Microbiologia Geral - Introdução e Histórico

1.399 visualizações

Publicada em

Aula da disciplina de Microbiologia Geral do Prof. Dr. Juliano de Carvalho Cury no CSL-UFSJ

Publicada em: Educação
0 comentários
0 gostaram
  • Seja o primeiro a comentar

  • Seja a primeira pessoa a gostar disto

Sem downloads
Visualizações totais
No SlideShare
A partir de incorporações
Número de incorporações
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Microbiologia Geral - Introdução e Histórico

  1. 1. 17/10/2013 História da microbiologia Microscópios Robert Hooke - Inglaterra Matemático e historiador natural 1635 - 1703 1665 Descrição da estrutura dos bolores Considerada a primeira descrição de micro-organismos Bolor azulado crescendo em uma superfície de couro Esporângios contendo os esporos http://archive.nlm.nih.gov/proj/ttp/fla sh/hooke/hooke.html 1
  2. 2. 17/10/2013 Antoni van Leeuwenhoek – Holanda Construtor amador de lentes e microscópios 1632 - 1723 Placa de bronze Lente Parafuso de ajuste de foco Amostra http://www.ucmp.berkeley.edu/history/leeuwenhoek.html Primeiro a visualizar bactérias http://ebiomedia.com/prod/LC/LCcellunit.html 1676 • Placa dental • Material vegetal em decomposição • Água 1684 – Sociedade Real de Londres “animáculos” Século XIX – avanço dos microscópios Ferdinand Cohn – Polônia 1828 – 1898 Botânico Bacteriologia – técnicas simples – ex. Bucha de algodão para evitar contaminação dos meios de cultura Algas unicelulares e bactérias fotossintetizantes Pai da bacteriologia e protozoologia Beggiatoa (oxida sulfeto – grânulos de S) (brock p. 12 – desenho 1866) 150 anos – progresso lento Descreveu o ciclo de Bacillus – formadora de endósporos (resistentes à água em ebulição) http://www.fop.unicamp.br/microbiologia/aulas/introducao.pdf Segunda metade do Século XIX – duas questões 1 – Geração expontânea 2 – Doenças infecciosas Micro-organismos são ubíquos Ar, solo, água, dentro (endofíticos) e na superfície de plantas e animais (incluindo os humanos) Biogênese x Abiogênese (geração espontânea) Pensamentos: Científico x Religioso / filosófico Primeira grande contribuição dos microrganismos - Até início século XIX – pais ou geração espontânea – Thales, Platão, Demócrito, São Tomás de Aquino, Goethe, Copérnico, Galileu, Francis Bacon, Descartes etc. - Material em putrefação – geração de vida – “receitas” Uma colher de chá de solo superficial pode conter 1 bilhão de células bacterianas A nossa boca pode conter 500 diferentes espécies de bactérias. Nossa pele pode ter 100 mil bactérias por centímetro quadrado Médico Jean Baptiste Van Helmont 2
  3. 3. 17/10/2013 Declínio da Abiogênese Luis Joblot Médico e biólogo Francesco Redi - 1866 Microrganismos em toda parte – microscópio – geração espontânea - Dois padres Difícil reprodução – crescimento posterior – contaminação – erros técnicos Pasteur X John Needham Lazzaro Spallanzani 1 – Mesmo com aquecimento e uso de frascos de gargalo estreito, microrganismos continuam aparecendo 2 – Não aqueceu o suficiente para tornar estéril 3 – Destruição do “princípio vital” e da “qualidade do ar” Origem da vida? – panspermia – astrobiologia Louis Pasteur Pasteurização - Aquecimento do alimento a uma determinada temperatura por determinado período de tempo um - Elimina alguns microrganismos (quais?) - Em seguida o alimento é selado hermeticamente (por que?) - Processo de pasteurização - Demonstrou a existência da vida sem ar (“la vie sans air”) - Cada tipo de fermentação é desempenhada por um organismo - Princípios da imunização - Pai da microbiologia - Pasteurização = esterilização? (= controle de crescimento?) - Melhora da qualidade de vida (por que?) - Pasteurização lenta – 65 graus 30 segundos - Pasteurização rápida – 75 graus alguns segundos - Pasteurização muito rápida – 130 a 150 graus 3 a 5 segundos (Ultra High Temperature – UHT) – B. subtilis e B. estearothermophilus – termotolerantes - UHT é “comercialmente estério” – longa vida 3
  4. 4. 17/10/2013 - Importância médica – desenvolvimento da microbiologia Bacillus anthracis carbúnculo - Época de ouro da microbiologia Koch – meios de cultura (1881) http://www.nobel.se/medicine/laureates/1905/koch-bio.html Koch -Estudo da forma e estrutura -Identificação http://upload.wikimedia.org/wikipedia/commons/thumb/1/19/M anWithPetriDishes.jpg/200px-ManWithPetriDishes.jpg -Patologias, transformações da MO, fermentação -Reprodução, fisiologia, metabolismo, genética (micro-organismos como modelos) Penicilina – Alexander Fleming Segunda grande contribuição dos micro-organismos Microbiologia Sergei Winogradsky - Microbiologia do Solo http://www.pasteur.fr/infosci/archives/win0.html http://helios.bto.ed.ac.uk/bto/microbes/winograd.htm Watson e Crick – DNA (1953) Rosalind Franklin e Maurice Wilkins http://www.time.com/time/time100/scientist/profile/watsoncrick.html 4
  5. 5. 17/10/2013 Kary Mullis – PCR (1985) http://www.karymullis.com/ PCR (Polimerase Chain Raction) (Reação em cadeia da polimerase) http://polaris.bioch.ox.ac.uk/dnaseq/images/photo_9700_1.jpg Multiplicação in vitro de fragmentos de DNA - DNA genômico - cDNA - Produtos de PCR (amplicons) - Fragmentos de DNA clonados em vetores - DNTPs – A T C G - DNA Polimerase – Taq DNA Polimerase – Thermus aquaticus http://www.med.uni-jena.de/klinikmagazin/archiv/km698/kmonline/pcr.jpg - Tampão – PCR Buffer - MgCl – cofator da Taq Reação de PCR - Reagentes - DNA-molde – amostra de DNA genômico contendo a sequência-alvo conservada - Iniciadores (“primers”) – Forward e Reverse Ex. BA338F – 5’ ACGGACTCCTACGGGAGGCAGCAG 3' UN518r - 5' ATTACCGCGGCTGCTGG 3' Arch21F - 5' TTCYGGTTGATCCYGCCIGA 3' Arch958R - 5' YCCGGCGTTGA(I/C)TCCAA TT 3' * Definição dos iniciadores (“primers”) 5
