os sofistas - apresentação de slides
Sócrates e os sofistas - apresentação de slidesSócrates e os sofistas - apresentação de slides
Sócrates e os sofistas - apresentação de slides
 
Slides Lição 11, CPAD, A Realidade Bíblica do Inferno, 2Tr24.pptx
Slides Lição 11, CPAD, A Realidade Bíblica do Inferno, 2Tr24.pptxSlides Lição 11, CPAD, A Realidade Bíblica do Inferno, 2Tr24.pptx
Slides Lição 11, CPAD, A Realidade Bíblica do Inferno, 2Tr24.pptx
 
Redação e Leitura_7º ano_58_Produção de cordel .pptx
Redação e Leitura_7º ano_58_Produção de cordel .pptxRedação e Leitura_7º ano_58_Produção de cordel .pptx
Redação e Leitura_7º ano_58_Produção de cordel .pptx
 
Aula 1 do livro de Ciências do aluno - sons
Aula 1 do livro de Ciências do aluno - sonsAula 1 do livro de Ciências do aluno - sons
Aula 1 do livro de Ciências do aluno - sons
 
Sistema de Bibliotecas UCS - Chronica do emperador Clarimundo, donde os reis ...
Sistema de Bibliotecas UCS - Chronica do emperador Clarimundo, donde os reis ...Sistema de Bibliotecas UCS - Chronica do emperador Clarimundo, donde os reis ...
Sistema de Bibliotecas UCS - Chronica do emperador Clarimundo, donde os reis ...
 
Caça-palavras - ortografia S, SS, X, C e Z
Caça-palavras - ortografia  S, SS, X, C e ZCaça-palavras - ortografia  S, SS, X, C e Z
Caça-palavras - ortografia S, SS, X, C e Z
 
Funções e Progressões - Livro completo prisma
Funções e Progressões - Livro completo prismaFunções e Progressões - Livro completo prisma
Funções e Progressões - Livro completo prisma
 
Famílias Que Contribuíram Para O Crescimento Do Assaré
Famílias Que Contribuíram Para O Crescimento Do AssaréFamílias Que Contribuíram Para O Crescimento Do Assaré
Famílias Que Contribuíram Para O Crescimento Do Assaré
 

Transcrição e tradução