SlideShare uma empresa Scribd logo
1 de 90
Baixar para ler offline
2a
SÉRIE
ENSINO MÉDIO
Volume2
BIOLOGIA
Ciências da Natureza
CADERNO DO ALUNO
MATERIAL DE APOIO AO
CURRÍCULO DO ESTADO DE SÃO PAULO
CADERNO DO ALUNO
BIOLOGIA
ENSINO MÉDIO
2a
SÉRIE
VOLUME 2
Nova edição
2014-2017
GOVERNO DO ESTADO DE SÃO PAULO
SECRETARIA DA EDUCAÇÃO
São Paulo
Governo do Estado de São Paulo
Governador
Geraldo Alckmin
Vice-Governador
Guilherme Afif Domingos
Secretário da Educação
Herman Voorwald
Secretária-Adjunta
Cleide Bauab Eid Bochixio
Chefe de Gabinete
Fernando Padula Novaes
Subsecretária de Articulação Regional
Rosania Morales Morroni
Coordenadora da Escola de Formação e
Aperfeiçoamento dos Professores – EFAP
Silvia Andrade da Cunha Galletta
Coordenadora de Gestão da
Educação Básica
Maria Elizabete da Costa
Coordenadora de Gestão de
Recursos Humanos
Cleide Bauab Eid Bochixio
Coordenadora de Informação,
Monitoramento e Avaliação
Educacional
Ione Cristina Ribeiro de Assunção
Coordenadora de Infraestrutura e
Serviços Escolares
Dione Whitehurst Di Pietro
Coordenadora de Orçamento e
Finanças
Claudia Chiaroni Afuso
Presidente da Fundação para o
Desenvolvimento da Educação – FDE
Barjas Negri
Caro(a) aluno(a)
No volume anterior do Caderno do Aluno, as temáticas envolvendo os estudos da Organização
Celular da Vida estiveram presentes ao longo de todo o caderno. Esperamos que você tenha iniciado
a compreensão da Vida a partir de uma perspectiva microscópica ampliando, assim, os conhecimentos
construídos na 1ª série do Ensino Médio. Conceitos sobre a Transmissão da Vida e da Variabilidade
Genética também fizeram parte dessa construção. Além disso, você teve a oportunidade de conhecer
os princípios das Leis de Mendel, as quais, até hoje, fundamentam a Genética Clássica e a Molecular.
Neste volume 2, o objetivo é aprofundar seus conhecimentos sobre Genética, de modo a com-
preender não somente os mecanismos de transmissão e de variabilidade genética, mas também como
o organismo pode ser controlado pelas proteínas, cujo mecanismo de produção está intimamente
associado ao DNA. Para isso, é necessário estudar a estrutura do DNA, compreender os processos
de Duplicação, Transcrição e Tradução. Esses mecanismos permitem a transmissão das características
e o controle do metabolismo do organismo através das proteínas.
Por fim, você terá a oportunidade de consolidar seus conhecimentos sobre alguns assuntos mais
recentes em termos de pesquisa científica em Genética, tais como: os testes de identificação através
do DNA e a produção dos transgênicos. Estes tópicos ainda são alvo de muita controvérsia na
atualidade.
Bons estudos!
Equipe Curricular de Biologia
Área de Ciências da Natureza
Coordenadoria de Gestão da Educação Básica – CGEB
Secretaria da Educação do Estado de São Paulo
TEMA DNA: A ECE TA DA V DA E SE C D GO
A compreensão atual sobre o funcionamento dos seres vivos baseia-se em alguns fundamentos,
sendo que um deles estabelece que as proteínas, macromoléculas de aminoácidos, são responsáveis
por muitas das atividades das células e dos organismos.
S T A O DE AP END AGEM 1
A EST T A DO DNA
Você, provavelmente, já conhece a sigla DNA. Seja porque já ouviu falar dela na escola, seja
porque leu alguma notícia ou assistiu a um programa de televisão que citava a sigla.
Nesta Situação de Aprendizagem, você vai se familiarizar com essa molécula, com as diferentes
formas de representá-la e com sua organização molecular.
Para começo de conversa
O que você conhece sobre o DNA
!
?
Leitura e análise de imagem
Analise a figura a seguir e depois responda às questões.
5
Biologia – 2ª série – Volume 2
Capa da revista Nature, de 15 de fevereiro de 2001, que anunciou o sequenciamento do genoma humano.
eprinted b permission from Macmillan Publishers Ltd: Nature 0 , 22 (15 ebruar 2001) Cover.
©MacmillanPublishers
Biologia – 2ª série – Volume 2
DNA
José Miguel Wisnik
Quando você nasceu ouvi seu grito
Embora longe muito longe de você
Meu coração bateu tambor aflito
Tambor aflito e tonto de bater
De tanto ser demais
De tanto ser além
De tanto bem e eu não ter paz
m raio quando cai
No medo que me fez
Não me sentir capaz de ser seu pai
Anos se passaram pela vida e te criaram
Noites de lembrar e de esquecer
Sonhos que não sei me esconderam e
[me mostraram
Esse dia em que eu te encontrei moça
[e mulher
E ali em frente a mim você me disse
Que a falta que eu nunca te fiz então se fez
E desabando como um edifício
Abria um abismo a nossos pés
1. Como a imagem do DNA foi composta na capa da revista
2. Na sua opinião, o que signi ca essa imagem na capa de uma revista que trata sobre o sequen-
ciamento do genoma humano
. Quais características da molécula de DNA podem ser observadas nessa imagem
Leitura e análise de texto
Agora você vai ler a letra da música DNA, de José Miguel Wisnik, para responder às questões.
Você nos viu tão bem
No fundo de ninguém
E o que se revelava a sós:
Que elo nos valeu
Que elo, ela e eu
E a lua absurda sobre nós
DNA, DNA
Dança sua dança
Dança em espirais
DNA, DNA
Ponte indecifrável
Onde nos levais
Seja onde for
Onda do mar
Mágica tão frágil
Ser e nada mais
DNA, DNA
Daniela
© Maianga Edições Musicais
7
Biologia – 2ª série – Volume 2
1. Qual é a relação de parentesco entre as personagens da canção Justi que com elementos pre-
sentes no texto.
2. As personagens da canção apresentam um elo que não é a convivência. De acordo com a can-
ção, que elo é esse
3. Localize, no texto, todas as sequências das letras “D”, “N” e “A” apresentadas nas três últimas
estrofes. Liste as palavras que apresentam as três letras simultaneamente.
. Com as palavras listadas na questão anterior, o autor da música, José Miguel Wisnik, cria um
efeito similar a uma das características da molécula de DNA, observável na capa da revista.
Que característica é essa
Revelando a organização da molécula de DNA
A substância ácido desoxirribonucleico (ADN ou DNA) é um polímero de nucleotídeos.
dentifique e escreva os nomes dos componentes de um nucleotídeo na ilustração a seguir.
Nucleotídeo
Nucleotídeo de DNA
+ +
Biologia – 2ª série – Volume 2
Leitura e análise de texto e imagem
O modelo da molécula da vida
Em 1 53, rancis Crick e James
Watson publicaram um artigo na
revista Nature no qual sugeriam um
modelo para a molécula do DNA.
Segundo esse modelo, a molécula de
DNA seria constituída por dois
polímeros de nucleotídeos organi-
zados em forma de uma dupla-hélice,
como uma escada retorcida. Os corri-
mãos dessa escada são formados de
açúcar e fosfato.
A novidade da estrutura proposta,
além do formato em dupla-hélice,
estava relacionada principalmente à
maneira como os elementos estavam
dispostos no DNA. De acordo com o
modelo, as duas cadeias eram manti-
das juntas por quatro bases nitrogena-
das, duas purinas (adenina e guanina)
e duas pirimidinas (timina e citosina),
arranjadas aos pares e dispostas perpen-
dicularmente ao eixo da molécula.
Essas bases nitrogenadas estariam
unidas aos pares por pontes de hidrogênio. Os pares seriam específicos, pois as pontes de
hidrogênio só poderiam ocorrer entre uma purina e uma pirimidina. Assim, a adenina
(purina) só pode se ligar à timina (pirimidina), e a guanina (purina) só se liga à citosina
(pirimidina). sso significava que, se em uma das cadeias a base era uma adenina, o elemento
correspondente na outra cadeia deveria ser uma timina. O mesmo ocorreria para o par
guanina e citosina.
Observe a imagem e faça a correspondência entre as características que estão sublinhadas
no texto e as estruturas da ilustração.
lustração esquemática de uma molécula de DNA.
Cadeia de
açúcar e fosfato
Adenina
Timina
Guanina
Citosina
©SamuelSilva
Biologia – 2ª série – Volume 2
Consolidando os conceitos
ácido
desoxirribonucleico
polímero
dupla-hélice
fosfatos
açúcar
bases
nitrogenadas
adenina citosina
guanina
forma par com forma par com
não estão ligados(as) com
são
ligam-se entre si por
meio deestão ligados(as) com
estão ligados(as)
com
que são formados por
é constituído
por muitos
que se
mantém
ligada por
é formado
por uma
é a sigla para o
é um
Você já viu um
mapa de conceitos
um esquema que explica
por meio de texto, ima-
gem e fluxo de setas o
que acontece em deter-
minado fenômeno.
No mapa de concei-
tos proposto, estão fal-
tando alguns elementos.
Converse com seus cole-
gas e descubra a melhor
maneira de completá-lo.
Desafio!
Mapa de conceitos sobre a estrutura do DNA.
tilize as informações do mapa de conceitos que você completou com a ajuda dos colegas, para
construir um texto em seu caderno explicando o que é e como está organizada a molécula de DNA.
Depois de elaborar o texto, responda à seguinte questão:
Na capa da revista Nature, as bases nitrogenadas estão representadas por cores diferentes.
Qual é o signi cado disso
©ConexãoEditorial
é um tipo de
10
Biologia – 2ª série – Volume 2
VOC AP ENDE
1. Em um segmento de 100 nucleotídeos de uma cadeia de DNA, há 25 adeninas e 15 guaninas;
no segmento correspondente da cadeia complementar há 30 adeninas. Com base nesses dados,
conclui-se que essa molécula de DNA, considerando as duas cadeias, possui:
a) 0 timinas.
b) 50 guaninas.
c) 30 timinas.
d) 25 timinas.
e) 5 citosinas.
2. (Enem–200 ) A identi cação da estrutura do DNA foi fundamental para compreender seu
papel na continuidade da vida. Na década de 1 50, um estudo pioneiro determinou a propor-
ção das bases nitrogenadas que compõem moléculas de DNA de várias espécies.
Exemplos de
materiais analisados
Bases nitrogenadas
Adenina Guanina Citosina Timina
Espermatozoide humano 30,7% 1 ,3% 1 , % 31,2%
ígado humano 30, % 1 ,5% 1 , % 30,2%
Medula óssea de rato 2 , % 21, % 21,5% 2 ,5%
Espermatozoide de ouriço-do-mar 32, % 17,7% 1 , % 32,1%
Plântulas de trigo 27, % 21, % 22,7% 27, %
Bactéria Escherichia coli 2 ,1% 2 , % 23, % 25,1%
A comparação das proporções permitiu concluir que ocorre emparelhamento entre as bases
nitrogenadas e que elas formam:
a) pares de mesmo tipo em todas as espécies, evidenciando a universalidade da estrutura do
DNA.
b) pares diferentes de acordo com a espécie considerada, o que garante a diversidade da vida.
c) pares diferentes em diferentes células de uma espécie, como resultado da diferenciação
celular.
d) pares especí cos apenas nos gametas, pois essas células são responsáveis pela perpetuação
das espécies.
e) pares especí cos somente nas bactérias, pois esses organismos são formados por uma única
célula.
11
Biologia – 2ª série – Volume 2
3. A publicação do trabalho de rancis Crick e James Watson que estabeleceu o modelo da estru-
tura da molécula de ácido desoxirribonucleico (DNA) ocorreu em 1 53. Entre as a rmativas a
seguir, assinale a CO ETA:
a) ma cadeia simples de DNA é constituída de nucleotídeos, compostos por uma desoxirri-
bose ligada a um fosfato e a um aminoácido.
b) Os nucleotídeos são ligados entre o fosfato e a base nitrogenada.
c) Duas cadeias simples de DNA formam uma dupla-hélice, por meio da formação de ligações
de hidrogênio entre as bases nitrogenadas.
d) As duas cadeias de uma dupla-hélice possuem a mesma sequência de bases nitrogenadas.
e) As ligações de hidrogênio mantêm o fosfato ligado ao açúcar desoxirribose.
. (Comvest Vestibular nicamp – 2005) Em 25 de abril de 1 53, um estudo de uma única
página na revista inglesa Nature intitulado “A estrutura molecular dos ácidos nucleicos”, quase
ignorado de início, revolucionou para sempre todas as ciências da vida, sejam elas de homem,
rato, planta ou bactéria. James Watson e rancis Crick descobriram a estrutura do DNA.
Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida.
Explique a que correspondem os “corrimãos” e os “degraus” dessa escada.
12
Biologia – 2ª série – Volume 2
S T A O DE AP END AGEM 2
A D PL CA O DO DNA
ma das características mais surpreendentes da molécula de DNA é sua capacidade de se duplicar
com o auxílio da enzima DNA polimerase e gerar duas moléculas idênticas.
!
?
Com o auxílio de um colega, analise o grá co e responda às questões a seguir descrevendo o que
observou. Considere, neste exercício, os conteúdos trabalhados no volume 1 sobre divisão celular.
1. O que está acontecendo durante a mitose
2. No período chamado de intérfase (G1, S e G2), o que aconteceu com a quantidade de DNA
3. Ao longo do ciclo celular, a quantidade de DNA por célula começa e termina com que valor
O que isso signi ca
Leitura e análise de gráfico
O gráfico a seguir descreve a variação da quantidade de DNA de uma célula ao longo
de seu ciclo.
2C
C
G1 S G2 G1
Tempo
Mitose
Prófase
Metáfase
Anáfase
TelófaseeCitocinese
QuantidadedeDNA
Quantidade de DNA ao
longo do ciclo celular.
©Lieobaashi
13
Biologia – 2ª série – Volume 2
ma vez concluído o trabalho, troque-o com o de outra dupla. Verifique se a descrição feita
pelos colegas confere com o que está representado no esquema.
Etapas do ciclo celular.
©SamuelSilva
Duplicação
do DNA
Aumento da
massa celular
Célula
Núcleo
Divisão
celular
I
nício do ciclo Mitose
ase S
G1 G2
Aumento da
massa celular
A duplicação do DNA
1. Com base no que você e seus colegas já conhecem, responda: Como a molécula de DNA con-
segue se duplicar As células formadas ao término da mitose são iguais ou diferentes
Atividade coletiva: simulando a duplicação do DNA
Nessa atividade, seu professor vai organizá-los de acordo com as fileiras da classe. Siga as instru-
ções para dramatizar a duplicação de uma molécula de DNA.
1
Biologia – 2ª série – Volume 2
Cada aluno deve escrever em uma folha de papel a base nitrogenada que representa. Cada fileira
de carteiras será uma cadeia de DNA. As fileiras 2 e 3 iniciam a atividade definindo qual será a
sequência de bases nitrogenadas: adenina (A), timina (T), citosina (C) ou guanina (G). Você e seus
colegas podem definir a ordem, porém é importante lembrar da complementaridade das cadeias.
Terminada a dramatização, escreva em seu caderno um resumo do que ocorreu.
1. Agora, retome o grá co do início da Situação de Aprendizagem e compare os fenômenos que
ocorrem na variação de DNA de uma célula ao longo de seu ciclo com as etapas de dramati-
zação que a classe acabou de realizar.
2. Complete a gura a seguir indicando o que representa cada cadeia da imagem de DNA em
relação às leiras que a classe formou durante a dramatização.
1o
Passo
2o
Passo
3o
Passo
leiraleira
leiraleira
leiraleira
leiraleira
leiraleira
©SamuelSilva
tas originais
derivadas da
duplicação
Duplicação do DNA de acordo com a
dramatização realizada.
15
Biologia – 2ª série – Volume 2
L O DE CASA
1. Elabore um texto em seu caderno explicando como a complementaridade das bases nitrogena-
das permite a duplicação do DNA.
Atenção!
Nesse texto, você deve apresentar:
a descrição da estrutura do DNA;
a complementaridade das bases nitrogenadas;
o processo de duplicação do DNA durante o ciclo celular;
a relação entre os eventos anteriores e a produção de duas células idênticas.
PESQ SA ND V D AL
O que é necessário para que o DNA se duplique?
Consulte seu livro didático e identifique o papel da enzima polimerase do DNA (em alguns
livros, você encontra o termo DNA polimerase) no processo de duplicação do DNA e as condições
para que ela atue.
O exercício a seguir requer que você pense no processo de duplicação como algo dinâmico que
ocorre na interação entre o DNA e diversas proteínas. Em primeiro lugar, observe o quadro com a
estimativa do número de pares de base (em bilhões) do DNA de diferentes espécies.
1
Biologia – 2ª série – Volume 2
Espécie Pares de base do DNA
Jiboia 2100000000
Ser humano 3100000000
Gafanhoto 300000000
Cebola 1 000000000
Salamandra 1 0000000000
Ameba 70000000000
Agora, pense no seguinte problema:
Para duplicar o DNA, antes da divisão celular, a enzima polimerase do DNA adiciona novos
nucleotídeos a uma velocidade aproximada de 00 nucleotídeos por segundo. Quantos dias seriam
necessários para uma célula de cada uma das espécies listadas duplicar o seu DNA
Espécie Jiboia Ser humano Gafanhoto Cebola Salamandra Ameba
Dias
possível que você e seus colegas de classe tenham chegado a um número elevado de dias
necessários para a duplicação de uma célula de DNA de cada uma das espécies. Sabe-se, no entanto,
que o tempo médio de duplicação de uma célula eucariota é de 12 horas. Tendo em vista que a
enzima polimerase do DNA apresenta uma velocidade de reação constante para todas as espécies
analisadas, converse com seus colegas e apresente uma hipótese para explicar essa aparente
contradição.
17
Biologia – 2ª série – Volume 2
VOCÊ APRENDEU?
1. Durante a intérfase da célula, pode-se a rmar que:
a) praticamente não há atividade metabólica celular.
b) ocorrem alterações no formato da célula.
c) ocorre duplicação da célula.
d) ocorre duplicação do DNA.
e) a dupla- ta do DNA se separa.
2. A sequência de nucleotídeos CTGACCTTCG forma um segmento de DNA dupla-hélice ao
se ligar à ta complementar:
a) CTGACCTTCG
b) GCTTCCAGTC
c) GACTGGAAGC
d) CTGACCTGCG
e) AGCTTCCAGT
3. Para duplicar o DNA antes da divisão celular, existe uma proteína, a enzima DNA polimerase,
cuja velocidade de reação é equivalente a aproximadamente 00 nucleotídeos por segundo.
Quantos dias seriam necessários para uma célula de mosca-da-fruta duplicar seu DNA, sabendo
que cada célula dessa espécie apresenta aproximadamente1 0 milhões de pares de base de DNA?
a) 10
b) 5
c) 1
d) 7500
e) 125
. Algumas células não se multiplicam ao longo de sua
vida. Entre elas, podem ser citados os neurônios. Para
esse tipo celular especí co, como caria o grá co apre-
sentado a seguir?
1
Biologia – 2ª série – Volume 2
Densidade do DNA
apenas com 1
N
Densidade do DNA
apenas com 15
N
©SamuelSilva
A B C
5. ( uvest–200 ) Bactérias (Escherichia coli) foram cultivadas durante várias gerações em um
meio de cultura no qual toda a fonte de nitrogênio era o isótopo pesado15
N.
De uma amostra destas bactérias (amostra A), extraiu-se o DNA que foi submetido a uma
técnica de centrifugação que permite separar moléculas de DNA de acordo com sua densidade.
O restante das bactérias foi transferido para um meio de cultura em que todo o nitrogênio
disponível era o isótopo normal 1
N. Retirou-se uma segunda amostra (amostra B), quando as
bactérias completaram uma divisão celular neste novo meio, e uma terceira amostra (amostra
C), quando as bactérias completaram duas divisões celulares. O DNA das bactérias das amos-
tras B e C foi também extraído e centrifugado.
A figura mostra o resultado da centrifugação do DNA das três amostras de bactérias.
a) Por que, na amostra B, todo o DNA tem uma densidade intermediária entre o que é cons-
tituído apenas por 1
N e o que contém apenas 15
N?
b) Considerando que, na amostra C, a quantidade de DNA separada na faixa inferior é X, que
quantidade de DNA há na faixa superior?
APRENDENDO A APRENDER
Existe uma série de recursos, disponíveis na internet, que representam o processo de
duplicação do DNA de forma dinâmica e animada. Entre em um site de busca e procure
pelos termos:
replicação DNA;
DNA replication animation.
1
Biologia – 2ª série – Volume 2
Dica!
nicie sua pesquisa pelos sites (acessos em: 27 fev. 201 ):
O DNA vai ao supermercado. Disponível em: http: cib.org.br p-content
uploads 2011 10 dna supermercado.pdf ;
DNA from the beginning. Disponível em: http: .dnaftb.org . Site em língua
inglesa com várias animações relacionadas ao tema.
20
Biologia – 2ª série – Volume 2
S TUA O DE APREND AGEM 3
DO DNA PROTE NA
Nesta Situação de Aprendizagem, você vai relacionar as características da molécula de DNA com
a síntese de RNAs e de proteínas e compreender como esses três tipos de substâncias estão envolvidos
com a manifestação das características.
PESQU SA ND V DUAL
O papel das macromoléculas
comum referir-se às proteínas como componentes importantes para a organização e o funcio-
namento da célula. No entanto, para o desenvolvimento desta Situação de Aprendizagem, é necessário
ter essa noção mais clara e aprofundada. Para isso, pesquise em seu livro didático e na internet,
converse com seus colegas e preencha a tabela a seguir:
!
?
Funções das proteínas
Função Descrição Exemplo
Enzimática
Atuam no metabolismo
catalisando reações químicas.
Pepsina, catalase, ATP
sintetase.
Estrutural
Movimento
Defesa
Comunicação celular
denti cação das células
Transporte
Características do DNA e do RNA
DNA e RNA são ácidos nucleicos, por isso apresentam algumas semelhanças e algumas diferen-
ças. Para estabelecer critérios claros que permitam comparar DNA e RNA, preencha a tabela a seguir
consultando seu livro didático ou outra fonte de informação, como a internet.
21
Biologia – 2ª série – Volume 2
DNA RNA
1. Qual é o signi cado da sigla?
2. O nucleotídeo desse ácido nucleico é
formado por qual tipo de açúcar?
3. Quais são as bases nitrogenadas que
podem formar um nucleotídeo desse
ácido nucleico?
. A molécula desse ácido nucleico é for-
mada por ta simples ou dupla- ta?
5. Quais podem ser as funções desem-
penhadas por moléculas desse ácido
nucleico?
. Em uma célula humana, onde são
encontradas as moléculas desse ácido
nucleico?
Confira com seus colegas o preenchimento da tabela.
O RNA mensageiro
A seguir, você realizará a leitura da história em quadrinhos (HQ) Lembranças de um RNA
mensageiro. Antes dessa leitura, reflita sobre a questão a seguir e registre que informações você espera
encontrar nessa HQ.
Como as informações contidas no DNA, que passam de uma geração para outra, podem
resultar em uma característica?
22
Biologia – 2ª série – Volume 2
©Karmo
23
Biologia – 2ª série – Volume 2
©Karmo
2
Biologia – 2ª série – Volume 2
Após a leitura da HQ, discuta com um colega e responda às questões a seguir:
1. Quais são, a partir das informações da HQ, os três tipos de RNA? Pesquise em seu livro didá-
tico ou em outras fontes quais são suas respectivas funções.
2. Pelo texto, a tradução do RNA mensageiro começa sempre em uma mesma sequência. Que
sequência é essa?
3. Em que local da célula eucariota ocorre a fabricação de RNA mensageiro?
. Em que local da célula eucariota ocorre a tradução do RNA mensageiro?
5. De acordo com o texto, quando é encerrada a tradução do RNA mensageiro?
. Que palavras podem substituir a expressão “sequências de aminoácidos”?
7. Com base na HQ, redija um texto que descreva a síntese de proteínas.
25
Biologia – 2ª série – Volume 2
Decifrando o código genético
Agora, você vai estudar com mais profundidade como uma informação presente no DNA pode
se transformar em uma característica. Para isso, discuta com seus colegas a manchete a seguir, tomando
como base as seguintes questões:
1. O que é um código?
2. O que signi ca código genético?
3. O que os cientistas mapearam?
. O que é o “amarelinho”?
5. O que é o “Genoma Xylella”?
Cientistas mapeiam o código
genético da praga da laranja
inalizado o maior projeto de pesquisa
biológica do País, o Genoma Xylella, que
pretende acabar com o amarelinho.
2
Biologia – 2ª série – Volume 2
Leitura e análise de tabela
O quadro a seguir resume o que a Ciência define como código genético. Com o auxílio
de seu professor e do livro didático ou de outras fontes de consulta, procure compreender
como o código genético é lido. Em seguida, procure pelo significado do termo “códon” e
escreva no espaço a seguir.
Códon:
O código genético dos seres vivos
1ª- letra do
códon
2ª- letra do códon 3ª- letra do
códonU C A G
U
fenilalanina
fenilalanina
leucina
leucina
serina
serina
serina
serina
tirosina
tirosina
parada
parada
cisteína
cisteína
parada
triptofano
U
C
A
G
C
leucina
leucina
leucina
leucina
prolina
prolina
prolina
prolina
histidina
histidina
glutamina
glutamina
arginina
arginina
arginina
arginina
U
C
A
G
A
isoleucina
isoleucina
isoleucina
metionina
treonina
treonina
treonina
treonina
asparagina
asparagina
lisina
lisina
serina
serina
arginina
arginina
U
C
A
G
G
valina
valina
valina
valina
alanina
alanina
alanina
alanina
ácido aspártico
ácido aspártico
ácido glutâmico
ácido glutâmico
glicina
glicina
glicina
glicina
U
C
A
G
. O que é genoma?
27
Biologia – 2ª série – Volume 2
Leitura e análise de texto
O código genético dos seres vivos
Uma notícia publicada no ano 2000 apresentava o seguinte título: “Anunciada decifração
do código genético da espécie humana”. No entanto, o código genético começou a ser
decifrado em 1 1, quando Marshall Nirenberg produziu um RNA mensageiro apenas com
nucleotídeos uracila. A proteína formada por Nirenberg era composta apenas de aminoácidos
fenilalanina. Antes do término da década de 1 0, o código genético estava completamente
decifrado. Para cada trinca de bases nitrogenadas, um aminoácido correspondente já havia
sido identificado, conforme mostra o quadro do código genético dos seres vivos.
Elaborado por Rodrigo Venturoso Mendes da Silveira especialmente para o São Paulo faz escola.
1. Depois de conversar com os colegas sobre o título da reportagem Cientistas mapeiam o código
genético da praga da laranja e de observar o quadro que resume o código genético, escreva como
a notícia publicada em 2000 pode ser interpretada. Em seguida, reescreva o título da reporta-
gem com base no que você aprendeu.
2. Retome a HQ Lembranças de um RNA mensageiro e descubra:
a) Qual a trinca de nucleotídeos (códon) que inicia a síntese de uma proteína.
b) Quais os três primeiros aminoácidos codi cados pelo RNA mensageiro da história.
3. Na HQ, o códon UAG desempenha papel importante na síntese de proteínas. Que papel é esse?
. Procure no quadro O código genético dos seres vivos outros códons que exerçam a mesma função
do códon UAG.
2
Biologia – 2ª série – Volume 2
5. Quais códons correspondem ao aminoácido arginina e quais codi cam o aminoácido triptofano?
. O que pode representar a diferença entre as formas como os aminoácidos arginina e triptofano
são codi cados?
7. O que signi ca dizer que o código genético é universal?
. Consultando o quadro O código genético dos seres vivos, traduza a sequência de DNA apresen-
tada a seguir.
Do DNA à proteína
ita do DNA a ser transcrita TAC GGA GTA GCT ATA ATT
RNA mensageiro
Proteína
VOCÊ APRENDEU?
1. Um professor de Biologia, procurando explicar de maneira mais simpli cada para seus alunos
o processo de síntese de proteínas, utilizou as seguintes analogias:
2
Biologia – 2ª série – Volume 2
– magine que você queira fazer um bolo. A primeira coisa de que você vai precisar é uma
receita. O mesmo ocorre em relação à síntese de proteínas.
– Para produzir um bolo, além da receita, você precisará de ingredientes. Da mesma forma,
a célula precisa de certos ingredientes para produzir proteínas.
– Suponha que sua mãe guarde todas as receitas no computador, que ca no escritório ou
no quarto de estudos. Para utilizar a receita, você terá de imprimi-la.
V – Para fazer o bolo, você se dirige à cozinha com a receita impressa. Lá estão, além dos
ingredientes, o forno e os objetos para fazer o bolo. Em uma célula, também há um local
onde ocorre a síntese de proteínas.
Analise as alternativas e assinale aquela que indica uma correspondência verdadeira:
a) O computador com as receitas seria o RNA das células.
b) O quarto de estudos é o citoplasma da célula e o computador representa os ribossomos.
c) O aluno, ao ler a receita e fazer o bolo na cozinha, representa o processo de tradução.
d) A receita impressa corresponde ao RNA transportador.
e) O bolo feito corresponde ao gene.
2. ( uvest – 1 ) Existe um número muito grande de substâncias com funções antibióticas.
Essas substâncias diferem quanto à maneira pela qual interferem no metabolismo celular.
Assim, a TETRAC CL NA liga-se aos ribossomos e impede a ligação do RNA transportador;
a M TOM C NA inibe a ação da polimerase do DNA e a ESTREPTOM C NA causa erros
na leitura dos códons do RNA mensageiro. Essas informações permitem a rmar que:
– A TETRAC CL NA impede a transcrição e leva a célula bacteriana à morte por falta de
RNA mensageiro.
– A M TOM C NA, por inibir a duplicação do DNA, impede a multiplicação da célula
bacteriana.
– A ESTREPTOM C NA interfere na tradução e leva a célula bacteriana a produzir
proteínas defeituosas.
Das alternativas acima,
a) apenas é correta.
b) apenas e são corretas.
c) apenas e são corretas.
d) apenas e são corretas.
e) , e são corretas.
30
Biologia – 2ª série – Volume 2
3. Se coletássemos proteínas em um ovo fóssil de certa espécie de dinossauro, seria possível
reconstituir o DNA desses animais? Justi que.
. ( uvest–2005) A seguir está representada a sequência dos 13 primeiros pares de nucleotídeos
da região codi cadora de um gene.
--- A T G A G T T G G C C T G ---
--- T A C T C A A C C G G A C ---
A primeira trinca de pares de bases nitrogenadas à esquerda corresponde ao aminoácido metionina.
A tabela a seguir mostra alguns códons do RNA mensageiro e os aminoácidos codificados por
cada um deles.
Códon do RNAm Aminoácido
ACC treonina
AGU serina
AUG metionina
CCU prolina
CUG leucina
GAC ácido aspártico
GGC glicina
UCA serina
UGG triptofano
a) Escreva a sequência de bases nitrogenadas
do RNA mensageiro transcrito a partir
desse segmento de DNA.
b) Utilizando a tabela de código genético
fornecida, indique a sequência dos três
aminoácidos seguintes à metionina, no
polipeptídio codi cado por esse gene.
31
Biologia – 2ª série – Volume 2
c) Qual seria a sequência dos três primeiros aminoácidos de um polipeptídio codi cado por
um alelo mutante desse gene, originado pela perda do sexto par de nucleotídeos (ou seja, a
deleção do par de bases T A)?
Efeito das mutações
O termo “mutação” é bastante popular e, normalmente, as pessoas o associam com o surgimento
de organismos com características aberrantes. Em Biologia, no entanto, mutações gênicas são alte-
rações permanentes na sequência de nucleotídeos do DNA. Essas alterações podem ter diferentes
resultados, de acordo com o efeito que produzem na proteína final.
Descubra algumas dessas situações resolvendo as questões:
1. Este é o trecho de um gene ( ta molde) fundamental para todos nós, o gene da proteína
beta-hemoglobina. Essa proteína é de extrema importância no transporte de gás oxigênio para
o corpo e sua função depende de sua estrutura espacial, que por sua vez depende da sequência
de aminoácidos que a compõe.
… CAC GTG GAC TGA GGA CTC CTC TTC…
Lembrando que os códons se referem ao RNAm, consulte o quadro com o código genético
para dizer qual é a sequência de aminoácidos correspondente.
2. Suponha que ocorra a seguinte mutação:
… CAT GTG GAC TGA GGA CTC CTC TTC…
Agora indique qual seria seu possível efeito.
3. Suponha agora a seguinte mutação:
… TAC GTG GAC TGA GGA CTC CTC TTC…
ndique as consequências em relação à sequência inicial.
32
Biologia – 2ª série – Volume 2
. Considere agora as duas mutações a seguir e seus efeitos.
a) … CAC GTG GAC TGA GGA ATC CTC TTC…
b) … CAC GT GAC TGA GGA CTC CTC TTC…
5. Para concluir, faça uma pesquisa sobre a anemia falciforme e sua causa genética.
33
Biologia – 2ª série – Volume 2
S TUA O DE APREND AGEM
DO DNA CARACTER ST CA
A proposta para esta Situação de Aprendizagem é rever alguns conceitos de Genética relacionados
às ideias de Mendel sobre a herança biológica e, a partir deles, estabelecer relações com os conteúdos
trabalhados sobre a molécula de DNA e a tradução da informação genética.
Para começo de conversa
Você se lembra do trabalho de Mendel estudado no volume 1?
Para iniciar esta Situação de Aprendizagem, será necessário retomá-lo. nterprete o esquema e o
mapa conceitual e, a seguir, redija um texto mostrando o que você entendeu. Ao concluir seu texto,
troque-o com o de um colega para análise. Ao receber o texto do colega, verifique se os conceitos do
mapa foram empregados corretamente para explicar o trabalho de Mendel com as ervilhas.
!
?
©SamuelSilva
Esquema do trabalho de Mendel com as ervilhas.
3
Biologia – 2ª série – Volume 2
Mapa conceitual sobre Genética.
ORGAN SMOS
V VOS
são formados por
C LULAS
possuem
estão contidas
em um
N ORMA ES
GEN T CAS
GENE
em seu conjunto
no indivíduo,
constituem o
são transmitidas
entre as
gerações pelos
formam-se por
possibilita a
podem ser
fundamenta a ocorre nos
ME OSE
pode apresentar
formas alternativas
chamadas
ALELOSPR ME RA LE
DE MENDEL
SEGREGA O
3 : 1
pode originar
as proporções
HOMO G T CA
HETERO G T CA
se expressam na
condição
se expressam na
condição
DOM NANTES
RECESS VOS
em interação
com o ambiente
produz o
GEN T PO
EN T PO
GAMETAS
©Adesign
35
Biologia – 2ª série – Volume 2
Leitura e análise de texto
Para integrar os conceitos de Biologia Molecular aos conceitos de Genética Clássica, será
apresentado como exemplo o trabalho de pesquisadores ingleses. Esses cientistas trabalharam
com uma das sete características de ervilha (Pisum sativum) estudadas por Mendel: a textura
da semente, em que o estado liso é dominante sobre o rugoso.
Do genótipo ao fenótipo
Ao pesquisar a causa do fenótipo rugoso, pesquisadores ingleses suspeitaram de que esse
fenótipo fosse consequência da grande quantidade de um açúcar simples (amido não ramificado)
no cotilédone, o que resultaria no acúmulo de grande quantidade de água. Quando a semente
amadurece, ela seca, ou seja, perde água. Como nessa semente há grande acúmulo de água, ela
fica muito volumosa e, ao secar, sua película se enruga. A semente lisa possui açúcares com
muitas ramificações, não acumulando água, e, como consequência, não tem rugosidade.
Esses pesquisadores descobriram que o alto índice de açúcar simples na semente rugosa
se deve a um defeito na síntese de amido, o que ocorre em razão da ausência de uma enzima
ramificadora do amido (SBE-1, starch-branching enzyme ou enzima ramificadora do amido).
Além disso, notaram que as células do cotilédone das ervilhas que acumulam amido não
ramificado, por pressão osmótica, retêm mais água.
O alelo “R”, que codifica a semente lisa, é um fragmento de DNA com 3,3 mil pares
de bases. Esse alelo codifica a enzima SBE-1, responsável pela produção do amido ramificado.
O alelo “r”, que codifica a semente rugosa, é um fragmento de DNA com uma inserção de
00 pares de bases, portanto o gene possui ,1 mil pares de bases, e a enzima SBE-1 produzida
não é funcional. Assim, não há produção de amido ramificado, o que leva ao maior acúmulo
de água; quando a semente seca, torna-se rugosa.
Elaborado por Rodrigo Venturoso Mendes da Silveira especialmente para o São Paulo faz escola.
Após a leitura, responda às questões a seguir:
1. Qual é o papel da enzima SBE-1 na semente lisa?
3
Biologia – 2ª série – Volume 2
Sementes lisas puras apresentam esta sequência:
TAC TCT ATG AAC CTC GTT AAA GTA CTA AAC ACT
Sequência complementar:
Sementes rugosas puras apresentam a seguinte sequência:
TAC TCT ATG AAC CTC GTT AAA GTA CTA AAT AGA AAA ACT TT
Sequência complementar:
. A seguir, forme o RNA mensageiro, utilizando como molde as sequências apresentadas nos
quadros da questão anterior.
5. Para nalizar, faça a tradução das moléculas de RNA mensageiro e escreva no quadro quais são as
proteínas formadas para cada tipo de semente. Para isso, consulte o quadro O código genético dos
seres vivos apresentado na Situação de Aprendizagem anterior.
2. Segundo o texto, qual a relação entre o fato de uma ervilha ser lisa ou rugosa e a osmose?
3. A seguir, você vai encontrar duas simulações hipotéticas de sequências obtidas na análise do
DNA de dois tipos diferentes de ervilhas puras (homozigóticas): com sementes lisas e com
sementes rugosas. Qual a sequência complementar do DNA em cada caso?
37
Biologia – 2ª série – Volume 2
Tipo de
semente
Sequência de aminoácidos
lisa
rugosa
. Qual das sequências de DNA corresponde ao alelo “r”, responsável pelo caráter semente rugosa?
7. Qual das sequências de DNA corresponde ao alelo “R”, responsável pelo caráter semente lisa?
. Considere, agora, uma planta de ervilha heterozigótica para a característica textura da ervilha.
Quais tipos de alelos ela possui?
. Uma ervilha heterozigótica (Rr) apresenta o mesmo fenótipo de uma ervilha homozigótica
dominante (RR): ambas são lisas. Esses dois tipos de ervilha são idênticos do ponto de vista
molecular? Comente.
3
Biologia – 2ª série – Volume 2
0
20
30
40
10
50
60
I II III IV V
70
80
90
100
10. Considerando o texto Do genótipo ao fenótipo e o grá co apresentado a seguir, discuta com seus
colegas de classe se a sequência dos aminoácidos de uma proteína pode in uenciar no funcio-
namento dela.
Porcentagem de amido rami cado na presença de diferentes proteínas.
Dados ctícios.
11. Se a ervilha apresenta 50% de proteínas do tipo , ela tem qual fenótipo?
12. Procure em seu livro didático as diferenças entre as estruturas primária, secundária e terciária
de uma proteína.
Estrutura primária:
Estrutura secundária:
Estrutura terciária:
Integrando conceitos
As ideias de Mendel foram o ponto de partida para a compreensão atual de como as características
biológicas são herdadas e se manifestam. Acontece, entretanto, que em seu tempo Mendel não tinha
acesso a uma série de informações conhecidas hoje. Assim, se for feito um paralelo entre as ideias
dele, que datam de 1 , e o que se sabe agora, pode-se construir o quadro a seguir:
3
Biologia – 2ª série – Volume 2
Mendel, em 1866, deduziu que: Mendel, hoje, saberia que:
As plantas possuem fatores hereditários. As plantas híbridas ( 1) para semente lisa e rugosa
possuem os dois alelos (“R” e “r”), que Mendel
chamou de fatores.
Os fatores são transmitidos de uma geração à
outra.
A meiose explica como os alelos se separam na for-
mação dos gametas.
Os fatores podem ser representados por letras:
maiúscula (R) para o dominante e minúscula
(r) para o recessivo.
Durante a meiose, os cromossomos homólogos se
separam.
As plantas híbridas ( 1) possuem os dois
fatores (Rr); só assim podem produzir dois
tipos de descendentes ( 2).
Os cromossomos são constituídos por DNA e
proteínas.
Os fatores na planta híbrida não se misturam. O DNA é formado por uma cadeia dupla de
nucleotídeos.
Os fatores na planta híbrida devem se separar
na formação dos gametas, para que cada game-
ta possua apenas um dos fatores.
A partir do DNA, uma molécula de RNA é sin-
tetizada (RNA mensageiro), codi cando uma
proteína.
Obs.: é importante ressaltar que nessa época
nada se sabia sobre cromossomos e meiose.
A textura da semente é determinada pela presen-
ça da enzima SBE-1 (strach-branching enzyme ou
enzima ramificadora do amido). A enzima fun-
cional, que permite o acúmulo de água tornando
a semente lisa, é codificada pelo alelo R, um
fragmento de DNA constituído por 3,3 mil pares
de bases. A enzima codificada pelo alelo r (for-
mado por ,1 mil pares de bases, contendo um
trecho de 00 pares adicionais em sua sequência)
não é funcional e impede o acúmulo de água, de
modo que a semente torna-se rugosa.
Agora, o professor vai organizar a turma, e você deve articular os conceitos apresentados na
tabela na forma de um mapa de conceitos. O objetivo desse mapa é integrar os conceitos de Biologia
Molecular e de Genética Clássica.
Para a construção do mapa, utilize o conjunto de palavras apresentadas na página seguinte e o
espaço em branco disponível. Caso o espaço não seja suficiente, faça o mapa em seu caderno. Em
seguida, trace linhas, orientadas por setas, relacionando os vários conceitos por meio das expressões
de ligação. Se for necessário, crie novas expressões para relacionar os conceitos.
aça correlações múltiplas, de modo que o mapa final fique com o aspecto de rede, evitando
relações lineares simples. Para isso, o mesmo conceito pode ser conectado a vários outros. Para ter
uma noção de como é um mapa de conceitos, retome outros mapas que foram apresentados ao longo
deste Caderno. Depois de construir seu mapa de conceitos, avalie os mapas dos colegas, verificando
as diferenças e indicando possíveis relações equivocadas.
0
Biologia – 2ª série – Volume 2
Conceitos I Conceitos II Expressões de ligação
RR
Rr
rr
R
r
fatores
dominante
recessivo
ervilha lisa
ervilha rugosa
fenótipo
genótipo
heterozigoto
homozigoto
DNA sem inserção
DNA com inserção
dupla-hélice de DNA
cromossomo
proteína SBE-1 funcional
proteína SBE-1 não funcional
água
alelo
gene
amido rami cado
RNA mensageiro
não produz
produz
perde muita
perde pouca
é
são
codi ca
acumula muita
acumula pouca
faz
composto de
1
Biologia – 2ª série – Volume 2
VOCÊ APRENDEU?
1. ( uvest–2003) Qual das alternativas se refere a um cromossomo?
a) Um conjunto de moléculas de DNA com todas as informações genéticas da espécie.
b) Uma única molécula de DNA com informação genética para algumas proteínas.
c) Um segmento de molécula de DNA com informação para uma cadeia polipeptídica.
d) Uma única molécula de RNA com informação para uma cadeia polipeptídica.
e) Uma sequência de três bases nitrogenadas do RNA mensageiro correspondente a um ami-
noácido na cadeia polipeptídica.
2. ( uvest–2002) Em seu trabalho com ervilhas, publicado em 1 , Mendel representou os
fatores hereditários determinantes dos estados amarelo e verde do caráter cor da semente pelas
letras A e a, respectivamente. O conhecimento atual a respeito da natureza do material heredi-
tário permite dizer que a letra A usada por Mendel simboliza:
a) um segmento de DNA com informação para uma cadeia polipeptídica.
b) um segmento de DNA com informação para um RNA ribossômico.
c) um aminoácido em uma proteína.
d) uma trinca de bases do RNA mensageiro.
e) uma trinca de bases do RNA transportador.
3. ( uvest–2001) O anúncio do sequenciamento do genoma humano, em 21 de junho de 2000,
signi ca que os cientistas determinaram:
a) a sequência de nucleotídeos dos cromossomos humanos.
b) todos os tipos de proteína codi cados pelos genes humanos.
c) a sequência de aminoácidos do DNA humano.
d) a sequência de aminoácidos de todas as proteínas humanas.
e) o número correto de cromossomos da espécie humana.
. (Comvest Vestibular Unicamp–1 ) O metabolismo celular é controlado por uma série de rea-
ções em que estão envolvidas inúmeras proteínas. Uma mutação gênica pode determinar a alteração
ou a ausência de algumas dessas proteínas, levando a mudanças no ciclo de vida da célula.
2
Biologia – 2ª série – Volume 2
a) Explique a relação que existe entre gene e proteína.
b) Por que podem ocorrer alterações nas proteínas quando o gene sofre mutação?
c) Em que situação uma mutação não altera a molécula proteica?
5. ( uvest–1 ) Uma doença genética de herança dominante é causada por mutações em um
gene localizado em um autossomo. Os indivíduos A, B e C têm mutações em um segmento de
DNA desse gene, cuja sequência normal está representada a seguir:
Sequência normal
CAA AAC TGA GGA ATG CAT TTC (m)
GTT TTG ACT CCT TAC GTA AAG
Indivíduo A
CAA AAC TGA GGA ATT CAT TTC (m)
GTT TTG ACT CCT TAA GTA AAG
Indivíduo B
CAT AAC TGA GGA ATG CAT TTC (m)
GTA TTG ACT CCT TAC GTA AAG
Indivíduo C
CAA TAC TGA GGA ATG CAT TTC (m)
GTT ATG ACT CCT TAC GTA AAG
3
Biologia – 2ª série – Volume 2
Códon Aminoácido Códon Aminoácido
AAA lisina CUA leucina
AAC asparagina GAU ácido glutâmico
AAG lisina GCC alanina
ACU treonina GUA valina
AGU serina GUU valina
AUG metionina UAA de parada
CAA glutamina UAC tirosina
CAU histidina UGA de parada
CCU prolina UUG leucina
Usando a tabela que relaciona alguns códons aos respectivos aminoácidos e considerando que a
ta molde a ser transcrita é aquela assinalada com a letra m, responda:
a) Quais serão os segmentos de proteínas produzidos, respectivamente, pelos indivíduos A,
B e C?
b) Como será o fenótipo (normal ou afetado) dos indivíduos A, B e C? Por quê?
. O esquema a seguir representa uma simpli cação da relação entre genótipo e fenótipo.
Com base nele e em outras informações trabalhadas ao longo deste ano, escreva um texto no
caderno com o título: Do DNA à característica.
Biologia – 2ª série – Volume 2
transcrição tradução
duplicação
Característica
biológica
DNA RNA Proteínas
5
Biologia – 2ª série – Volume 2
PARA SABER MA S
Livros
PERE RA, L gia V. Sequenciaram o genoma humano... e agora? São Paulo: Moderna,
2001. A autora explica as bases do sequenciamento de DNA e discute os impactos
desse conhecimento.
STRATHERN, Paul. Crick, Watson e o DNA em 90 minutos. Rio de Janeiro: Jorge
ahar, 2001. O livro conta a história do trabalho de Watson e Crick e explica a
estrutura do DNA.
Sites (Acessos em: 27 fev. 201 .)
GEN T CA NA ESCOLA. Disponível em: http: .sbg.org.br . O site apresenta
atividades relacionadas aos conteúdos de Genética e Biologia Molecular.
PROJETO GENOMA HUMANO. Disponível em: http: .videolog.tv video.
php?id 311 7 . Neste endereço, está disponível um vídeo que aborda conteúdos
de Biologia Molecular.
Biologia – 2ª série – Volume 2
7
TEMA DNA: TECNOLOG AS DE MAN PULA O
Neste Caderno, você e seus colegas vão trabalhar com algumas das aplicações tecnológicas
desenvolvidas a partir do conhecimento acumulado sobre os mecanismos de herança. Entre elas estão
a identificação por perfil de DNA e a produção de organismos transgênicos.
S TUA O DE APREND AGEM 5
TESTE DE DENT CA O PELO DNA
Para começo de conversa: montagem da molécula de DNA
Nas páginas finais deste Caderno, você vai encontrar um esquema com modelos de nucleotídeos
para recortar e montar moléculas de ácidos nucleicos.
Com a orientação do professor, monte, com um colega, uma molécula de DNA com dez pares
de nucleotídeos, considerando que 30% da molécula deve ser formada por adeninas.
Depois duplique essa molécula com os nucleotídeos restantes. Por fim, transcreva essa molécula
de DNA utilizando apenas uma das fitas como molde para produzir um RNA.
Dica: os desoxirribonucleotídeos formam as moléculas de DNA e os ribonucleotídeos formam
moléculas de RNA.
A seguir, continuaremos o trabalho com biotecnologia mostrando como são feitos os testes de
identificação pelo DNA. Trata-se de um tema bastante atual que contribui para a resolução de
inúmeros casos de paternidade duvidosa, muitos deles divulgados pela mídia. Além disso, é uma
técnica de amplo uso nas diversas áreas de Ciência e Tecnologia.
O mistério de Dom Casmurro seria resolvido pelo teste de DNA?
Um dos aspectos mais sedutores da obra Dom Casmurro, de Machado de Assis (1 ), é o
mistério sobre a possível traição da personagem Capitu com Escobar, o melhor amigo de Bentinho,
que é o protagonista e narrador da trama. Machado de Assis constrói um personagem atormentado
pelo ciúme, colocando em dúvida, inclusive, a paternidade de seu filho, Ezequiel. Após a morte de
Escobar, Bentinho começa a suspeitar da esposa, ao notar o grande sofrimento que ela demonstrou
durante o enterro do amigo. A desconfiança de Bentinho chega ao ponto de provocar o rompimento
e o fim do casamento. O filho, porém, fica sob a guarda do pai, que, a cada dia, acha que a criança
fica mais parecida com Escobar. Essa é uma dúvida que o protagonista não tem como esclarecer;
nem consegue provar se Capitu de fato o traiu.
Se o romance Dom Casmurro estivesse ambientado nos dias de hoje, talvez não fosse tão
encantador. O culpado? O teste de DNA.
!
?
7
Biologia – 2ª série – Volume 2
1. Como o teste de DNA poderia elucidar esse mistério?
2. Possivelmente, você já ouviu falar em teste de DNA. Em quais veículos de comunicação você
tomou contato com esse assunto? Em que situações? Quais são os materiais biológicos coleta-
dos dos indivíduos envolvidos para fazer o teste de DNA?
Desvendando o mistério de Capitu
Para resolver o mistério de Dom Casmurro, seria necessário realizar um teste de DNA. A
primeira etapa seria coletar material biológico dos envolvidos: Capitu, Bentinho, Escobar (o
melhor amigo de Bentinho) e Ezequiel (o filho). Geralmente, os pesquisadores empregam células
presentes no sangue ou na mucosa da boca, mas podem utilizar células da pele ou presentes na
raiz do cabelo.
O DNA é extraído das células, isolado das demais estruturas celulares e purificado. Depois
ele passa por um processo de clonagem molecular. Aqui, o termo “clonagem” refere-se à produção
de cópias idênticas da sequência de DNA utilizando nucleotídeos livres e uma enzima já estudada
neste volume: a polimerase do DNA.
Atualmente, uma das técnicas mais adotadas para aumentar a quantidade de cópias (amplificar)
de trechos específicos do DNA é a reação em cadeia da polimerase (PCR). Essa técnica permite que,
em curto espaço de tempo, trechos específicos do DNA possam ser amplificados milhões de vezes.
Depois de aumentar a quantidade de DNA por meio da clonagem molecular, os pesquisadores
utilizam enzimas de restrição, proteínas capazes de cortar o DNA em pontos definidos, ou melhor,
em sequências específicas. As “tesouras moleculares” foram descobertas em diferentes bactérias
e, para cada uma delas, é quebrada uma sequência específica do DNA. No quadro a seguir, são
apresentados algumas enzimas e seus pontos de corte.
Biologia – 2ª série – Volume 2
As setas que aparecem na primeira coluna do quadro simbolizam os pontos de quebra da
ligação entre um nucleotídeo e outro. Quando isso acontece, os trechos se separam, formando
fragmentos de DNA.
Simulação do teste de DNA
Para simular o teste de paternidade de Ezequiel, você terá acesso a algumas sequências
fictícias de DNA humano. Sua tarefa será utilizar a enzima fictícia MDA para produzir os
padrões de DNA característicos de cada pessoa. Essa proteína quebra as ligações apenas quando
encontra a sequência de DNA apresentada a seguir. As ligações entre o T G e o A C são
quebradas nesse local.
t t t a t g g g c
aaa t a c c c g
Esquema para localizar o sítio de restrição da enzima utilizada.
Sequência reconhecida Nome Origem
5’ GGATCC 3’
3’ CCTAGG 5’
BamH Bacillus amyloliquefaciens H
5’ GAATTC 3’
3’ CTTAAG 5’
EcoR E. coli R 13
5’ GGCC 3’
3’ CCGG 5’
Hae Haemophilus aegyptius
5’ CTGCAG 3’
3’ GACGTC 5’
Pst Providencia stuartii
5’ CTCGAG 3’
3’ GAGCTC 5’
Xho Xanthomonas holcicola
Especi cidade de algumas endonucleases de restrição. As setas indicam o ponto de clivagem na cadeia de DNA.
onte: AHA, Arnaldo; ERRE RA, Henrique B.; PASSAGL A, Luciane M.P. (orgs.). Biologia molecular básica. . ed. Porto Alegre:
Artmed, 2012. p. 33 .
Biologia – 2ª série – Volume 2
A seguir, cada dupla-fita de nucleotídeos faz parte de um cromossomo dos personagens de Dom
Casmurro. Você deve utilizar a enzima de restrição MDA para separar o DNA dos envolvidos em frag-
mentos menores. Para isso, localize no quadro os sítios de restrição da enzima MDA no DNA de todos
os indivíduos.
gcaatggcacccgttttatgggctggaatggcccctcccaatggcacccgtcacccgtttaaacc
cgttaccgtgggcaaaatacccgaccttaccggggagggttaccgtgggcagtgggcaaatttgg
tcgcacccgtatggaccgagcccctccccgactccgctctccgaatggcgccctgaaaccgagca
agcgtgggcatacctggctcggggaggggctgaggcgagaggcttaccgcgggactttggctcgt
gcaatggcacccgttttatgggctggaatggcccctcccaatggcacccgtcacccgtttaaacc
cgttaccgtgggcaaaatacccgaccttaccggggagggttaccgtgggcagtgggcaaatttgg
ctatgggctgggaatccatggccgcgcgcaatggcacccgtttaaaatggcccctccccgactcc
gatacccgacccttaggtaccggcgcgcgttaccgtgggcaaatttttaccgggaggggctgagg
cacccgacccgtatggaatggcacccgtcccgaccgacgggccgatgggcccgtcgggcccgtcg
gtgggctgggcataccttaccgtgggcagggctggctccccggctgcccgggcagcccgggcagc
tcgcacccgtatggaccgagcccctccccgactccgctctccgaatggcgccctgaaaccgagca
agcgtgggcatacctggctcggggaggggctgaggcgagaggcttaccgcgggactttggctcgt
tcgcacccgtatgcatggagcccctccccgactccgctctccgaatggcgccctgaaaccgagca
agcgtgggcatacgtacctcggggaggggctgaggcgagaggcttaccgcgggactttggctcgt
cacccgtcgagcacccgtatggacccaatggcacccgtccatggccatggcggacgggcccgtcg
gtgggcagctcgtgggcatacctgggttaccgtgggcaggtaccggtaccgcctgcccgggcagc
Capitu Ezequiel Bentinho Escobar
Simulação de sequências
de DNA dos personagens.
50
Biologia – 2ª série – Volume 2
Depois de localizar e indicar os locais de corte pela enzima, confira seus resultados com os dos
colegas da classe.
Medindo fragmentos de DNA
Esquema simpli cado da eletroforese.
Após a produção dos fragmentos de diversos tamanhos, é preciso comparar o DNA dos envol-
vidos. Para isso, vamos usar uma técnica conhecida como eletroforese.
Após as explicações de seu professor sobre a técnica de eletroforese, descreva-a no espaço a seguir.
polo
negativo
polo
positivo
gelatina
banda
de
DNA
+
©JurandirRibeiro
SASSON, Sezar; S LVA JUN OR, Cesar da. Biologia – volume único. São Paulo: Saraiva, 2007. p. 5 5.
51
Biologia – 2ª série – Volume 2
O quadro a seguir representa os sítios de restrição do DNA dos envolvidos no caso. Na tabela
da próxima página, você deve indicar as bandas de cada um dos envolvidos, de acordo com os
números dos pares de nucleotídeos de seu DNA.
Quadro indicando os sítios
de restrição para enzima do
DNA dos personagens.
tcgcacccgtatggaccgagcccctccccgactccgctctccgaatggcgccctgaaaccgagca
agcgtgggcatacctggctcggggaggggctgaggcgagaggcttaccgcgggactttggctcgt
123419
cacccgacccgtatggaatggcacccgtcccgaccgacgggccgatgggcccgtcgggcccgtcg
gtgggctgggcataccttaccgtgggcagggctggctccccggctgcccgggcagcccgggcagc
14546
tcgcacccgtatggaccgagcccctccccgactccgctctccgaatggcgccctgaaaccgagca
agcgtgggcatacctggctcggggaggggctgaggcgagaggcttaccgcgggactttggctcgt123419
tcgcacccgtatgcatggagcccctccccgactccgctctccgaatggcgccctgaaaccgagca
agcgtgggcatacgtacctcggggaggggctgaggcgagaggcttaccgcgggactttggctcgt
163019
cacccgtcgagcacccgtatggacccaatggcacccgtccatggccatggcggacgggcccgtcg
gtgggcagctcgtgggcatacctgggttaccgtgggcaggtaccggtaccgcctgcccgggcagc20913617
gcaatggcacccgttttatgggctggaatggcccctcccaatggcacccgtcacccgtttaaacc
cgttaccgtgggcaaaatacccgaccttaccggggagggttaccgtgggcagtgggcaaatttgg514101323
gcaatggcacccgttttatgggctggaatggcccctcccaatggcacccgtcacccgtttaaacc
cgttaccgtgggcaaaatacccgaccttaccggggagggttaccgtgggcagtgggcaaatttgg514101323
ctatgggctgggaatccatggccgcgcgcaatggcacccgtttaaaatggcccctccccgactcc
gatacccgacccttaggtaccggcgcgcgttaccgtgggcaaatttttaccgggaggggctgagg415131617
Capitu Ezequiel Bentinho Escobar
52
Biologia – 2ª série – Volume 2
Com base no padrão de bandas de DNA de todos os envolvidos é possível determinar as
relações de parentesco entre eles. Considere que, em caso de paternidade, deve-se, inicialmente,
comparar o perfil de fragmentos de DNA da criança com o da mãe e identificar todos os
possíveis fragmentos de DNA da criança que também estão presentes no da mãe. Depois,
compare os fragmentos de DNA da criança que sobraram (que não têm correspondência com
o DNA da mãe) com os perfis de DNA dos possíveis pais. O provável pai será aquele cujo
perfil de DNA contenha todos os fragmentos de DNA complementares aos fragmentos de
DNA da criança que não estão presentes no DNA da mãe.
Escala em
pares de base
(pb)
Envolvidos
Capitu Ezequiel Bentinho Escobar
1
2
3
5
7
10
11
12
13
1
15
1
17
1
1
20
21
22
23
2
Escala em
pares de base
(pb)
Envolvidos
Capitu Ezequiel Bentinho Escobar
25
2
27
2
2
30
31
32
33
3
35
3
37
3
3
0
1
2
3
5
7
53
Biologia – 2ª série – Volume 2
Agora, a partir da leitura do padrão de bandas de todos os indivíduos, responda às questões:
1. Quais são as bandas presentes na mãe e no lho?
2. Quais bandas sobraram no padrão do lho sem correspondência com o padrão da mãe?
3. Quem possui todas essas bandas que não têm correspondência com o padrão da mãe?
. De acordo com a simulação feita, quem é o provável pai de Ezequiel?
5. Elabore uma história em quadrinhos propondo um desfecho para a obra de Machado de Assis,
Dom Casmurro, com base em um suposto teste de DNA. Esse teste não precisa ter o mesmo
resultado da simulação feita, ou seja, o pai de Ezequiel pode ser outro personagem de Dom
Casmurro.
5
Biologia – 2ª série – Volume 2
L O DE CASA
Etapas para obtenção e análise do DNA
1. Complete o quadro a seguir com informações sobre cada uma das etapas, a partir das explica-
ções de seu professor e de consultas ao livro didático.
2. Pesquise em seu livro o que são enzimas de restrição e como elas atuam.
Extração
Quantificação
Amplificação
Separação
Análise e interpretação
55
Biologia – 2ª série – Volume 2
VOCÊ APRENDEU?
1. Cinco casais procuraram a polícia e a rmaram ser os verdadeiros pais de Gabriela. A garota
teria sido roubada de uma maternidade em 1 0. Ao assistir à entrevista da garota na TV, esses
casais descon aram de que poderiam ser os pais. Todos se submeteram ao teste de identi cação
pelo DNA e os resultados são apresentados a seguir. Quem são os verdadeiros pais de Gabriela?
Assinale a alternativa correta.
2. Com relação às enzimas de restrição, é correto a rmar que:
a) os sítios de restrição nunca acontecem dentro de um gene.
b) para um ser vivo, os sítios de restrição são úteis apenas para a técnica inventada para analisar
o DNA.
c) todo sítio de restrição marca também o início da síntese de proteínas.
d) indivíduos de uma mesma espécie possuem o mesmo número de sítios de restrição.
e) irmãos sempre apresentam a mesma quantidade de sítios de restrição.
3. ( uvest – 1 7) Enzimas de restrição são fundamentais à Engenharia Genética porque
permitem:
a) a passagem de DNA através da membrana celular.
b) inibir a síntese de RNA a partir de DNA.
Gabriela a) Pai Mãe b) Pai Mãe c) Pai Mãe d) Pai Mãe e) Pai Mãe
5
Biologia – 2ª série – Volume 2
c) inibir a síntese de DNA a partir de RNA.
d) cortar DNA onde ocorrem sequências especí cas de bases.
e) modi car sequências de bases do DNA.
. Explique se as a rmações seguintes, sobre o teste de DNA, são verdadeiras ou falsas:
a) “O exame de DNA só pode ser feito com sangue.”
b) “O resultado mostrou que nós possuímos algumas bandas do mesmo tamanho; logo, está
provado que ele é o meu pai.”
5. Com as técnicas estudadas, podemos veri car se existem regiões de interesse na ta de DNA.
Chamamos essas regiões de marcadores, já que podemos associá-las a alguma característica em
particular. A presença de um marcador no genoma de um indivíduo pode ser visualizada como
uma banda de DNA em um gel de eletroforese. Dessa forma, podemos descobrir se um embrião
poderá apresentar determinada característica ou doença genética com base na análise de seus
marcadores. O esquema a seguir representa a análise de marcadores de DNA de quatro embriões
humanos ( , , e V). Apenas a presença de duas bandas (A e B) indica que o indivíduo pode
apresentar certa doença quando adulto.
I II III IV
DNA dos embriões
eletroforese
Banda A
Banda B
+
–
Observe o padrão de bandas do DNA de cada embrião e responda:
a) Entre os embriões analisados, quais N O deverão apresentar a doença quando adultos?
57
Biologia – 2ª série – Volume 2
b) Supondo que os quatro embriões sejam irmãos, qual é o padrão de bandas ( , , e V)
mais provável PARA CADA UM de seus pais?
c) Qual banda é formada por fragmentos de DNA de MENOR tamanho? Justi que.
. A síndrome de Do n é ocasionada por uma trissomia do cromossomo 21. Em uma situação
hipotética, um casal teve uma criança com a síndrome (C1
) e, na segunda gravidez, resolveu sub-
meter-se a um teste de DNA para veri car se a segunda criança (C2
) também teria a síndrome.
O teste de DNA analisa marcadores para os diferentes cromossomos presentes nas células das
pessoas e foi feito a partir do DNA extraído de células sanguíneas dos pais e do primeiro filho (C1
)
e de uma punção do líquido amniótico (amniocentese) para analisar o segundo filho (C2
).
Mãe MãePai Pai
Kb Kb
C1
C2
7
6
5
4
7
6
5
4
Com base na análise dos resultados expressos na ilustração, responda:
a) Qual a origem do cromossomo extra da criança?
b) A segunda criança apresenta ou não a síndrome? Justi que.
c) aça uma pesquisa e descubra qual a principal razão para que se forme um embrião com
trissomia do cromossomo 21.
5
Biologia – 2ª série – Volume 2
APRENDENDO A APRENDER
Há diferentes situações nas quais o teste de identificação por DNA pode ser aplicado.
Para cada uma das situações a seguir, encontre um exemplo real ou descreva de que forma
esse teste é útil.
Criminalística
Crimes ambientais
Tráfico de animais silvestres
Pedigree de animais
Doenças hereditárias
dentificação de vírus e bactérias causadores de doenças
5
Biologia – 2ª série – Volume 2
0
Biologia – 2ª série – Volume 2
S TUA O DE APREND AGEM
COMO PRODU R UM TRANSGÊN CO?
Eles estão entre nós. Se perguntar aos outros alunos da escola se já viram um organismo trans-
gênico, é provável que a maioria diga que não. No entanto, é possível que a maioria, se não todos,
já tenha tido algum contato com produtos derivados de organismos transgênicos. Muitos alimentos
industrializados, por exemplo, usam produtos desse tipo em seu processo de fabricação. Da mesma
forma, há diversos medicamentos feitos a partir de organismos transgênicos.
aça uma pesquisa em seu livro didático ou em outras fontes de informação confiáveis e descubra
exemplos de alimentos e medicamentos produzidos a partir de transgênicos.
Leitura e análise de imagem
1. Quais são os organismos representados nessa
imagem?
2. Os organismos estão representados do modo
como os conhecemos? Comente.
©AlexandreCamanho
3. Se a imagem sugerir a representação de um transgênico, que características dos organismos
podem ter sido combinadas para gerar um organismo desse tipo?
!
?
1
Biologia – 2ª série – Volume 2
Leitura e análise de texto
Troca-troca genético
Já viu porco com patas e focinho coloridos? E cabra que dá leite capaz de acelerar a
cicatrização de ferimentos? Ao contrário do que você possa estar pensando, não estamos
falando de criaturas de filmes de ficção. Esses animais são resultado de experimentos cien-
tíficos de verdade! Se você tiver curiosidade, podemos conversar sobre como essas e outras
modificações nos seres vivos são possíveis e por que os cientistas fazem isso. Que tal?
A cabra e o porco citados na abertura deste texto são apenas exemplos curiosos de
seres vivos que receberam características de outras espécies. O porco ganhou a coloração
de um tipo de alga marinha. Já na cabra foi introduzida uma característica do sangue
responsável pela coagulação, isto é, por evitar hemorragias em cirurgias ou quando você
se corta. Como assim? Bem, todos os animais e plantas têm dentro de suas células um
conjunto de códigos que os fazem ser do jeito que são. Nos seres humanos, por exemplo,
esse conjunto de códigos é responsável por termos dois braços, duas pernas, dois olhos,
duas orelhas, um nariz, uma boca, um coração, dois rins... Enfim, por tudo que nos faz
ter aparência humana por dentro e por fora. No caso de uma galinha, seu conjunto de
códigos é responsável pelas características físicas que ela apresenta. E, assim, cada ser vivo
tem o seu próprio conjunto de códigos, que se chama DNA. Guardou isso? Então, vamos
adiante porque a conversa só está esquentando!
Você, agora, precisa saber que cada código que forma esse conjunto recebe o nome de
gene e que cada gene tem sua função. De novo, vamos pensar em nós, humanos: temos genes
responsáveis pelo formato das nossas orelhas; pela cor dos nossos olhos; pela produção de
substâncias que nos permitem digerir os alimentos... Enfim, como temos muitas caracterís-
ticas, nosso DNA é formado por milhares de genes.
Pense bem: se cada espécie de animal e de planta tem características próprias determi-
nadas pelo conjunto de seus genes – isto é, pelo seu DNA –, o que acontece se os cientistas
transferirem genes de uma espécie para outra?
A espécie que receber os genes irá desenvolver uma ou mais características que não eram
suas naturalmente, certo? Pois foi exatamente isso que aconteceu com a cabra ao receber o
gene do homem responsável pelo desenvolvimento do fator de coagulação humano no seu
leite. E também com o porco, que recebeu da alga marinha o gene responsável pela sua cor.
Quando um ser vivo recebe um gene de outra espécie de animal ou vegetal, ele é chamado
transgênico. Mas os cientistas podem, também, transferir genes entre seres da mesma espécie;
estes são chamados organismos geneticamente modificados.
ODA, Leila M.; CARNE RO, Júlia D. Troca-troca genético. Revista Ciência Hoje das Crianças.
Rio de Janeiro: nstituto Ciência Hoje, mar. 2002.
2
Biologia – 2ª série – Volume 2
1. Quais relações você faz entre a imagem anterior e o título do texto Troca-troca genético?
2. Utilize os termos “seres vivos”, “células”, “DNA”, “genes”, “características biológicas”, “transgê-
nicos” e “organismos geneticamente modi cados” (OGMs) e construa um mapa de conceitos.
Para isso, explore as informações do texto e pesquise também em seu livro didático ou em
outras fontes con áveis.
3
Biologia – 2ª série – Volume 2
Leitura e análise de texto
Para que trocar genes?
Ao transferir genes de uma espécie para outra, os cientistas não estão pensando apenas
em produzir porcos coloridos ou cabras com genes humanos. Experimentos como esses são
válidos para testar se a troca genética é realmente possível. Se for, plantas podem receber
genes de vírus, por exemplo. Este é o caso da alface transgênica, desenvolvida recentemente.
Ela recebeu o gene que produz o antígeno do vírus da hepatite B e que pode virar uma vacina!
Você comeria uma alface dessas? Pense duas vezes antes de dizer que não, porque o antígeno
é a parte do vírus usada nas vacinas. Quando ele entra em nosso corpo, estimula o organismo
a se defender da doença causada pelo vírus. Logo, a alface transgênica funciona como uma
vacina para a hepatite B. Então, você prefere alface ou injeção?
Gostou da vacina de alface? Melhor é a bebida láctea transgênica! Você sabe do que
se trata: são aquelas pequenas garrafinhas que contêm leite fermentado com lactobacilos,
bactérias que ajudam a proteger o intestino. Em breve, teremos lactobacilos transgênicos,
com os antígenos de seis vírus diferentes. A vacina de leite fermentado vai combater
doenças como a difteria, a coqueluche, o tétano, a caxumba, a rubéola e o sarampo, entre
outras. No futuro, é provável que as vacinas sejam todas assim. Como é bom sonhar com
o adeus às agulhadas...
Podemos, ainda, citar as chances de os organismos transgênicos se tornarem substitutos
de remédios, vitaminas e outras substâncias que nosso organismo necessita. Veja: em 1 5,
começou a ser vendido o primeiro produto proveniente de um transgênico – a insulina,
substância que controla a quantidade de açúcar no sangue. O gene humano responsável pela
produção de insulina foi retirado de uma célula do pâncreas de uma pessoa saudável e
transferido para uma bactéria, que começou a produzir a substância. Hoje, a insulina trans-
gênica ajuda a salvar vidas de pessoas que têm diabetes, uma doença causada pela falha do
corpo na produção dessa substância.
Quer saber um pouco mais sobre a cabra que pode ser usada para melhorar a saúde das
pessoas? Pois anote: a cabra transgênica (a vaca também pode ser usada), que recebe o gene
humano responsável pela coagulação do sangue, produz no próprio leite a substância que
possibilita a cicatrização de cortes e machucados nas pessoas. Essa substância é muito impor-
tante para tratar os hemofílicos, que não a produzem em quantidades suficientes e podem
ter grandes hemorragias a partir do mais simples sangramento.
ODA, Leila M.; CARNE RO, Júlia D. Troca-troca genético. Revista Ciência Hoje das Crianças.
Rio de Janeiro: nstituto Ciência Hoje, mar. 2002.
Biologia – 2ª série – Volume 2
1. denti que, no texto, exemplos de uso dos transgênicos.
2. O que esses exemplos apresentam em comum?
Leitura e análise de imagem
A imagem a seguir é um esquema que busca explicar como se produz insulina transgênica.
Após a leitura, responda às questões a seguir.
Esquema da produção de insulina.
Bactéria
DNA da bactéria
ragmento de
DNA humano
com o gene
responsável
pela produção
de insulina
nsulina transgênica
produzida pela bactéria
Célula
humana
1
1
1
2
2
3 3
4 4
Isolamento do DNA
bacteriano e do DNA
humano
Corte de ambos os
DNAs com enzima de
restrição
Mistura de ambos os DNAs.
Eles se juntam, formando uma
molécula de DNA recombinante
O DNA recombinante é
introduzido em bactérias
©Aeroestudio
5
Biologia – 2ª série – Volume 2
1. Elabore um texto descrevendo os eventos representados.
2. Como são produzidos os fragmentos de DNA de interesse?
3. Por que o fragmento de interesse pode se ligar ao DNA da bactéria?
. Como é possível aumentar o número de cópias desse DNA recombinante?
Biologia – 2ª série – Volume 2
Consolidando os conceitos
Leitura e análise de texto
Troca entre iguais
Agora, vamos falar da troca de genes entre seres da mesma espécie: os organismos
geneticamente modificados! Alguém poderia perguntar: para que trocar genes entre seres
iguais? Que diferença isso pode fazer? hora de dizer que, embora organismos da mesma
espécie tenham DNA exageradamente semelhante, existem mínimas diferenças que fazem
cada ser ter o seu próprio código genético. Por isso, mesmo tendo dois braços, duas pernas,
um nariz etc. etc. etc. como o seu vizinho, você é diferente dele! Com os bichos e as plantas
também é assim: mesmo tendo um DNA que os caracteriza como sendo de determinada
espécie, cada ser tem um código genético só seu.
O uso de plantas geneticamente modificadas também pode aumentar a produção agrí-
cola, o que traz vantagens para o meio ambiente. Quando as lavouras produzem mais vegetais
de melhor qualidade, diminui a necessidade de desmatar novas áreas para plantações. Além
disso, as plantas podem ser modificadas para que consumam menos água durante o cresci-
mento. Assim o planeta economiza, pois cerca de dois terços de toda a água doce do mundo
são consumidas na agricultura.
A transferência de genes entre iguais também pode melhorar a qualidade dos alimentos,
tornando-os mais nutritivos. o caso, por exemplo, de um arroz transgênico chamado golden
rice (ou “arroz dourado”, em português). Ele é mais rico em vitamina A e ferro do que o
arroz comum. A carência dessas substâncias no organismo pode causar problemas sérios,
como cegueira e anemia. Olha que os animais também podem ser modificados para melhorar
sob o ponto de vista alimentar. Cuba, por exemplo, criou uma tilápia transgênica e o Canadá,
o salmão transgênico. Esses peixes tiveram alterado o gene responsável pelo crescimento e,
por isso, crescem mais e concentram maior quantidade de proteínas.
Apesar das vantagens, muitas pessoas temem as consequências do consumo de produtos
transgênicos ou geneticamente modificados. Afinal de contas, esses experimentos são muito
recentes. Os próprios cientistas trabalham com cautela, avaliando, a cada nova descoberta,
se ela não oferece riscos ao homem e à natureza. E é normal que muitas pessoas tenham
receio das novas tecnologias; as maiores descobertas científicas da História também encon-
traram resistência na sua época. Mas quem sabe? Talvez esse troca-troca genético não pareça
nada estranho daqui a um tempo.
ODA, Leila M.; CARNE RO, Júlia D. Troca-troca genético. Revista Ciência Hoje das Crianças.
Rio de Janeiro: nstituto Ciência Hoje, mar. 2002.
7
Biologia – 2ª série – Volume 2
Após a leitura do texto, responda às questões:
1. Qual o termo mais apropriado para substituir a expressão “código genético” no texto?
2. Com base no texto, faça uma lista de benefícios decorrentes do uso de transgênicos.
3. As autoras se posicionam em relação aos transgênicos ou são imparciais?
Criação de um título para o texto
O texto a seguir trata do tema que estamos estudando. Leia com atenção e crie um título. Lembre-se
de que, nesse caso, além de indicar o assunto tratado, o título deve ser atraente para o leitor.
Título:
Ocorreu em um dos melhores hospitais de São Paulo. azia menos de 2 horas que ele
havia nascido quando me apresentaram um papel para assinar autorizando o procedimento.
Consultei o médico, que me assegurou que era o recomendado. azer o quê? Autorizei. A
injeção foi indolor e logo depois me entregaram a carteira de vacinação. iquei feliz, meu
filho havia sido vacinado contra o vírus da hepatite B.
Se você acha que isso é uma grande novidade, ainda em fase experimental, está enganado.
Neste ano, o Ministério da Saúde adquiriu milhões de doses dessa vacina e agora ela faz parte
do programa de imunização do governo brasileiro. Nos próximos anos, praticamente todas
as crianças recém-nascidas serão imunizadas com esta vacina “recombinante”, um nome mais
“delicado” e que sofre menos discriminação que “transgênica”, apesar de significar exatamente
a mesma coisa.
Biologia – 2ª série – Volume 2
1. Qual parece ser a posição do autor em relação ao uso dos transgênicos?
O termo significa que o produto injetado foi produzido por um organismo genetica-
mente modificado (OGM), assim como o óleo de soja que consumimos, o algodão de muitas
das roupas que vestimos ou a insulina que a maioria dos diabéticos recebe todos os dias.
Ao contrário da hepatite A, que geralmente não deixa sequelas, uma infecção pelo vírus
da hepatite B é muito mais séria. Ela pode deixar sequelas crônicas no fígado e uma parte
dos pacientes pode desenvolver câncer. Como é difícil produzir grandes quantidades desse
vírus, o desenvolvimento de uma vacina eficaz e segura só foi possível devido aos avanços
da biotecnologia.
A partir do sequenciamento do genoma do vírus, foi identificado o gene que codifica a
proteína capaz de tornar as pessoas imunes ao próprio vírus.
Esse gene foi retirado do vírus e transferido para um fungo (semelhante àquele que utili-
zamos para fazer cerveja). O fungo modificado, por ter em seu genoma um gene originário do
vírus, é denominado transgênico. Ele se torna capaz de produzir grandes quantidades da
proteína viral. O fungo é cultivado, a proteína purificada e utilizada na produção da vacina.
Se neste ano estamos comemorando nossa autossuficiência em petróleo, nos últimos
anos deveríamos ter comemorado nossa autossuficiência na produção dessa vacina.
A vacina recombinante contra o vírus da hepatite B foi desenvolvida no nstituto Butantan
com a ajuda de um cientista que emigrou da ex-União Soviética, na década de 0. A adoção
em larga escala dessa vacina nos programas de vacinação do governo vai permitir diminuir a
incidência da doença e, de quebra, diminuir o número de casos de câncer de fígado. Espero
que ela também ajude a diminuir a desinformação que ronda os transgênicos e os OGMs,
afinal é um produto comercial, desenvolvido, aprovado e distribuído pelo governo brasileiro.
Quando recebi meu filho na saída da maternidade, tive a curiosidade de verificar se tinham
pendurado nele um “rótulo” com a advertência “pode conter transgênicos”, como exigido pelo
governo brasileiro para qualquer produto contendo derivados da soja transgênica. Não encon-
trei. Tampouco vejo a frase “contém transgênico” tatuada nos diabéticos que devem sua sobre-
vivência exatamente ao fato de receber, todos os dias, uma dose de insulina transgênica.
RE NACH, ernando. njetaram proteína transgênica no meu lho! São Paulo. O Estado de S.Paulo, 2 abr. 200 . Vida .
Disponível em: http: .reinach.com Estado Colunas 200 7 ---2 -abr-200 .doc . Acesso em: 27 fev. 201 .
Biologia – 2ª série – Volume 2
2. O conceito de organismo geneticamente modi cado apresentado no terceiro parágrafo do
texto é semelhante ao apresentado no texto Troca-troca genético?
3. O que signi ca “autossu ciência” em vacinas?
. Qual é a posição do autor em relação à legislação brasileira de identi cação dos produtos que
contêm transgênicos?
5. Qual é a principal ideia do texto Troca-troca genético? E do texto de ernando Reinach?
70
Biologia – 2ª série – Volume 2
. Do que você mais gostou nos textos?
L O DE CASA
Construção de um texto argumentativo
Leitura e análise de texto
Consumo de organismos transgênicos
No blog do jornalista Marcelo Leite (disponível em: http: cienciaemdia.folha.
blog.uol.com.br ; acesso em: 27 fev. 201 ), ele comenta o artigo do cientista ernando
Reinach reproduzido neste Caderno. O jornalista considera que o cientista usou apenas
exemplos em que produtos extraídos de organismos transgênicos são isolados antes de
ser utilizados. Por exemplo, quando o bebê citado no texto recebe a vacina contra
hepatite, nada proveniente do fungo transgênico é consumido, apenas a vacina purifi-
cada. sso, segundo o jornalista, é bem diferente de um produto como biscoitos ou
bolachas feitos com farinha de soja. Para a produção da farinha, a semente de soja
transgênica inteira é triturada e consumida. Todas as proteínas da semente, bem como
todo o DNA de cada célula, serão consumidas também.
Apesar da visão crítica do jornalista, sua posição quanto aos alimentos transgênicos
não fica evidente. Ele critica que Reinach tenha usado um exemplo que subestima o
problema dos alimentos transgênicos, afinal, ingerir DNA transgênico não é igual a se
alimentar de um produto obtido desse material. Para Marcelo Leite, a adoção da vacina
seria comparada ao uso do óleo de soja, mas não à ingestão do alimento contendo a semente
da soja, como o salgadinho.
Elaborado por Paulo Cunha especialmente para o São Paulo faz escola.
71
Biologia – 2ª série – Volume 2
Tomando por base as considerações do jornalista, faça uma redação analisando o artigo do
cientista ernando Reinach. No primeiro parágrafo, você deve apresentar o texto que será
analisado. No segundo, você pode destacar os aspectos positivos do texto. No terceiro, seus
aspectos negativos. Ao longo da redação, deve estar bem explícito o que é fato, o que é opinião
do cientista e o que é sua opinião.
72
Biologia – 2ª série – Volume 2
VOCÊ APRENDEU?
1. Pesquisadores inseriram dois genes bacterianos na Arabidopsis thaliana, uma espécie de agrião, e
criaram uma planta que não tolera solos contaminados. Nesse caso, é correto a rmar que:
a) houve melhoramento genético e, além da qualidade desejada, outras qualidades foram
transferidas, porque, invariavelmente, a planta resultante é melhor.
b) a planta recebeu naturalmente os genes, pois o próprio ar ou os insetos realizam a troca
do pólen contido nas ores das plantas.
c) foi realizada uma transformação genética e apenas os genes de interesse foram transfe-
ridos, o que resultou em uma bactéria transgênica.
d) os pesquisadores construíram uma bactéria e uma planta transgênicas com os dois
genes de interesse.
e) foi realizada uma transformação genética e apenas os genes de interesse foram transfe-
ridos, o que resultou em uma planta transgênica.
2. Com relação aos organismos transgênicos, é correto a rmar que:
a) são seres cuja informação genética provém de outra espécie.
b) são seres que possuem parte de sua informação genética proveniente de outra espécie.
c) são seres que apresentam substâncias mais saudáveis e devem ser consumidos por toda
a população.
d) devem ser evitados, uma vez que, por apresentarem composição química modi cada,
não são produtos saudáveis.
e) são seres que, durante o processo de alimentação, incorporam material genético das
espécies ingeridas.
3. (Enem – 2012) O milho transgênico é produzido a partir da manipulação do milho original,
com a transferência, para este, de um gene de interesse retirado de outro organismo de espécie
diferente. A característica de interesse será manifestada em decorrência:
a) do incremento do DNA a partir da duplicação do gene transferido.
b) da transcrição do RNA transportador a partir do gene transferido.
c) da expressão de proteínas sintetizadas a partir do DNA não hibridizado.
d) da síntese de carboidratos a partir da ativação do DNA do milho original.
e) da tradução do RNA mensageiro sintetizado a partir do DNA recombinante.
73
Biologia – 2ª série – Volume 2
. Analise a charge a seguir:
Mariano. Jornal da Ciência, ed. 515, 10 out. 2003.
Qual deve ser a opinião do autor da charge sobre a liberação das plantações de soja transgênica?
A partir dos elementos presentes na imagem, elabore um texto justi cando sua resposta.
5. A soja transgênica resistente a uma marca de herbicida foi produzida pela Empresa Brasileira de
Pesquisa Agropecuária (Embrapa) e está passando por testes de segurança alimentar e ambiental.
Esse processo dura aproximadamente três anos e consiste na produção de 200 plantas resistentes
ao herbicida. A partir desse lote, os pesquisadores escolhem as dez plantas com maior capacidade
de gerar descendentes também resistentes. Esses lhotes do lote inicial são expostos a doses de
herbicida três vezes maiores que as aplicadas convencionalmente. Por m, as melhores são separa-
das e apenas uma delas é levada a testes de segurança. Não existe a possibilidade de cruzamento
dessas plantas com outras e o risco de polinização cruzada com outro tipo de soja é de apenas 1%.
Por isso, os riscos ambientais causados pela soja transgênica são pequenos.
Com base no texto, explique por que a soja transgênica apresenta baixo risco ambiental.
©JornaldaCiência
7
Biologia – 2ª série – Volume 2
75
Biologia – 2ª série – Volume 2
S TUA O DE APREND AGEM 7
DEBATE SOBRE TRANSGÊN COS
Construindo argumentos e aprofundando o conhecimento
Neste Caderno, tratamos das tecnologias do DNA e de suas possíveis aplicações. Acontece
que a utilização dessas e de outras tecnologias não é um assunto que deve ficar restrito à
comunidade científica. necessário que diferentes segmentos da sociedade opinem, atuem e
ajudem a regularizar a aplicação e o uso de novas tecnologias. com essa intenção que convi-
damos você e seus colegas a organizar um debate cujo tema é a implantação da unidade de uma
empresa de biotecnologia (fictícia) que utiliza diferentes tipos de organismo transgênico no
município de Ecoli (também fictício).
Leitura e análise de texto
Caros cidadãos de Ecoli,
Gostaria de solicitar a participação de todos em um debate muito importante para a
nossa cidade. A Transbio, que é uma empresa de biotecnologia, acaba de inaugurar suas
instalações em Ecoli. Ela utiliza organismos transgênicos para a produção de diversos
materiais.
Nessa nova unidade, a empresa atua na área alimentícia, produzindo óleo de soja trans-
gênica e arroz com vitamina B; na área da saúde, insulina humana transgênica; e, na área
agropecuária, agrotóxico e soja transgênica resistente a esse agrotóxico. Além de plantar esses
organismos na região, ela quer vender tais produtos para nossa população.
Gostaria de contar com a ajuda de vocês, representantes de diversos setores de nossa
sociedade, para elaborar uma carta manifestando a posição dos cidadãos de Ecoli sobre alguns
questionamentos:
1. Devemos liberar a produção de todos esses materiais? E a venda? Quais condições
devem ser atendidas pela empresa?
2. Que cuidados devemos ter com a saúde de nossa população?
3. Quais são os benefícios dessa atividade para nossa cidade? E os riscos?
Conto com a colaboração de todos.
Atenciosamente,
O prefeito.
Elaborado especialmente para o São Paulo faz escola.
!
?
7
Biologia – 2ª série – Volume 2
Depois de ler a carta, siga a orientação de seu professor a respeito da organização do debate. A
turma será dividida em equipes que representarão os diferentes grupos sociais envolvidos na situação.
Grupos sociais
Cada grupo vai elaborar uma pesquisa, selecionar e organizar argumentos para defender seu ponto
de vista durante o debate. Essa pesquisa pode ser feita em sites, em revistas ou em livros didáticos. Seu
professor vai marcar uma data para que os grupos apresentem os resultados dessa pesquisa. Veja os
grupos participantes do debate.
Empresa de biotecnologia
ormado por administradores e técnicos em biotecnologia, este grupo representa os
interesses da indústria Transbio. Seus principais produtos são: na área alimentícia, óleo de
soja transgênica e arroz com vitamina B; na área da saúde, insulina humana transgênica; e,
na área agropecuária, agrotóxico e soja transgênica resistente a esse agrotóxico. A empresa
paga todos os seus impostos e está instalada em cidades do interior de São Paulo com baixa
renda per capita, como Ecoli. Suas plantações transgênicas são acompanhadas por órgãos de
fiscalização e estão de acordo com as regras estabelecidas até o momento.
Profissionais de saúde
ormado por médicos, nutricionistas, enfermeiros e outros profissionais ligados à saúde
humana, este grupo representa os interesses da população relacionados ao bem-estar físico.
Preocupados com a presença da indústria Transbio na região, esses profissionais começaram a
levantar dados sobre a população local para verificar os efeitos do trabalho em plantações trans-
gênicas e, principalmente, as consequências do consumo de alimentos e medicamentos transgê-
nicos. Além da toxicidade de produtos utilizados pela indústria, os profissionais de saúde
preocupam-se com as taxas de alergia dos moradores locais.
Setor agropecuário
ormado por proprietários de fazendas de pequeno, médio e grande portes e por
trabalhadores rurais, este grupo representa os interesses dos produtores agrícolas, que visam
aumentar a produtividade do setor. Segundo eles, a indústria Transbio traria benefícios
para a cidade por meio da geração de empregos e de maior atividade econômica na região.
No entanto, o setor agropecuário está preocupado com os gastos com matéria-prima e
com a rejeição do mercado consumidor.
Poder público
ormada por vereadores e secretários municipais, esta parte do poder público deve avaliar
quais seriam os benefícios das atividades da Transbio para a economia local assim como analisar
77
Biologia – 2ª série – Volume 2
as relações comerciais entre a empresa e o setor agropecuário, principalmente no que diz respeito
aos royalties ou direitos intelectuais. A legislação sobre a venda de transgênicos ao consumidor é
responsabilidade deste setor. Cabe também ao poder público propor às empresas estratégias de
investimento na qualidade de vida da população, como investir nos hospitais da região parte do
dinheiro que pagariam em impostos.
Pesquisadores da área de ecologia
ormado por biólogos, ambientalistas e ONGs de preservação do meio ambiente, este
setor está preocupado com os impactos das atividades da Transbio na área natural da cidade.
Ecoli apresenta uma vegetação de cerrado e de mata atlântica, dois importantes biomas no
Brasil que estão em risco, pois se encontram muito reduzidos. Este setor deve avaliar os
impactos em espécies nativas da região, pensando em como monitorá-los, e levantar infor-
mações sobre pesquisas na área.
Elaborado especialmente para o São Paulo faz escola.
Apresentando os resultados da pesquisa
Após a pesquisa, você e seus colegas de grupo devem discutir seus argumentos e elaborar uma
resposta à solicitação do prefeito, considerando o ponto de vista que representam. importante que
vocês esgotem todas as dúvidas e verifiquem a exatidão das informações dos colegas de grupo para
que os dados e os argumentos sejam consistentes.
No espaço a seguir, anote resumidamente os argumentos apresentados separadamente pelos
grupos sociais.
7
Biologia – 2ª série – Volume 2
Agora a turma será reorganizada para iniciar o debate entre os representantes dos diferentes
grupos.
Após o debate, os representantes devem elaborar uma carta de consenso. Nela, os diferentes
pontos de vista devem ser incorporados caso não seja possível uma proposta única.
Registre, no espaço a seguir, a carta de consenso elaborada pela turma.
7
Biologia – 2ª série – Volume 2
PARA SABER MA S
Livros
BRAS L. M N ST R O DA AGR CULTURA, PECUÁR A E ABASTEC MENTO.
Produtos orgânicos: o olho do consumidor. Secretaria de Desenvolvimento Agropecuário
e Cooperativismo. Brasília: Mapa ACS, 200 . Trata-se de uma cartilha do Ministério
da Agricultura produzida para orientar o consumidor sobre o novo selo de certificação
de produtos orgânicos, o Sistema Brasileiro de Avaliação da Conformidade Orgânica
(Sisorg). A publicação é ilustrada pelo cartunista iraldo e explica o que é produto
orgânico, suas qualidades e como ele deve ser produzido para ganhar o selo.
LE TE, Marcelo. Os alimentos transgênicos. São Paulo: Publifolha, 2000. O jornalista
explica os diferentes aspectos do tema.
LORETO, lgion L.S.; SEPEL, Lenira M.N. Atividades experimentais e didáticas de
Biologia Molecular e Celular. São Paulo: Editora da Sociedade Brasileira de Genética,
2003. v. 1. Esta obra apresenta materiais simples que podem ser utilizados na pro-
dução de atividades práticas sobre o tema.
Site e revista
REV STA DE B OTECNOLOG A. Disponível em: http: biotecnologia.com.br .
Revista eletrônica com atualidades em biotecnologia. Acesso em: 27 fev. 201 .
RUMJANEK, ranklin D.; R N LER, Conc M.C. Os exames de DNA nos tri-
bunais. Revista Ciência Hoje, Rio de Janeiro, v. 2 , n. 1 , mar. 2001.
Documentários e filme
Gattaca: a experiência genética (Gattaca). Direção: Andre Niccol. EUA, 1 7. 112
min. 1 anos. icção científica sobre uma sociedade organizada com base nas carac-
terísticas genéticas das pessoas.
Genoma humano: decodificando a vida (Decoding life: the blueprint of the human body).
Produção: Télé mages. rança, 1 . 50 min. Série transmitida pela TV Escola que
apresenta diferentes situações relacionadas ao estudo do genoma humano (câncer,
herança e envelhecimento, entre outras).
Mendel e a manipulação dos genes (Big questions: Mendel and the gene splicers).
Produção: Channel Learning England. nglaterra, 200 . 1 min. Exibido pela TV
Escola, este episódio da série Ciência em foco retrata o trabalho de Mendel e seus
desdobramentos no conhecimento atual sobre a herança biológica.
0
Biologia – 2ª série – Volume 2
Desafio!
Conforme proposto no início da Situação de Aprendizagem 1, recorte os nucleotídeos do
esquema a seguir e monte as moléculas de DNA e de RNA complementar. Seu professor vai
orientá-lo nessa tarefa. Boa sorte!
Desoxirribose
Desoxirribose
Desoxirribose
Desoxirribose
DesoxirriboseDesoxirriboseDesoxirribose
Desoxirribose
Desoxirribose
Desoxirribose
Desoxirribose
Desoxirribose
Desoxirribose
Desoxirribose
Desoxirribose
Desoxirribose
Ribose
Ribose
P
P
P
PCCCC
CU
P
P
P
PCCCC
CU
A
G
TTTU
A
G
TTTU
Desoxirribose
Desoxirribose
Desoxirribose
Desoxirribose
Desoxirribose
Desoxirribose
Desoxirribose
Desoxirribose
Ribose
A
A
Ribose
Ribose
Ribose
Ribose
Ribose
Ribose
Ribose
Ribose
Ribose
Ribose
Ribose
Ribose
Ribose
AAA
AAA
GGG
G
GGG
G
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
P
1
Biologia – 2ª série – Volume 2
3
Biologia – 2ª série – Volume 2
Biologia – 2ª série – Volume 2
5
Biologia – 2ª série – Volume 2
Biologia – 2ª série – Volume 2
CONCEPÇÃO E COORDENAÇÃO GERAL
NOVA EDIÇÃO 2014-2017
COORDENADORIA DE GESTÃO DA
EDUCAÇÃO BÁSICA – CGEB
Coordenadora
Maria Elizabete da Costa
Diretor do Departamento de Desenvolvimento
Curricular de Gestão da Educação Básica
João Freitas da Silva
Diretora do Centro de Ensino Fundamental
dos Anos Finais, Ensino Médio e Educação
Profissional – CEFAF
Valéria Tarantello de Georgel
Coordenadora Geral do Programa São Paulo
faz escola
Valéria Tarantello de Georgel
Coordenação Técnica
Roberto Canossa
Roberto Liberato
Suely Cristina de Albuquerque Bomfim
EQUIPES CURRICULARES
Área de Linguagens
Arte: Ana Cristina dos Santos Siqueira, Carlos
Eduardo Povinha, Kátia Lucila Bueno e Roseli
Ventrella.
Educação Física: Marcelo Ortega Amorim, Maria
Elisa Kobs Zacarias, Mirna Leia Violin Brandt,
Rosângela Aparecida de Paiva e Sergio Roberto
Silveira.
Língua Estrangeira Moderna (Inglês e
Espanhol): Ana Beatriz Pereira Franco, Ana Paula
de Oliveira Lopes, Marina Tsunokawa Shimabukuro
e Neide Ferreira Gaspar.
Língua Portuguesa e Literatura: Angela Maria
Baltieri Souza, Claricia Akemi Eguti, Idê Moraes dos
Santos, João Mário Santana, Kátia Regina Pessoa,
Mara Lúcia David, Marcos Rodrigues Ferreira, Roseli
Cordeiro Cardoso e Rozeli Frasca Bueno Alves.
Área de Matemática
Matemática: Carlos Tadeu da Graça Barros,
Ivan Castilho, João dos Santos, Otavio Yoshio
Yamanaka, Rosana Jorge Monteiro, Sandra Maira
Zen Zacarias e Vanderley Aparecido Cornatione.
Área de Ciências da Natureza
Biologia: Aparecida Kida Sanches, Elizabeth
Reymi Rodrigues, Juliana Pavani de Paula Bueno e
Rodrigo Ponce.
Ciências: Eleuza Vania Maria Lagos Guazzelli,
Gisele Nanini Mathias, Herbert Gomes da Silva e
Maria da Graça de Jesus Mendes.
Física: Anderson Jacomini Brandão, Carolina dos
Santos Batista, Fábio Bresighello Beig, Renata
Cristina de Andrade Oliveira e Tatiana Souza da
Luz Stroeymeyte.
Química: Ana Joaquina Simões S. de Mattos
Carvalho, Jeronimo da Silva Barbosa Filho, João
Batista Santos Junior, Natalina de Fátima Mateus e
Roseli Gomes de Araujo da Silva.
Área de Ciências Humanas
Filosofia: Emerson Costa, Tânia Gonçalves e
Teônia de Abreu Ferreira.
Geografia: Andréia Cristina Barroso Cardoso,
Débora Regina Aversan e Sérgio Luiz Damiati.
História: Cynthia Moreira Marcucci, Maria
Margarete dos Santos Benedicto e Walter Nicolas
Otheguy Fernandez.
Sociologia: Alan Vitor Corrêa, Carlos Fernando de
Almeida e Tony Shigueki Nakatani.
PROFESSORES COORDENADORES DO NÚCLEO
PEDAGÓGICO
Área de Linguagens
Educação Física: Ana Lucia Steidle, Eliana Cristine
Budiski de Lima, Fabiana Oliveira da Silva, Isabel
Cristina Albergoni, Karina Xavier, Katia Mendes
e Silva, Liliane Renata Tank Gullo, Marcia Magali
Rodrigues dos Santos, Mônica Antonia Cucatto da
Silva, Patrícia Pinto Santiago, Regina Maria Lopes,
Sandra Pereira Mendes, Sebastiana Gonçalves
Ferreira Viscardi, Silvana Alves Muniz.
Língua Estrangeira Moderna (Inglês): Célia
Regina Teixeira da Costa, Cleide Antunes Silva,
Ednéa Boso, Edney Couto de Souza, Elana
Simone Schiavo Caramano, Eliane Graciela
dos Santos Santana, Elisabeth Pacheco Lomba
Kozokoski, Fabiola Maciel Saldão, Isabel Cristina
dos Santos Dias, Juliana Munhoz dos Santos,
Kátia Vitorian Gellers, Lídia Maria Batista
Bomfim, Lindomar Alves de Oliveira, Lúcia
Aparecida Arantes, Mauro Celso de Souza,
Neusa A. Abrunhosa Tápias, Patrícia Helena
Passos, Renata Motta Chicoli Belchior, Renato
José de Souza, Sandra Regina Teixeira Batista de
Campos e Silmara Santade Masiero.
Língua Portuguesa: Andrea Righeto, Edilene
Bachega R. Viveiros, Eliane Cristina Gonçalves
Ramos, Graciana B. Ignacio Cunha, Letícia M.
de Barros L. Viviani, Luciana de Paula Diniz,
Márcia Regina Xavier Gardenal, Maria Cristina
Cunha Riondet Costa, Maria José de Miranda
Nascimento, Maria Márcia Zamprônio Pedroso,
Patrícia Fernanda Morande Roveri, Ronaldo Cesar
Alexandre Formici, Selma Rodrigues e
Sílvia Regina Peres.
Área de Matemática
Matemática: Carlos Alexandre Emídio, Clóvis
Antonio de Lima, Delizabeth Evanir Malavazzi,
Edinei Pereira de Sousa, Eduardo Granado Garcia,
Evaristo Glória, Everaldo José Machado de Lima,
Fabio Augusto Trevisan, Inês Chiarelli Dias, Ivan
Castilho, José Maria Sales Júnior, Luciana Moraes
Funada, Luciana Vanessa de Almeida Buranello,
Mário José Pagotto, Paula Pereira Guanais, Regina
Helena de Oliveira Rodrigues, Robson Rossi,
Rodrigo Soares de Sá, Rosana Jorge Monteiro,
Rosângela Teodoro Gonçalves, Roseli Soares
Jacomini, Silvia Ignês Peruquetti Bortolatto e Zilda
Meira de Aguiar Gomes.
Área de Ciências da Natureza
Biologia: Aureli Martins Sartori de Toledo, Evandro
Rodrigues Vargas Silvério, Fernanda Rezende
Pedroza, Regiani Braguim Chioderoli e Rosimara
Santana da Silva Alves.
Ciências: Davi Andrade Pacheco, Franklin Julio
de Melo, Liamara P. Rocha da Silva, Marceline
de Lima, Paulo Garcez Fernandes, Paulo Roberto
Orlandi Valdastri, Rosimeire da Cunha e Wilson
Luís Prati.
Física: Ana Claudia Cossini Martins, Ana Paula
Vieira Costa, André Henrique Ghelfi Rufino,
Cristiane Gislene Bezerra, Fabiana Hernandes
M. Garcia, Leandro dos Reis Marques, Marcio
Bortoletto Fessel, Marta Ferreira Mafra, Rafael
Plana Simões e Rui Buosi.
Química: Armenak Bolean, Cátia Lunardi, Cirila
Tacconi, Daniel B. Nascimento, Elizandra C. S.
Lopes, Gerson N. Silva, Idma A. C. Ferreira, Laura
C. A. Xavier, Marcos Antônio Gimenes, Massuko
S. Warigoda, Roza K. Morikawa, Sílvia H. M.
Fernandes, Valdir P. Berti e Willian G. Jesus.
Área de Ciências Humanas
Filosofia: Álex Roberto Genelhu Soares, Anderson
Gomes de Paiva, Anderson Luiz Pereira, Claudio
Nitsch Medeiros e José Aparecido Vidal.
Geografia: Ana Helena Veneziani Vitor, Célio
Batista da Silva, Edison Luiz Barbosa de Souza,
Edivaldo Bezerra Viana, Elizete Buranello Perez,
Márcio Luiz Verni, Milton Paulo dos Santos,
Mônica Estevan, Regina Célia Batista, Rita de
Cássia Araujo, Rosinei Aparecida Ribeiro Libório,
Sandra Raquel Scassola Dias, Selma Marli Trivellato
e Sonia Maria M. Romano.
História: Aparecida de Fátima dos Santos
Pereira, Carla Flaitt Valentini, Claudia Elisabete
Silva, Cristiane Gonçalves de Campos, Cristina
de Lima Cardoso Leme, Ellen Claudia Cardoso
Doretto, Ester Galesi Gryga, Karin Sant’Ana
Kossling, Marcia Aparecida Ferrari Salgado de
Barros, Mercia Albertina de Lima Camargo,
Priscila Lourenço, Rogerio Sicchieri, Sandra Maria
Fodra e Walter Garcia de Carvalho Vilas Boas.
Sociologia: Anselmo Luis Fernandes Gonçalves,
Celso Francisco do Ó, Lucila Conceição Pereira e
Tânia Fetchir.
Apoio:
Fundação para o Desenvolvimento da Educação
- FDE
CTP, Impressão e acabamento
Plural Indústria Gráfica Ltda.
Caderno do aluno biologia 2 ano vol 2 2014 2017
Caderno do aluno biologia 2 ano vol 2 2014 2017

Mais conteúdo relacionado

Mais procurados

Lista de exercicios sobre tabela periodica
Lista de exercicios sobre tabela periodicaLista de exercicios sobre tabela periodica
Lista de exercicios sobre tabela periodicaEstude Mais
 
Exercícios parte 1
Exercícios parte 1Exercícios parte 1
Exercícios parte 1diegodduarte
 
7ano exercicio anelideos_e_moluscos
7ano exercicio anelideos_e_moluscos7ano exercicio anelideos_e_moluscos
7ano exercicio anelideos_e_moluscosDomiciano514
 
Evolução biológica
Evolução biológicaEvolução biológica
Evolução biológicaCésar Milani
 
Aula 8º ano - O sistema endócrino
Aula 8º ano - O sistema endócrinoAula 8º ano - O sistema endócrino
Aula 8º ano - O sistema endócrinoLeonardo Kaplan
 
Planejamento de ciências 6º ano
Planejamento de ciências 6º anoPlanejamento de ciências 6º ano
Planejamento de ciências 6º anoAgenario Silva
 
Lista de exercícios Tipos de reprodução
Lista de exercícios Tipos de reproduçãoLista de exercícios Tipos de reprodução
Lista de exercícios Tipos de reproduçãoAndrea Barreto
 
I.1 Os seres vivos e o ambiente
I.1 Os seres vivos e o ambienteI.1 Os seres vivos e o ambiente
I.1 Os seres vivos e o ambienteRebeca Vale
 
Aula Biologia: introdução à biologia [1° Ano Ensino Médio]
Aula Biologia: introdução à biologia [1° Ano Ensino Médio]Aula Biologia: introdução à biologia [1° Ano Ensino Médio]
Aula Biologia: introdução à biologia [1° Ano Ensino Médio]Ronaldo Santana
 
Origem da vida
Origem da vidaOrigem da vida
Origem da vidaemanuel
 
Plano de aula( biotecnologia na microbiologia)
Plano de aula( biotecnologia na microbiologia)Plano de aula( biotecnologia na microbiologia)
Plano de aula( biotecnologia na microbiologia)Osmarino Gomes Pereira
 
Atividade analizando cariotipos humanos aberrante
Atividade   analizando cariotipos humanos aberranteAtividade   analizando cariotipos humanos aberrante
Atividade analizando cariotipos humanos aberrantenetoalvirubro
 
Gimnospermas
GimnospermasGimnospermas
GimnospermasURCA
 

Mais procurados (20)

Lista de exercicios sobre tabela periodica
Lista de exercicios sobre tabela periodicaLista de exercicios sobre tabela periodica
Lista de exercicios sobre tabela periodica
 
Plano de aula semanal 2 nadja
Plano de aula semanal 2 nadjaPlano de aula semanal 2 nadja
Plano de aula semanal 2 nadja
 
Exercícios parte 1
Exercícios parte 1Exercícios parte 1
Exercícios parte 1
 
7ano exercicio anelideos_e_moluscos
7ano exercicio anelideos_e_moluscos7ano exercicio anelideos_e_moluscos
7ano exercicio anelideos_e_moluscos
 
Plano de aula 05
Plano de aula 05Plano de aula 05
Plano de aula 05
 
Aula sobre origem da vida
Aula sobre origem da vidaAula sobre origem da vida
Aula sobre origem da vida
 
Evolução biológica
Evolução biológicaEvolução biológica
Evolução biológica
 
Prova de biologia diagnóstico 2º ano
Prova de biologia diagnóstico 2º anoProva de biologia diagnóstico 2º ano
Prova de biologia diagnóstico 2º ano
 
Aula 8º ano - O sistema endócrino
Aula 8º ano - O sistema endócrinoAula 8º ano - O sistema endócrino
Aula 8º ano - O sistema endócrino
 
Ciclo do carbono
Ciclo do carbonoCiclo do carbono
Ciclo do carbono
 
Planejamento de ciências 6º ano
Planejamento de ciências 6º anoPlanejamento de ciências 6º ano
Planejamento de ciências 6º ano
 
Lista de exercícios Tipos de reprodução
Lista de exercícios Tipos de reproduçãoLista de exercícios Tipos de reprodução
Lista de exercícios Tipos de reprodução
 
I.1 Os seres vivos e o ambiente
I.1 Os seres vivos e o ambienteI.1 Os seres vivos e o ambiente
I.1 Os seres vivos e o ambiente
 
Aula Biologia: introdução à biologia [1° Ano Ensino Médio]
Aula Biologia: introdução à biologia [1° Ano Ensino Médio]Aula Biologia: introdução à biologia [1° Ano Ensino Médio]
Aula Biologia: introdução à biologia [1° Ano Ensino Médio]
 
Origem da vida
Origem da vidaOrigem da vida
Origem da vida
 
Plano de ensino ciências 6º ano
Plano de ensino ciências 6º anoPlano de ensino ciências 6º ano
Plano de ensino ciências 6º ano
 
Plano de aula( biotecnologia na microbiologia)
Plano de aula( biotecnologia na microbiologia)Plano de aula( biotecnologia na microbiologia)
Plano de aula( biotecnologia na microbiologia)
 
Atividade analizando cariotipos humanos aberrante
Atividade   analizando cariotipos humanos aberranteAtividade   analizando cariotipos humanos aberrante
Atividade analizando cariotipos humanos aberrante
 
Caatinga
CaatingaCaatinga
Caatinga
 
Gimnospermas
GimnospermasGimnospermas
Gimnospermas
 

Semelhante a Caderno do aluno biologia 2 ano vol 2 2014 2017

Dt 11ºbg- virus-dna-mit dna
Dt 11ºbg- virus-dna-mit dnaDt 11ºbg- virus-dna-mit dna
Dt 11ºbg- virus-dna-mit dnaCecilferreira
 
Codigo genetico, controle das atividades celulares
Codigo genetico, controle das atividades celularesCodigo genetico, controle das atividades celulares
Codigo genetico, controle das atividades celularesGeraldo Ferigato
 
Cláudia Silva Poster STC
Cláudia Silva  Poster STCCláudia Silva  Poster STC
Cláudia Silva Poster STCEFAG
 
Crescimento e renovação celular
Crescimento e renovação celularCrescimento e renovação celular
Crescimento e renovação celularCecilferreira
 
Crescimento e renovacao_celular_-_historia_e_estrutura_do_dna
Crescimento e renovacao_celular_-_historia_e_estrutura_do_dnaCrescimento e renovacao_celular_-_historia_e_estrutura_do_dna
Crescimento e renovacao_celular_-_historia_e_estrutura_do_dnaDiogo Soares
 
2009 Volume3 C A D E R N O D O A L U N O B I O L O G I A Ensino Medio 2ase...
2009 Volume3  C A D E R N O D O A L U N O  B I O L O G I A  Ensino Medio 2ase...2009 Volume3  C A D E R N O D O A L U N O  B I O L O G I A  Ensino Medio 2ase...
2009 Volume3 C A D E R N O D O A L U N O B I O L O G I A Ensino Medio 2ase...BIOLOGO TOTAL
 
Engenharia genetica-conceitos-basicos,-ferramentas-e-aplicacoes-
Engenharia genetica-conceitos-basicos,-ferramentas-e-aplicacoes-Engenharia genetica-conceitos-basicos,-ferramentas-e-aplicacoes-
Engenharia genetica-conceitos-basicos,-ferramentas-e-aplicacoes-Gissely Souza
 
Polígrafo de genética
Polígrafo de genéticaPolígrafo de genética
Polígrafo de genéticadroppz
 
estudoemcasa - cn 8 ano volume 2.pdf
estudoemcasa - cn 8 ano volume 2.pdfestudoemcasa - cn 8 ano volume 2.pdf
estudoemcasa - cn 8 ano volume 2.pdfAglis Delgado
 
Planos de aula juntos
Planos de aula juntosPlanos de aula juntos
Planos de aula juntositihane
 

Semelhante a Caderno do aluno biologia 2 ano vol 2 2014 2017 (20)

Dt 11ºbg- virus-dna-mit dna
Dt 11ºbg- virus-dna-mit dnaDt 11ºbg- virus-dna-mit dna
Dt 11ºbg- virus-dna-mit dna
 
Plano ii juliana
Plano ii   julianaPlano ii   juliana
Plano ii juliana
 
Td 05 bio i síntese proteica
Td 05 bio i síntese proteicaTd 05 bio i síntese proteica
Td 05 bio i síntese proteica
 
Codigo genetico, controle das atividades celulares
Codigo genetico, controle das atividades celularesCodigo genetico, controle das atividades celulares
Codigo genetico, controle das atividades celulares
 
Cláudia Silva Poster STC
Cláudia Silva  Poster STCCláudia Silva  Poster STC
Cláudia Silva Poster STC
 
DNA
DNADNA
DNA
 
Disciplinas enem 2012
Disciplinas enem 2012Disciplinas enem 2012
Disciplinas enem 2012
 
2 genetica molecular
2 genetica molecular2 genetica molecular
2 genetica molecular
 
Plano ii luciana
Plano  ii   lucianaPlano  ii   luciana
Plano ii luciana
 
O dna em origami
O dna em origamiO dna em origami
O dna em origami
 
Crescimento e renovação celular
Crescimento e renovação celularCrescimento e renovação celular
Crescimento e renovação celular
 
Crescimento e renovacao_celular_-_historia_e_estrutura_do_dna
Crescimento e renovacao_celular_-_historia_e_estrutura_do_dnaCrescimento e renovacao_celular_-_historia_e_estrutura_do_dna
Crescimento e renovacao_celular_-_historia_e_estrutura_do_dna
 
2009 Volume3 C A D E R N O D O A L U N O B I O L O G I A Ensino Medio 2ase...
2009 Volume3  C A D E R N O D O A L U N O  B I O L O G I A  Ensino Medio 2ase...2009 Volume3  C A D E R N O D O A L U N O  B I O L O G I A  Ensino Medio 2ase...
2009 Volume3 C A D E R N O D O A L U N O B I O L O G I A Ensino Medio 2ase...
 
Engenharia genetica-conceitos-basicos,-ferramentas-e-aplicacoes-
Engenharia genetica-conceitos-basicos,-ferramentas-e-aplicacoes-Engenharia genetica-conceitos-basicos,-ferramentas-e-aplicacoes-
Engenharia genetica-conceitos-basicos,-ferramentas-e-aplicacoes-
 
Polígrafo de genética
Polígrafo de genéticaPolígrafo de genética
Polígrafo de genética
 
estudoemcasa - cn 8 ano volume 2.pdf
estudoemcasa - cn 8 ano volume 2.pdfestudoemcasa - cn 8 ano volume 2.pdf
estudoemcasa - cn 8 ano volume 2.pdf
 
4.1.1.mod.a4.1. dna
4.1.1.mod.a4.1. dna4.1.1.mod.a4.1. dna
4.1.1.mod.a4.1. dna
 
Adn
AdnAdn
Adn
 
Dna
DnaDna
Dna
 
Planos de aula juntos
Planos de aula juntosPlanos de aula juntos
Planos de aula juntos
 

Mais de Diogo Santos

3 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_3s
3 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_3s3 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_3s
3 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_3sDiogo Santos
 
3 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_3s
3 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_3s3 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_3s
3 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_3sDiogo Santos
 
2 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_2s
2 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_2s2 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_2s
2 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_2sDiogo Santos
 
2 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_2s
2 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_2s2 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_2s
2 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_2sDiogo Santos
 
1 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_1s
1 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_1s1 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_1s
1 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_1sDiogo Santos
 
1 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_1s
1 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_1s1 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_1s
1 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_1sDiogo Santos
 
Caderno do aluno química 3 ano vol 2 2014 2017
Caderno do aluno química 3 ano vol 2 2014 2017Caderno do aluno química 3 ano vol 2 2014 2017
Caderno do aluno química 3 ano vol 2 2014 2017Diogo Santos
 
Caderno do aluno química 3 ano vol 1 2014 2017
Caderno do aluno química 3 ano vol 1 2014 2017Caderno do aluno química 3 ano vol 1 2014 2017
Caderno do aluno química 3 ano vol 1 2014 2017Diogo Santos
 
Caderno do aluno química 2 ano vol 2 2014 2017
Caderno do aluno química 2 ano vol 2 2014 2017Caderno do aluno química 2 ano vol 2 2014 2017
Caderno do aluno química 2 ano vol 2 2014 2017Diogo Santos
 
Caderno do aluno química 2 ano vol 1 2014 2017
Caderno do aluno química 2 ano vol 1 2014 2017Caderno do aluno química 2 ano vol 1 2014 2017
Caderno do aluno química 2 ano vol 1 2014 2017Diogo Santos
 
Caderno do aluno química 1 ano vol 2 2014 2017
Caderno do aluno química 1 ano vol 2 2014 2017Caderno do aluno química 1 ano vol 2 2014 2017
Caderno do aluno química 1 ano vol 2 2014 2017Diogo Santos
 
Caderno do aluno química 1 ano vol 1 2014 2017
Caderno do aluno química 1 ano vol 1 2014 2017Caderno do aluno química 1 ano vol 1 2014 2017
Caderno do aluno química 1 ano vol 1 2014 2017Diogo Santos
 
Caderno do aluno biologia 3 ano vol 2 2014 2017
Caderno do aluno biologia 3 ano vol 2 2014 2017Caderno do aluno biologia 3 ano vol 2 2014 2017
Caderno do aluno biologia 3 ano vol 2 2014 2017Diogo Santos
 
Caderno do aluno biologia 3 ano vol 1 2014 2017
Caderno do aluno biologia 3 ano vol 1 2014 2017Caderno do aluno biologia 3 ano vol 1 2014 2017
Caderno do aluno biologia 3 ano vol 1 2014 2017Diogo Santos
 
Caderno do aluno biologia 1 ano vol 2 2014 2017
Caderno do aluno biologia 1 ano vol 2 2014 2017Caderno do aluno biologia 1 ano vol 2 2014 2017
Caderno do aluno biologia 1 ano vol 2 2014 2017Diogo Santos
 
Caderno do aluno biologia 1 ano vol 1 2014 2017
Caderno do aluno biologia 1 ano vol 1 2014 2017Caderno do aluno biologia 1 ano vol 1 2014 2017
Caderno do aluno biologia 1 ano vol 1 2014 2017Diogo Santos
 
Caderno do Aluno Física 3 Ano vol 1 2014-2017
Caderno do Aluno Física 3 Ano vol 1 2014-2017Caderno do Aluno Física 3 Ano vol 1 2014-2017
Caderno do Aluno Física 3 Ano vol 1 2014-2017Diogo Santos
 
Caderno do Aluno Física 3 Ano vol 2 2014-2017
Caderno do Aluno Física 3 Ano vol 2 2014-2017Caderno do Aluno Física 3 Ano vol 2 2014-2017
Caderno do Aluno Física 3 Ano vol 2 2014-2017Diogo Santos
 
Caderno do Aluno Física 2 Ano vol 2 2014-2017
Caderno do Aluno Física 2 Ano vol 2 2014-2017Caderno do Aluno Física 2 Ano vol 2 2014-2017
Caderno do Aluno Física 2 Ano vol 2 2014-2017Diogo Santos
 
Caderno do Aluno Física 2 Ano vol 1 2014-2017
Caderno do Aluno Física 2 Ano vol 1 2014-2017Caderno do Aluno Física 2 Ano vol 1 2014-2017
Caderno do Aluno Física 2 Ano vol 1 2014-2017Diogo Santos
 

Mais de Diogo Santos (20)

3 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_3s
3 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_3s3 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_3s
3 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_3s
 
3 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_3s
3 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_3s3 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_3s
3 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_3s
 
2 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_2s
2 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_2s2 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_2s
2 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_2s
 
2 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_2s
2 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_2s2 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_2s
2 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_2s
 
1 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_1s
1 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_1s1 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_1s
1 caderno do aluno 2014_2017_vol2_baixa_mat_matematica_em_1s
 
1 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_1s
1 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_1s1 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_1s
1 caderno do aluno 2014_2017_vol1_baixa_mat_matematica_em_1s
 
Caderno do aluno química 3 ano vol 2 2014 2017
Caderno do aluno química 3 ano vol 2 2014 2017Caderno do aluno química 3 ano vol 2 2014 2017
Caderno do aluno química 3 ano vol 2 2014 2017
 
Caderno do aluno química 3 ano vol 1 2014 2017
Caderno do aluno química 3 ano vol 1 2014 2017Caderno do aluno química 3 ano vol 1 2014 2017
Caderno do aluno química 3 ano vol 1 2014 2017
 
Caderno do aluno química 2 ano vol 2 2014 2017
Caderno do aluno química 2 ano vol 2 2014 2017Caderno do aluno química 2 ano vol 2 2014 2017
Caderno do aluno química 2 ano vol 2 2014 2017
 
Caderno do aluno química 2 ano vol 1 2014 2017
Caderno do aluno química 2 ano vol 1 2014 2017Caderno do aluno química 2 ano vol 1 2014 2017
Caderno do aluno química 2 ano vol 1 2014 2017
 
Caderno do aluno química 1 ano vol 2 2014 2017
Caderno do aluno química 1 ano vol 2 2014 2017Caderno do aluno química 1 ano vol 2 2014 2017
Caderno do aluno química 1 ano vol 2 2014 2017
 
Caderno do aluno química 1 ano vol 1 2014 2017
Caderno do aluno química 1 ano vol 1 2014 2017Caderno do aluno química 1 ano vol 1 2014 2017
Caderno do aluno química 1 ano vol 1 2014 2017
 
Caderno do aluno biologia 3 ano vol 2 2014 2017
Caderno do aluno biologia 3 ano vol 2 2014 2017Caderno do aluno biologia 3 ano vol 2 2014 2017
Caderno do aluno biologia 3 ano vol 2 2014 2017
 
Caderno do aluno biologia 3 ano vol 1 2014 2017
Caderno do aluno biologia 3 ano vol 1 2014 2017Caderno do aluno biologia 3 ano vol 1 2014 2017
Caderno do aluno biologia 3 ano vol 1 2014 2017
 
Caderno do aluno biologia 1 ano vol 2 2014 2017
Caderno do aluno biologia 1 ano vol 2 2014 2017Caderno do aluno biologia 1 ano vol 2 2014 2017
Caderno do aluno biologia 1 ano vol 2 2014 2017
 
Caderno do aluno biologia 1 ano vol 1 2014 2017
Caderno do aluno biologia 1 ano vol 1 2014 2017Caderno do aluno biologia 1 ano vol 1 2014 2017
Caderno do aluno biologia 1 ano vol 1 2014 2017
 
Caderno do Aluno Física 3 Ano vol 1 2014-2017
Caderno do Aluno Física 3 Ano vol 1 2014-2017Caderno do Aluno Física 3 Ano vol 1 2014-2017
Caderno do Aluno Física 3 Ano vol 1 2014-2017
 
Caderno do Aluno Física 3 Ano vol 2 2014-2017
Caderno do Aluno Física 3 Ano vol 2 2014-2017Caderno do Aluno Física 3 Ano vol 2 2014-2017
Caderno do Aluno Física 3 Ano vol 2 2014-2017
 
Caderno do Aluno Física 2 Ano vol 2 2014-2017
Caderno do Aluno Física 2 Ano vol 2 2014-2017Caderno do Aluno Física 2 Ano vol 2 2014-2017
Caderno do Aluno Física 2 Ano vol 2 2014-2017
 
Caderno do Aluno Física 2 Ano vol 1 2014-2017
Caderno do Aluno Física 2 Ano vol 1 2014-2017Caderno do Aluno Física 2 Ano vol 1 2014-2017
Caderno do Aluno Física 2 Ano vol 1 2014-2017
 

Último

Slides Lição 8, Betel, Ordenança para confessar os pecados e perdoar as ofens...
Slides Lição 8, Betel, Ordenança para confessar os pecados e perdoar as ofens...Slides Lição 8, Betel, Ordenança para confessar os pecados e perdoar as ofens...
Slides Lição 8, Betel, Ordenança para confessar os pecados e perdoar as ofens...LuizHenriquedeAlmeid6
 
Unidade 4 (Texto poético) (Teste sem correção) (2).docx
Unidade 4 (Texto poético) (Teste sem correção) (2).docxUnidade 4 (Texto poético) (Teste sem correção) (2).docx
Unidade 4 (Texto poético) (Teste sem correção) (2).docxRaquelMartins389880
 
Produção de poemas - Reciclar é preciso
Produção  de  poemas  -  Reciclar é precisoProdução  de  poemas  -  Reciclar é preciso
Produção de poemas - Reciclar é precisoMary Alvarenga
 
As Mil Palavras Mais Usadas No Inglês (Robert de Aquino) (Z-Library).pdf
As Mil Palavras Mais Usadas No Inglês (Robert de Aquino) (Z-Library).pdfAs Mil Palavras Mais Usadas No Inglês (Robert de Aquino) (Z-Library).pdf
As Mil Palavras Mais Usadas No Inglês (Robert de Aquino) (Z-Library).pdfcarloseduardogonalve36
 
Campanha 18 de. Maio laranja dds.pptx
Campanha 18 de.    Maio laranja dds.pptxCampanha 18 de.    Maio laranja dds.pptx
Campanha 18 de. Maio laranja dds.pptxlucioalmeida2702
 
Multiplicação - Caça-número
Multiplicação - Caça-número Multiplicação - Caça-número
Multiplicação - Caça-número Mary Alvarenga
 
Exercícios de Clima no brasil e no mundo.pdf
Exercícios de Clima no brasil e no mundo.pdfExercícios de Clima no brasil e no mundo.pdf
Exercícios de Clima no brasil e no mundo.pdfRILTONNOGUEIRADOSSAN
 
livro para educação infantil conceitos sensorial
livro para educação infantil conceitos sensoriallivro para educação infantil conceitos sensorial
livro para educação infantil conceitos sensorialNeuroppIsnayaLciaMar
 
HISTORIA DA XILOGRAVURA A SUA IMPORTANCIA
HISTORIA DA XILOGRAVURA A SUA IMPORTANCIAHISTORIA DA XILOGRAVURA A SUA IMPORTANCIA
HISTORIA DA XILOGRAVURA A SUA IMPORTANCIAElianeAlves383563
 
O que é, de facto, a Educação de Infância
O que é, de facto, a Educação de InfânciaO que é, de facto, a Educação de Infância
O que é, de facto, a Educação de InfânciaHenrique Santos
 
"Nós Propomos! Escola Secundária em Pedrógão Grande"
"Nós Propomos! Escola Secundária em Pedrógão Grande""Nós Propomos! Escola Secundária em Pedrógão Grande"
"Nós Propomos! Escola Secundária em Pedrógão Grande"Ilda Bicacro
 
Slides Lição 9, CPAD, Resistindo à Tentação no Caminho, 2Tr24.pptx
Slides Lição 9, CPAD, Resistindo à Tentação no Caminho, 2Tr24.pptxSlides Lição 9, CPAD, Resistindo à Tentação no Caminho, 2Tr24.pptx
Slides Lição 9, CPAD, Resistindo à Tentação no Caminho, 2Tr24.pptxLuizHenriquedeAlmeid6
 
Planejamento 2024 - 1º ano - Matemática 38 a 62.pdf
Planejamento 2024 - 1º ano - Matemática  38 a 62.pdfPlanejamento 2024 - 1º ano - Matemática  38 a 62.pdf
Planejamento 2024 - 1º ano - Matemática 38 a 62.pdfdanielagracia9
 
Livro infantil: A onda da raiva. pdf-crianças
Livro infantil: A onda da raiva. pdf-criançasLivro infantil: A onda da raiva. pdf-crianças
Livro infantil: A onda da raiva. pdf-criançasMonizeEvellin2
 
PPP6_ciencias final 6 ano ano de 23/24 final
PPP6_ciencias final 6 ano ano de 23/24 finalPPP6_ciencias final 6 ano ano de 23/24 final
PPP6_ciencias final 6 ano ano de 23/24 finalcarlaOliveira438
 
prova do exame nacional Port. 2008 - 2ª fase - Criterios.pdf
prova do exame nacional Port. 2008 - 2ª fase - Criterios.pdfprova do exame nacional Port. 2008 - 2ª fase - Criterios.pdf
prova do exame nacional Port. 2008 - 2ª fase - Criterios.pdfssuser06ee57
 
Meu corpo - Ruth Rocha e Anna Flora livro
Meu corpo - Ruth Rocha e Anna Flora livroMeu corpo - Ruth Rocha e Anna Flora livro
Meu corpo - Ruth Rocha e Anna Flora livroBrenda Fritz
 
CONCORDÂNCIA NOMINAL atividade ensino médio ead.pptx
CONCORDÂNCIA NOMINAL atividade ensino médio  ead.pptxCONCORDÂNCIA NOMINAL atividade ensino médio  ead.pptx
CONCORDÂNCIA NOMINAL atividade ensino médio ead.pptxLuana240603
 
APH- Avaliação de cena , analise geral do ambiente e paciente.
APH- Avaliação de cena , analise geral do ambiente e paciente.APH- Avaliação de cena , analise geral do ambiente e paciente.
APH- Avaliação de cena , analise geral do ambiente e paciente.HandersonFabio
 

Último (20)

Slides Lição 8, Betel, Ordenança para confessar os pecados e perdoar as ofens...
Slides Lição 8, Betel, Ordenança para confessar os pecados e perdoar as ofens...Slides Lição 8, Betel, Ordenança para confessar os pecados e perdoar as ofens...
Slides Lição 8, Betel, Ordenança para confessar os pecados e perdoar as ofens...
 
Unidade 4 (Texto poético) (Teste sem correção) (2).docx
Unidade 4 (Texto poético) (Teste sem correção) (2).docxUnidade 4 (Texto poético) (Teste sem correção) (2).docx
Unidade 4 (Texto poético) (Teste sem correção) (2).docx
 
Produção de poemas - Reciclar é preciso
Produção  de  poemas  -  Reciclar é precisoProdução  de  poemas  -  Reciclar é preciso
Produção de poemas - Reciclar é preciso
 
As Mil Palavras Mais Usadas No Inglês (Robert de Aquino) (Z-Library).pdf
As Mil Palavras Mais Usadas No Inglês (Robert de Aquino) (Z-Library).pdfAs Mil Palavras Mais Usadas No Inglês (Robert de Aquino) (Z-Library).pdf
As Mil Palavras Mais Usadas No Inglês (Robert de Aquino) (Z-Library).pdf
 
Campanha 18 de. Maio laranja dds.pptx
Campanha 18 de.    Maio laranja dds.pptxCampanha 18 de.    Maio laranja dds.pptx
Campanha 18 de. Maio laranja dds.pptx
 
Multiplicação - Caça-número
Multiplicação - Caça-número Multiplicação - Caça-número
Multiplicação - Caça-número
 
Exercícios de Clima no brasil e no mundo.pdf
Exercícios de Clima no brasil e no mundo.pdfExercícios de Clima no brasil e no mundo.pdf
Exercícios de Clima no brasil e no mundo.pdf
 
livro para educação infantil conceitos sensorial
livro para educação infantil conceitos sensoriallivro para educação infantil conceitos sensorial
livro para educação infantil conceitos sensorial
 
HISTORIA DA XILOGRAVURA A SUA IMPORTANCIA
HISTORIA DA XILOGRAVURA A SUA IMPORTANCIAHISTORIA DA XILOGRAVURA A SUA IMPORTANCIA
HISTORIA DA XILOGRAVURA A SUA IMPORTANCIA
 
O que é, de facto, a Educação de Infância
O que é, de facto, a Educação de InfânciaO que é, de facto, a Educação de Infância
O que é, de facto, a Educação de Infância
 
"Nós Propomos! Escola Secundária em Pedrógão Grande"
"Nós Propomos! Escola Secundária em Pedrógão Grande""Nós Propomos! Escola Secundária em Pedrógão Grande"
"Nós Propomos! Escola Secundária em Pedrógão Grande"
 
Slides Lição 9, CPAD, Resistindo à Tentação no Caminho, 2Tr24.pptx
Slides Lição 9, CPAD, Resistindo à Tentação no Caminho, 2Tr24.pptxSlides Lição 9, CPAD, Resistindo à Tentação no Caminho, 2Tr24.pptx
Slides Lição 9, CPAD, Resistindo à Tentação no Caminho, 2Tr24.pptx
 
Enunciado_da_Avaliacao_1__Direito_e_Legislacao_Social_(IL60174).pdf
Enunciado_da_Avaliacao_1__Direito_e_Legislacao_Social_(IL60174).pdfEnunciado_da_Avaliacao_1__Direito_e_Legislacao_Social_(IL60174).pdf
Enunciado_da_Avaliacao_1__Direito_e_Legislacao_Social_(IL60174).pdf
 
Planejamento 2024 - 1º ano - Matemática 38 a 62.pdf
Planejamento 2024 - 1º ano - Matemática  38 a 62.pdfPlanejamento 2024 - 1º ano - Matemática  38 a 62.pdf
Planejamento 2024 - 1º ano - Matemática 38 a 62.pdf
 
Livro infantil: A onda da raiva. pdf-crianças
Livro infantil: A onda da raiva. pdf-criançasLivro infantil: A onda da raiva. pdf-crianças
Livro infantil: A onda da raiva. pdf-crianças
 
PPP6_ciencias final 6 ano ano de 23/24 final
PPP6_ciencias final 6 ano ano de 23/24 finalPPP6_ciencias final 6 ano ano de 23/24 final
PPP6_ciencias final 6 ano ano de 23/24 final
 
prova do exame nacional Port. 2008 - 2ª fase - Criterios.pdf
prova do exame nacional Port. 2008 - 2ª fase - Criterios.pdfprova do exame nacional Port. 2008 - 2ª fase - Criterios.pdf
prova do exame nacional Port. 2008 - 2ª fase - Criterios.pdf
 
Meu corpo - Ruth Rocha e Anna Flora livro
Meu corpo - Ruth Rocha e Anna Flora livroMeu corpo - Ruth Rocha e Anna Flora livro
Meu corpo - Ruth Rocha e Anna Flora livro
 
CONCORDÂNCIA NOMINAL atividade ensino médio ead.pptx
CONCORDÂNCIA NOMINAL atividade ensino médio  ead.pptxCONCORDÂNCIA NOMINAL atividade ensino médio  ead.pptx
CONCORDÂNCIA NOMINAL atividade ensino médio ead.pptx
 
APH- Avaliação de cena , analise geral do ambiente e paciente.
APH- Avaliação de cena , analise geral do ambiente e paciente.APH- Avaliação de cena , analise geral do ambiente e paciente.
APH- Avaliação de cena , analise geral do ambiente e paciente.
 

Caderno do aluno biologia 2 ano vol 2 2014 2017

  • 2. MATERIAL DE APOIO AO CURRÍCULO DO ESTADO DE SÃO PAULO CADERNO DO ALUNO BIOLOGIA ENSINO MÉDIO 2a SÉRIE VOLUME 2 Nova edição 2014-2017 GOVERNO DO ESTADO DE SÃO PAULO SECRETARIA DA EDUCAÇÃO São Paulo
  • 3. Governo do Estado de São Paulo Governador Geraldo Alckmin Vice-Governador Guilherme Afif Domingos Secretário da Educação Herman Voorwald Secretária-Adjunta Cleide Bauab Eid Bochixio Chefe de Gabinete Fernando Padula Novaes Subsecretária de Articulação Regional Rosania Morales Morroni Coordenadora da Escola de Formação e Aperfeiçoamento dos Professores – EFAP Silvia Andrade da Cunha Galletta Coordenadora de Gestão da Educação Básica Maria Elizabete da Costa Coordenadora de Gestão de Recursos Humanos Cleide Bauab Eid Bochixio Coordenadora de Informação, Monitoramento e Avaliação Educacional Ione Cristina Ribeiro de Assunção Coordenadora de Infraestrutura e Serviços Escolares Dione Whitehurst Di Pietro Coordenadora de Orçamento e Finanças Claudia Chiaroni Afuso Presidente da Fundação para o Desenvolvimento da Educação – FDE Barjas Negri
  • 4. Caro(a) aluno(a) No volume anterior do Caderno do Aluno, as temáticas envolvendo os estudos da Organização Celular da Vida estiveram presentes ao longo de todo o caderno. Esperamos que você tenha iniciado a compreensão da Vida a partir de uma perspectiva microscópica ampliando, assim, os conhecimentos construídos na 1ª série do Ensino Médio. Conceitos sobre a Transmissão da Vida e da Variabilidade Genética também fizeram parte dessa construção. Além disso, você teve a oportunidade de conhecer os princípios das Leis de Mendel, as quais, até hoje, fundamentam a Genética Clássica e a Molecular. Neste volume 2, o objetivo é aprofundar seus conhecimentos sobre Genética, de modo a com- preender não somente os mecanismos de transmissão e de variabilidade genética, mas também como o organismo pode ser controlado pelas proteínas, cujo mecanismo de produção está intimamente associado ao DNA. Para isso, é necessário estudar a estrutura do DNA, compreender os processos de Duplicação, Transcrição e Tradução. Esses mecanismos permitem a transmissão das características e o controle do metabolismo do organismo através das proteínas. Por fim, você terá a oportunidade de consolidar seus conhecimentos sobre alguns assuntos mais recentes em termos de pesquisa científica em Genética, tais como: os testes de identificação através do DNA e a produção dos transgênicos. Estes tópicos ainda são alvo de muita controvérsia na atualidade. Bons estudos! Equipe Curricular de Biologia Área de Ciências da Natureza Coordenadoria de Gestão da Educação Básica – CGEB Secretaria da Educação do Estado de São Paulo
  • 5.
  • 6. TEMA DNA: A ECE TA DA V DA E SE C D GO A compreensão atual sobre o funcionamento dos seres vivos baseia-se em alguns fundamentos, sendo que um deles estabelece que as proteínas, macromoléculas de aminoácidos, são responsáveis por muitas das atividades das células e dos organismos. S T A O DE AP END AGEM 1 A EST T A DO DNA Você, provavelmente, já conhece a sigla DNA. Seja porque já ouviu falar dela na escola, seja porque leu alguma notícia ou assistiu a um programa de televisão que citava a sigla. Nesta Situação de Aprendizagem, você vai se familiarizar com essa molécula, com as diferentes formas de representá-la e com sua organização molecular. Para começo de conversa O que você conhece sobre o DNA ! ? Leitura e análise de imagem Analise a figura a seguir e depois responda às questões. 5 Biologia – 2ª série – Volume 2
  • 7. Capa da revista Nature, de 15 de fevereiro de 2001, que anunciou o sequenciamento do genoma humano. eprinted b permission from Macmillan Publishers Ltd: Nature 0 , 22 (15 ebruar 2001) Cover. ©MacmillanPublishers Biologia – 2ª série – Volume 2
  • 8. DNA José Miguel Wisnik Quando você nasceu ouvi seu grito Embora longe muito longe de você Meu coração bateu tambor aflito Tambor aflito e tonto de bater De tanto ser demais De tanto ser além De tanto bem e eu não ter paz m raio quando cai No medo que me fez Não me sentir capaz de ser seu pai Anos se passaram pela vida e te criaram Noites de lembrar e de esquecer Sonhos que não sei me esconderam e [me mostraram Esse dia em que eu te encontrei moça [e mulher E ali em frente a mim você me disse Que a falta que eu nunca te fiz então se fez E desabando como um edifício Abria um abismo a nossos pés 1. Como a imagem do DNA foi composta na capa da revista 2. Na sua opinião, o que signi ca essa imagem na capa de uma revista que trata sobre o sequen- ciamento do genoma humano . Quais características da molécula de DNA podem ser observadas nessa imagem Leitura e análise de texto Agora você vai ler a letra da música DNA, de José Miguel Wisnik, para responder às questões. Você nos viu tão bem No fundo de ninguém E o que se revelava a sós: Que elo nos valeu Que elo, ela e eu E a lua absurda sobre nós DNA, DNA Dança sua dança Dança em espirais DNA, DNA Ponte indecifrável Onde nos levais Seja onde for Onda do mar Mágica tão frágil Ser e nada mais DNA, DNA Daniela © Maianga Edições Musicais 7 Biologia – 2ª série – Volume 2
  • 9. 1. Qual é a relação de parentesco entre as personagens da canção Justi que com elementos pre- sentes no texto. 2. As personagens da canção apresentam um elo que não é a convivência. De acordo com a can- ção, que elo é esse 3. Localize, no texto, todas as sequências das letras “D”, “N” e “A” apresentadas nas três últimas estrofes. Liste as palavras que apresentam as três letras simultaneamente. . Com as palavras listadas na questão anterior, o autor da música, José Miguel Wisnik, cria um efeito similar a uma das características da molécula de DNA, observável na capa da revista. Que característica é essa Revelando a organização da molécula de DNA A substância ácido desoxirribonucleico (ADN ou DNA) é um polímero de nucleotídeos. dentifique e escreva os nomes dos componentes de um nucleotídeo na ilustração a seguir. Nucleotídeo Nucleotídeo de DNA + + Biologia – 2ª série – Volume 2
  • 10. Leitura e análise de texto e imagem O modelo da molécula da vida Em 1 53, rancis Crick e James Watson publicaram um artigo na revista Nature no qual sugeriam um modelo para a molécula do DNA. Segundo esse modelo, a molécula de DNA seria constituída por dois polímeros de nucleotídeos organi- zados em forma de uma dupla-hélice, como uma escada retorcida. Os corri- mãos dessa escada são formados de açúcar e fosfato. A novidade da estrutura proposta, além do formato em dupla-hélice, estava relacionada principalmente à maneira como os elementos estavam dispostos no DNA. De acordo com o modelo, as duas cadeias eram manti- das juntas por quatro bases nitrogena- das, duas purinas (adenina e guanina) e duas pirimidinas (timina e citosina), arranjadas aos pares e dispostas perpen- dicularmente ao eixo da molécula. Essas bases nitrogenadas estariam unidas aos pares por pontes de hidrogênio. Os pares seriam específicos, pois as pontes de hidrogênio só poderiam ocorrer entre uma purina e uma pirimidina. Assim, a adenina (purina) só pode se ligar à timina (pirimidina), e a guanina (purina) só se liga à citosina (pirimidina). sso significava que, se em uma das cadeias a base era uma adenina, o elemento correspondente na outra cadeia deveria ser uma timina. O mesmo ocorreria para o par guanina e citosina. Observe a imagem e faça a correspondência entre as características que estão sublinhadas no texto e as estruturas da ilustração. lustração esquemática de uma molécula de DNA. Cadeia de açúcar e fosfato Adenina Timina Guanina Citosina ©SamuelSilva Biologia – 2ª série – Volume 2
  • 11. Consolidando os conceitos ácido desoxirribonucleico polímero dupla-hélice fosfatos açúcar bases nitrogenadas adenina citosina guanina forma par com forma par com não estão ligados(as) com são ligam-se entre si por meio deestão ligados(as) com estão ligados(as) com que são formados por é constituído por muitos que se mantém ligada por é formado por uma é a sigla para o é um Você já viu um mapa de conceitos um esquema que explica por meio de texto, ima- gem e fluxo de setas o que acontece em deter- minado fenômeno. No mapa de concei- tos proposto, estão fal- tando alguns elementos. Converse com seus cole- gas e descubra a melhor maneira de completá-lo. Desafio! Mapa de conceitos sobre a estrutura do DNA. tilize as informações do mapa de conceitos que você completou com a ajuda dos colegas, para construir um texto em seu caderno explicando o que é e como está organizada a molécula de DNA. Depois de elaborar o texto, responda à seguinte questão: Na capa da revista Nature, as bases nitrogenadas estão representadas por cores diferentes. Qual é o signi cado disso ©ConexãoEditorial é um tipo de 10 Biologia – 2ª série – Volume 2
  • 12. VOC AP ENDE 1. Em um segmento de 100 nucleotídeos de uma cadeia de DNA, há 25 adeninas e 15 guaninas; no segmento correspondente da cadeia complementar há 30 adeninas. Com base nesses dados, conclui-se que essa molécula de DNA, considerando as duas cadeias, possui: a) 0 timinas. b) 50 guaninas. c) 30 timinas. d) 25 timinas. e) 5 citosinas. 2. (Enem–200 ) A identi cação da estrutura do DNA foi fundamental para compreender seu papel na continuidade da vida. Na década de 1 50, um estudo pioneiro determinou a propor- ção das bases nitrogenadas que compõem moléculas de DNA de várias espécies. Exemplos de materiais analisados Bases nitrogenadas Adenina Guanina Citosina Timina Espermatozoide humano 30,7% 1 ,3% 1 , % 31,2% ígado humano 30, % 1 ,5% 1 , % 30,2% Medula óssea de rato 2 , % 21, % 21,5% 2 ,5% Espermatozoide de ouriço-do-mar 32, % 17,7% 1 , % 32,1% Plântulas de trigo 27, % 21, % 22,7% 27, % Bactéria Escherichia coli 2 ,1% 2 , % 23, % 25,1% A comparação das proporções permitiu concluir que ocorre emparelhamento entre as bases nitrogenadas e que elas formam: a) pares de mesmo tipo em todas as espécies, evidenciando a universalidade da estrutura do DNA. b) pares diferentes de acordo com a espécie considerada, o que garante a diversidade da vida. c) pares diferentes em diferentes células de uma espécie, como resultado da diferenciação celular. d) pares especí cos apenas nos gametas, pois essas células são responsáveis pela perpetuação das espécies. e) pares especí cos somente nas bactérias, pois esses organismos são formados por uma única célula. 11 Biologia – 2ª série – Volume 2
  • 13. 3. A publicação do trabalho de rancis Crick e James Watson que estabeleceu o modelo da estru- tura da molécula de ácido desoxirribonucleico (DNA) ocorreu em 1 53. Entre as a rmativas a seguir, assinale a CO ETA: a) ma cadeia simples de DNA é constituída de nucleotídeos, compostos por uma desoxirri- bose ligada a um fosfato e a um aminoácido. b) Os nucleotídeos são ligados entre o fosfato e a base nitrogenada. c) Duas cadeias simples de DNA formam uma dupla-hélice, por meio da formação de ligações de hidrogênio entre as bases nitrogenadas. d) As duas cadeias de uma dupla-hélice possuem a mesma sequência de bases nitrogenadas. e) As ligações de hidrogênio mantêm o fosfato ligado ao açúcar desoxirribose. . (Comvest Vestibular nicamp – 2005) Em 25 de abril de 1 53, um estudo de uma única página na revista inglesa Nature intitulado “A estrutura molecular dos ácidos nucleicos”, quase ignorado de início, revolucionou para sempre todas as ciências da vida, sejam elas de homem, rato, planta ou bactéria. James Watson e rancis Crick descobriram a estrutura do DNA. Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a que correspondem os “corrimãos” e os “degraus” dessa escada. 12 Biologia – 2ª série – Volume 2
  • 14. S T A O DE AP END AGEM 2 A D PL CA O DO DNA ma das características mais surpreendentes da molécula de DNA é sua capacidade de se duplicar com o auxílio da enzima DNA polimerase e gerar duas moléculas idênticas. ! ? Com o auxílio de um colega, analise o grá co e responda às questões a seguir descrevendo o que observou. Considere, neste exercício, os conteúdos trabalhados no volume 1 sobre divisão celular. 1. O que está acontecendo durante a mitose 2. No período chamado de intérfase (G1, S e G2), o que aconteceu com a quantidade de DNA 3. Ao longo do ciclo celular, a quantidade de DNA por célula começa e termina com que valor O que isso signi ca Leitura e análise de gráfico O gráfico a seguir descreve a variação da quantidade de DNA de uma célula ao longo de seu ciclo. 2C C G1 S G2 G1 Tempo Mitose Prófase Metáfase Anáfase TelófaseeCitocinese QuantidadedeDNA Quantidade de DNA ao longo do ciclo celular. ©Lieobaashi 13 Biologia – 2ª série – Volume 2
  • 15. ma vez concluído o trabalho, troque-o com o de outra dupla. Verifique se a descrição feita pelos colegas confere com o que está representado no esquema. Etapas do ciclo celular. ©SamuelSilva Duplicação do DNA Aumento da massa celular Célula Núcleo Divisão celular I nício do ciclo Mitose ase S G1 G2 Aumento da massa celular A duplicação do DNA 1. Com base no que você e seus colegas já conhecem, responda: Como a molécula de DNA con- segue se duplicar As células formadas ao término da mitose são iguais ou diferentes Atividade coletiva: simulando a duplicação do DNA Nessa atividade, seu professor vai organizá-los de acordo com as fileiras da classe. Siga as instru- ções para dramatizar a duplicação de uma molécula de DNA. 1 Biologia – 2ª série – Volume 2
  • 16. Cada aluno deve escrever em uma folha de papel a base nitrogenada que representa. Cada fileira de carteiras será uma cadeia de DNA. As fileiras 2 e 3 iniciam a atividade definindo qual será a sequência de bases nitrogenadas: adenina (A), timina (T), citosina (C) ou guanina (G). Você e seus colegas podem definir a ordem, porém é importante lembrar da complementaridade das cadeias. Terminada a dramatização, escreva em seu caderno um resumo do que ocorreu. 1. Agora, retome o grá co do início da Situação de Aprendizagem e compare os fenômenos que ocorrem na variação de DNA de uma célula ao longo de seu ciclo com as etapas de dramati- zação que a classe acabou de realizar. 2. Complete a gura a seguir indicando o que representa cada cadeia da imagem de DNA em relação às leiras que a classe formou durante a dramatização. 1o Passo 2o Passo 3o Passo leiraleira leiraleira leiraleira leiraleira leiraleira ©SamuelSilva tas originais derivadas da duplicação Duplicação do DNA de acordo com a dramatização realizada. 15 Biologia – 2ª série – Volume 2
  • 17. L O DE CASA 1. Elabore um texto em seu caderno explicando como a complementaridade das bases nitrogena- das permite a duplicação do DNA. Atenção! Nesse texto, você deve apresentar: a descrição da estrutura do DNA; a complementaridade das bases nitrogenadas; o processo de duplicação do DNA durante o ciclo celular; a relação entre os eventos anteriores e a produção de duas células idênticas. PESQ SA ND V D AL O que é necessário para que o DNA se duplique? Consulte seu livro didático e identifique o papel da enzima polimerase do DNA (em alguns livros, você encontra o termo DNA polimerase) no processo de duplicação do DNA e as condições para que ela atue. O exercício a seguir requer que você pense no processo de duplicação como algo dinâmico que ocorre na interação entre o DNA e diversas proteínas. Em primeiro lugar, observe o quadro com a estimativa do número de pares de base (em bilhões) do DNA de diferentes espécies. 1 Biologia – 2ª série – Volume 2
  • 18. Espécie Pares de base do DNA Jiboia 2100000000 Ser humano 3100000000 Gafanhoto 300000000 Cebola 1 000000000 Salamandra 1 0000000000 Ameba 70000000000 Agora, pense no seguinte problema: Para duplicar o DNA, antes da divisão celular, a enzima polimerase do DNA adiciona novos nucleotídeos a uma velocidade aproximada de 00 nucleotídeos por segundo. Quantos dias seriam necessários para uma célula de cada uma das espécies listadas duplicar o seu DNA Espécie Jiboia Ser humano Gafanhoto Cebola Salamandra Ameba Dias possível que você e seus colegas de classe tenham chegado a um número elevado de dias necessários para a duplicação de uma célula de DNA de cada uma das espécies. Sabe-se, no entanto, que o tempo médio de duplicação de uma célula eucariota é de 12 horas. Tendo em vista que a enzima polimerase do DNA apresenta uma velocidade de reação constante para todas as espécies analisadas, converse com seus colegas e apresente uma hipótese para explicar essa aparente contradição. 17 Biologia – 2ª série – Volume 2
  • 19. VOCÊ APRENDEU? 1. Durante a intérfase da célula, pode-se a rmar que: a) praticamente não há atividade metabólica celular. b) ocorrem alterações no formato da célula. c) ocorre duplicação da célula. d) ocorre duplicação do DNA. e) a dupla- ta do DNA se separa. 2. A sequência de nucleotídeos CTGACCTTCG forma um segmento de DNA dupla-hélice ao se ligar à ta complementar: a) CTGACCTTCG b) GCTTCCAGTC c) GACTGGAAGC d) CTGACCTGCG e) AGCTTCCAGT 3. Para duplicar o DNA antes da divisão celular, existe uma proteína, a enzima DNA polimerase, cuja velocidade de reação é equivalente a aproximadamente 00 nucleotídeos por segundo. Quantos dias seriam necessários para uma célula de mosca-da-fruta duplicar seu DNA, sabendo que cada célula dessa espécie apresenta aproximadamente1 0 milhões de pares de base de DNA? a) 10 b) 5 c) 1 d) 7500 e) 125 . Algumas células não se multiplicam ao longo de sua vida. Entre elas, podem ser citados os neurônios. Para esse tipo celular especí co, como caria o grá co apre- sentado a seguir? 1 Biologia – 2ª série – Volume 2
  • 20. Densidade do DNA apenas com 1 N Densidade do DNA apenas com 15 N ©SamuelSilva A B C 5. ( uvest–200 ) Bactérias (Escherichia coli) foram cultivadas durante várias gerações em um meio de cultura no qual toda a fonte de nitrogênio era o isótopo pesado15 N. De uma amostra destas bactérias (amostra A), extraiu-se o DNA que foi submetido a uma técnica de centrifugação que permite separar moléculas de DNA de acordo com sua densidade. O restante das bactérias foi transferido para um meio de cultura em que todo o nitrogênio disponível era o isótopo normal 1 N. Retirou-se uma segunda amostra (amostra B), quando as bactérias completaram uma divisão celular neste novo meio, e uma terceira amostra (amostra C), quando as bactérias completaram duas divisões celulares. O DNA das bactérias das amos- tras B e C foi também extraído e centrifugado. A figura mostra o resultado da centrifugação do DNA das três amostras de bactérias. a) Por que, na amostra B, todo o DNA tem uma densidade intermediária entre o que é cons- tituído apenas por 1 N e o que contém apenas 15 N? b) Considerando que, na amostra C, a quantidade de DNA separada na faixa inferior é X, que quantidade de DNA há na faixa superior? APRENDENDO A APRENDER Existe uma série de recursos, disponíveis na internet, que representam o processo de duplicação do DNA de forma dinâmica e animada. Entre em um site de busca e procure pelos termos: replicação DNA; DNA replication animation. 1 Biologia – 2ª série – Volume 2
  • 21. Dica! nicie sua pesquisa pelos sites (acessos em: 27 fev. 201 ): O DNA vai ao supermercado. Disponível em: http: cib.org.br p-content uploads 2011 10 dna supermercado.pdf ; DNA from the beginning. Disponível em: http: .dnaftb.org . Site em língua inglesa com várias animações relacionadas ao tema. 20 Biologia – 2ª série – Volume 2
  • 22. S TUA O DE APREND AGEM 3 DO DNA PROTE NA Nesta Situação de Aprendizagem, você vai relacionar as características da molécula de DNA com a síntese de RNAs e de proteínas e compreender como esses três tipos de substâncias estão envolvidos com a manifestação das características. PESQU SA ND V DUAL O papel das macromoléculas comum referir-se às proteínas como componentes importantes para a organização e o funcio- namento da célula. No entanto, para o desenvolvimento desta Situação de Aprendizagem, é necessário ter essa noção mais clara e aprofundada. Para isso, pesquise em seu livro didático e na internet, converse com seus colegas e preencha a tabela a seguir: ! ? Funções das proteínas Função Descrição Exemplo Enzimática Atuam no metabolismo catalisando reações químicas. Pepsina, catalase, ATP sintetase. Estrutural Movimento Defesa Comunicação celular denti cação das células Transporte Características do DNA e do RNA DNA e RNA são ácidos nucleicos, por isso apresentam algumas semelhanças e algumas diferen- ças. Para estabelecer critérios claros que permitam comparar DNA e RNA, preencha a tabela a seguir consultando seu livro didático ou outra fonte de informação, como a internet. 21 Biologia – 2ª série – Volume 2
  • 23. DNA RNA 1. Qual é o signi cado da sigla? 2. O nucleotídeo desse ácido nucleico é formado por qual tipo de açúcar? 3. Quais são as bases nitrogenadas que podem formar um nucleotídeo desse ácido nucleico? . A molécula desse ácido nucleico é for- mada por ta simples ou dupla- ta? 5. Quais podem ser as funções desem- penhadas por moléculas desse ácido nucleico? . Em uma célula humana, onde são encontradas as moléculas desse ácido nucleico? Confira com seus colegas o preenchimento da tabela. O RNA mensageiro A seguir, você realizará a leitura da história em quadrinhos (HQ) Lembranças de um RNA mensageiro. Antes dessa leitura, reflita sobre a questão a seguir e registre que informações você espera encontrar nessa HQ. Como as informações contidas no DNA, que passam de uma geração para outra, podem resultar em uma característica? 22 Biologia – 2ª série – Volume 2
  • 24. ©Karmo 23 Biologia – 2ª série – Volume 2
  • 25. ©Karmo 2 Biologia – 2ª série – Volume 2
  • 26. Após a leitura da HQ, discuta com um colega e responda às questões a seguir: 1. Quais são, a partir das informações da HQ, os três tipos de RNA? Pesquise em seu livro didá- tico ou em outras fontes quais são suas respectivas funções. 2. Pelo texto, a tradução do RNA mensageiro começa sempre em uma mesma sequência. Que sequência é essa? 3. Em que local da célula eucariota ocorre a fabricação de RNA mensageiro? . Em que local da célula eucariota ocorre a tradução do RNA mensageiro? 5. De acordo com o texto, quando é encerrada a tradução do RNA mensageiro? . Que palavras podem substituir a expressão “sequências de aminoácidos”? 7. Com base na HQ, redija um texto que descreva a síntese de proteínas. 25 Biologia – 2ª série – Volume 2
  • 27. Decifrando o código genético Agora, você vai estudar com mais profundidade como uma informação presente no DNA pode se transformar em uma característica. Para isso, discuta com seus colegas a manchete a seguir, tomando como base as seguintes questões: 1. O que é um código? 2. O que signi ca código genético? 3. O que os cientistas mapearam? . O que é o “amarelinho”? 5. O que é o “Genoma Xylella”? Cientistas mapeiam o código genético da praga da laranja inalizado o maior projeto de pesquisa biológica do País, o Genoma Xylella, que pretende acabar com o amarelinho. 2 Biologia – 2ª série – Volume 2
  • 28. Leitura e análise de tabela O quadro a seguir resume o que a Ciência define como código genético. Com o auxílio de seu professor e do livro didático ou de outras fontes de consulta, procure compreender como o código genético é lido. Em seguida, procure pelo significado do termo “códon” e escreva no espaço a seguir. Códon: O código genético dos seres vivos 1ª- letra do códon 2ª- letra do códon 3ª- letra do códonU C A G U fenilalanina fenilalanina leucina leucina serina serina serina serina tirosina tirosina parada parada cisteína cisteína parada triptofano U C A G C leucina leucina leucina leucina prolina prolina prolina prolina histidina histidina glutamina glutamina arginina arginina arginina arginina U C A G A isoleucina isoleucina isoleucina metionina treonina treonina treonina treonina asparagina asparagina lisina lisina serina serina arginina arginina U C A G G valina valina valina valina alanina alanina alanina alanina ácido aspártico ácido aspártico ácido glutâmico ácido glutâmico glicina glicina glicina glicina U C A G . O que é genoma? 27 Biologia – 2ª série – Volume 2
  • 29. Leitura e análise de texto O código genético dos seres vivos Uma notícia publicada no ano 2000 apresentava o seguinte título: “Anunciada decifração do código genético da espécie humana”. No entanto, o código genético começou a ser decifrado em 1 1, quando Marshall Nirenberg produziu um RNA mensageiro apenas com nucleotídeos uracila. A proteína formada por Nirenberg era composta apenas de aminoácidos fenilalanina. Antes do término da década de 1 0, o código genético estava completamente decifrado. Para cada trinca de bases nitrogenadas, um aminoácido correspondente já havia sido identificado, conforme mostra o quadro do código genético dos seres vivos. Elaborado por Rodrigo Venturoso Mendes da Silveira especialmente para o São Paulo faz escola. 1. Depois de conversar com os colegas sobre o título da reportagem Cientistas mapeiam o código genético da praga da laranja e de observar o quadro que resume o código genético, escreva como a notícia publicada em 2000 pode ser interpretada. Em seguida, reescreva o título da reporta- gem com base no que você aprendeu. 2. Retome a HQ Lembranças de um RNA mensageiro e descubra: a) Qual a trinca de nucleotídeos (códon) que inicia a síntese de uma proteína. b) Quais os três primeiros aminoácidos codi cados pelo RNA mensageiro da história. 3. Na HQ, o códon UAG desempenha papel importante na síntese de proteínas. Que papel é esse? . Procure no quadro O código genético dos seres vivos outros códons que exerçam a mesma função do códon UAG. 2 Biologia – 2ª série – Volume 2
  • 30. 5. Quais códons correspondem ao aminoácido arginina e quais codi cam o aminoácido triptofano? . O que pode representar a diferença entre as formas como os aminoácidos arginina e triptofano são codi cados? 7. O que signi ca dizer que o código genético é universal? . Consultando o quadro O código genético dos seres vivos, traduza a sequência de DNA apresen- tada a seguir. Do DNA à proteína ita do DNA a ser transcrita TAC GGA GTA GCT ATA ATT RNA mensageiro Proteína VOCÊ APRENDEU? 1. Um professor de Biologia, procurando explicar de maneira mais simpli cada para seus alunos o processo de síntese de proteínas, utilizou as seguintes analogias: 2 Biologia – 2ª série – Volume 2
  • 31. – magine que você queira fazer um bolo. A primeira coisa de que você vai precisar é uma receita. O mesmo ocorre em relação à síntese de proteínas. – Para produzir um bolo, além da receita, você precisará de ingredientes. Da mesma forma, a célula precisa de certos ingredientes para produzir proteínas. – Suponha que sua mãe guarde todas as receitas no computador, que ca no escritório ou no quarto de estudos. Para utilizar a receita, você terá de imprimi-la. V – Para fazer o bolo, você se dirige à cozinha com a receita impressa. Lá estão, além dos ingredientes, o forno e os objetos para fazer o bolo. Em uma célula, também há um local onde ocorre a síntese de proteínas. Analise as alternativas e assinale aquela que indica uma correspondência verdadeira: a) O computador com as receitas seria o RNA das células. b) O quarto de estudos é o citoplasma da célula e o computador representa os ribossomos. c) O aluno, ao ler a receita e fazer o bolo na cozinha, representa o processo de tradução. d) A receita impressa corresponde ao RNA transportador. e) O bolo feito corresponde ao gene. 2. ( uvest – 1 ) Existe um número muito grande de substâncias com funções antibióticas. Essas substâncias diferem quanto à maneira pela qual interferem no metabolismo celular. Assim, a TETRAC CL NA liga-se aos ribossomos e impede a ligação do RNA transportador; a M TOM C NA inibe a ação da polimerase do DNA e a ESTREPTOM C NA causa erros na leitura dos códons do RNA mensageiro. Essas informações permitem a rmar que: – A TETRAC CL NA impede a transcrição e leva a célula bacteriana à morte por falta de RNA mensageiro. – A M TOM C NA, por inibir a duplicação do DNA, impede a multiplicação da célula bacteriana. – A ESTREPTOM C NA interfere na tradução e leva a célula bacteriana a produzir proteínas defeituosas. Das alternativas acima, a) apenas é correta. b) apenas e são corretas. c) apenas e são corretas. d) apenas e são corretas. e) , e são corretas. 30 Biologia – 2ª série – Volume 2
  • 32. 3. Se coletássemos proteínas em um ovo fóssil de certa espécie de dinossauro, seria possível reconstituir o DNA desses animais? Justi que. . ( uvest–2005) A seguir está representada a sequência dos 13 primeiros pares de nucleotídeos da região codi cadora de um gene. --- A T G A G T T G G C C T G --- --- T A C T C A A C C G G A C --- A primeira trinca de pares de bases nitrogenadas à esquerda corresponde ao aminoácido metionina. A tabela a seguir mostra alguns códons do RNA mensageiro e os aminoácidos codificados por cada um deles. Códon do RNAm Aminoácido ACC treonina AGU serina AUG metionina CCU prolina CUG leucina GAC ácido aspártico GGC glicina UCA serina UGG triptofano a) Escreva a sequência de bases nitrogenadas do RNA mensageiro transcrito a partir desse segmento de DNA. b) Utilizando a tabela de código genético fornecida, indique a sequência dos três aminoácidos seguintes à metionina, no polipeptídio codi cado por esse gene. 31 Biologia – 2ª série – Volume 2
  • 33. c) Qual seria a sequência dos três primeiros aminoácidos de um polipeptídio codi cado por um alelo mutante desse gene, originado pela perda do sexto par de nucleotídeos (ou seja, a deleção do par de bases T A)? Efeito das mutações O termo “mutação” é bastante popular e, normalmente, as pessoas o associam com o surgimento de organismos com características aberrantes. Em Biologia, no entanto, mutações gênicas são alte- rações permanentes na sequência de nucleotídeos do DNA. Essas alterações podem ter diferentes resultados, de acordo com o efeito que produzem na proteína final. Descubra algumas dessas situações resolvendo as questões: 1. Este é o trecho de um gene ( ta molde) fundamental para todos nós, o gene da proteína beta-hemoglobina. Essa proteína é de extrema importância no transporte de gás oxigênio para o corpo e sua função depende de sua estrutura espacial, que por sua vez depende da sequência de aminoácidos que a compõe. … CAC GTG GAC TGA GGA CTC CTC TTC… Lembrando que os códons se referem ao RNAm, consulte o quadro com o código genético para dizer qual é a sequência de aminoácidos correspondente. 2. Suponha que ocorra a seguinte mutação: … CAT GTG GAC TGA GGA CTC CTC TTC… Agora indique qual seria seu possível efeito. 3. Suponha agora a seguinte mutação: … TAC GTG GAC TGA GGA CTC CTC TTC… ndique as consequências em relação à sequência inicial. 32 Biologia – 2ª série – Volume 2
  • 34. . Considere agora as duas mutações a seguir e seus efeitos. a) … CAC GTG GAC TGA GGA ATC CTC TTC… b) … CAC GT GAC TGA GGA CTC CTC TTC… 5. Para concluir, faça uma pesquisa sobre a anemia falciforme e sua causa genética. 33 Biologia – 2ª série – Volume 2
  • 35. S TUA O DE APREND AGEM DO DNA CARACTER ST CA A proposta para esta Situação de Aprendizagem é rever alguns conceitos de Genética relacionados às ideias de Mendel sobre a herança biológica e, a partir deles, estabelecer relações com os conteúdos trabalhados sobre a molécula de DNA e a tradução da informação genética. Para começo de conversa Você se lembra do trabalho de Mendel estudado no volume 1? Para iniciar esta Situação de Aprendizagem, será necessário retomá-lo. nterprete o esquema e o mapa conceitual e, a seguir, redija um texto mostrando o que você entendeu. Ao concluir seu texto, troque-o com o de um colega para análise. Ao receber o texto do colega, verifique se os conceitos do mapa foram empregados corretamente para explicar o trabalho de Mendel com as ervilhas. ! ? ©SamuelSilva Esquema do trabalho de Mendel com as ervilhas. 3 Biologia – 2ª série – Volume 2
  • 36. Mapa conceitual sobre Genética. ORGAN SMOS V VOS são formados por C LULAS possuem estão contidas em um N ORMA ES GEN T CAS GENE em seu conjunto no indivíduo, constituem o são transmitidas entre as gerações pelos formam-se por possibilita a podem ser fundamenta a ocorre nos ME OSE pode apresentar formas alternativas chamadas ALELOSPR ME RA LE DE MENDEL SEGREGA O 3 : 1 pode originar as proporções HOMO G T CA HETERO G T CA se expressam na condição se expressam na condição DOM NANTES RECESS VOS em interação com o ambiente produz o GEN T PO EN T PO GAMETAS ©Adesign 35 Biologia – 2ª série – Volume 2
  • 37. Leitura e análise de texto Para integrar os conceitos de Biologia Molecular aos conceitos de Genética Clássica, será apresentado como exemplo o trabalho de pesquisadores ingleses. Esses cientistas trabalharam com uma das sete características de ervilha (Pisum sativum) estudadas por Mendel: a textura da semente, em que o estado liso é dominante sobre o rugoso. Do genótipo ao fenótipo Ao pesquisar a causa do fenótipo rugoso, pesquisadores ingleses suspeitaram de que esse fenótipo fosse consequência da grande quantidade de um açúcar simples (amido não ramificado) no cotilédone, o que resultaria no acúmulo de grande quantidade de água. Quando a semente amadurece, ela seca, ou seja, perde água. Como nessa semente há grande acúmulo de água, ela fica muito volumosa e, ao secar, sua película se enruga. A semente lisa possui açúcares com muitas ramificações, não acumulando água, e, como consequência, não tem rugosidade. Esses pesquisadores descobriram que o alto índice de açúcar simples na semente rugosa se deve a um defeito na síntese de amido, o que ocorre em razão da ausência de uma enzima ramificadora do amido (SBE-1, starch-branching enzyme ou enzima ramificadora do amido). Além disso, notaram que as células do cotilédone das ervilhas que acumulam amido não ramificado, por pressão osmótica, retêm mais água. O alelo “R”, que codifica a semente lisa, é um fragmento de DNA com 3,3 mil pares de bases. Esse alelo codifica a enzima SBE-1, responsável pela produção do amido ramificado. O alelo “r”, que codifica a semente rugosa, é um fragmento de DNA com uma inserção de 00 pares de bases, portanto o gene possui ,1 mil pares de bases, e a enzima SBE-1 produzida não é funcional. Assim, não há produção de amido ramificado, o que leva ao maior acúmulo de água; quando a semente seca, torna-se rugosa. Elaborado por Rodrigo Venturoso Mendes da Silveira especialmente para o São Paulo faz escola. Após a leitura, responda às questões a seguir: 1. Qual é o papel da enzima SBE-1 na semente lisa? 3 Biologia – 2ª série – Volume 2
  • 38. Sementes lisas puras apresentam esta sequência: TAC TCT ATG AAC CTC GTT AAA GTA CTA AAC ACT Sequência complementar: Sementes rugosas puras apresentam a seguinte sequência: TAC TCT ATG AAC CTC GTT AAA GTA CTA AAT AGA AAA ACT TT Sequência complementar: . A seguir, forme o RNA mensageiro, utilizando como molde as sequências apresentadas nos quadros da questão anterior. 5. Para nalizar, faça a tradução das moléculas de RNA mensageiro e escreva no quadro quais são as proteínas formadas para cada tipo de semente. Para isso, consulte o quadro O código genético dos seres vivos apresentado na Situação de Aprendizagem anterior. 2. Segundo o texto, qual a relação entre o fato de uma ervilha ser lisa ou rugosa e a osmose? 3. A seguir, você vai encontrar duas simulações hipotéticas de sequências obtidas na análise do DNA de dois tipos diferentes de ervilhas puras (homozigóticas): com sementes lisas e com sementes rugosas. Qual a sequência complementar do DNA em cada caso? 37 Biologia – 2ª série – Volume 2
  • 39. Tipo de semente Sequência de aminoácidos lisa rugosa . Qual das sequências de DNA corresponde ao alelo “r”, responsável pelo caráter semente rugosa? 7. Qual das sequências de DNA corresponde ao alelo “R”, responsável pelo caráter semente lisa? . Considere, agora, uma planta de ervilha heterozigótica para a característica textura da ervilha. Quais tipos de alelos ela possui? . Uma ervilha heterozigótica (Rr) apresenta o mesmo fenótipo de uma ervilha homozigótica dominante (RR): ambas são lisas. Esses dois tipos de ervilha são idênticos do ponto de vista molecular? Comente. 3 Biologia – 2ª série – Volume 2
  • 40. 0 20 30 40 10 50 60 I II III IV V 70 80 90 100 10. Considerando o texto Do genótipo ao fenótipo e o grá co apresentado a seguir, discuta com seus colegas de classe se a sequência dos aminoácidos de uma proteína pode in uenciar no funcio- namento dela. Porcentagem de amido rami cado na presença de diferentes proteínas. Dados ctícios. 11. Se a ervilha apresenta 50% de proteínas do tipo , ela tem qual fenótipo? 12. Procure em seu livro didático as diferenças entre as estruturas primária, secundária e terciária de uma proteína. Estrutura primária: Estrutura secundária: Estrutura terciária: Integrando conceitos As ideias de Mendel foram o ponto de partida para a compreensão atual de como as características biológicas são herdadas e se manifestam. Acontece, entretanto, que em seu tempo Mendel não tinha acesso a uma série de informações conhecidas hoje. Assim, se for feito um paralelo entre as ideias dele, que datam de 1 , e o que se sabe agora, pode-se construir o quadro a seguir: 3 Biologia – 2ª série – Volume 2
  • 41. Mendel, em 1866, deduziu que: Mendel, hoje, saberia que: As plantas possuem fatores hereditários. As plantas híbridas ( 1) para semente lisa e rugosa possuem os dois alelos (“R” e “r”), que Mendel chamou de fatores. Os fatores são transmitidos de uma geração à outra. A meiose explica como os alelos se separam na for- mação dos gametas. Os fatores podem ser representados por letras: maiúscula (R) para o dominante e minúscula (r) para o recessivo. Durante a meiose, os cromossomos homólogos se separam. As plantas híbridas ( 1) possuem os dois fatores (Rr); só assim podem produzir dois tipos de descendentes ( 2). Os cromossomos são constituídos por DNA e proteínas. Os fatores na planta híbrida não se misturam. O DNA é formado por uma cadeia dupla de nucleotídeos. Os fatores na planta híbrida devem se separar na formação dos gametas, para que cada game- ta possua apenas um dos fatores. A partir do DNA, uma molécula de RNA é sin- tetizada (RNA mensageiro), codi cando uma proteína. Obs.: é importante ressaltar que nessa época nada se sabia sobre cromossomos e meiose. A textura da semente é determinada pela presen- ça da enzima SBE-1 (strach-branching enzyme ou enzima ramificadora do amido). A enzima fun- cional, que permite o acúmulo de água tornando a semente lisa, é codificada pelo alelo R, um fragmento de DNA constituído por 3,3 mil pares de bases. A enzima codificada pelo alelo r (for- mado por ,1 mil pares de bases, contendo um trecho de 00 pares adicionais em sua sequência) não é funcional e impede o acúmulo de água, de modo que a semente torna-se rugosa. Agora, o professor vai organizar a turma, e você deve articular os conceitos apresentados na tabela na forma de um mapa de conceitos. O objetivo desse mapa é integrar os conceitos de Biologia Molecular e de Genética Clássica. Para a construção do mapa, utilize o conjunto de palavras apresentadas na página seguinte e o espaço em branco disponível. Caso o espaço não seja suficiente, faça o mapa em seu caderno. Em seguida, trace linhas, orientadas por setas, relacionando os vários conceitos por meio das expressões de ligação. Se for necessário, crie novas expressões para relacionar os conceitos. aça correlações múltiplas, de modo que o mapa final fique com o aspecto de rede, evitando relações lineares simples. Para isso, o mesmo conceito pode ser conectado a vários outros. Para ter uma noção de como é um mapa de conceitos, retome outros mapas que foram apresentados ao longo deste Caderno. Depois de construir seu mapa de conceitos, avalie os mapas dos colegas, verificando as diferenças e indicando possíveis relações equivocadas. 0 Biologia – 2ª série – Volume 2
  • 42. Conceitos I Conceitos II Expressões de ligação RR Rr rr R r fatores dominante recessivo ervilha lisa ervilha rugosa fenótipo genótipo heterozigoto homozigoto DNA sem inserção DNA com inserção dupla-hélice de DNA cromossomo proteína SBE-1 funcional proteína SBE-1 não funcional água alelo gene amido rami cado RNA mensageiro não produz produz perde muita perde pouca é são codi ca acumula muita acumula pouca faz composto de 1 Biologia – 2ª série – Volume 2
  • 43. VOCÊ APRENDEU? 1. ( uvest–2003) Qual das alternativas se refere a um cromossomo? a) Um conjunto de moléculas de DNA com todas as informações genéticas da espécie. b) Uma única molécula de DNA com informação genética para algumas proteínas. c) Um segmento de molécula de DNA com informação para uma cadeia polipeptídica. d) Uma única molécula de RNA com informação para uma cadeia polipeptídica. e) Uma sequência de três bases nitrogenadas do RNA mensageiro correspondente a um ami- noácido na cadeia polipeptídica. 2. ( uvest–2002) Em seu trabalho com ervilhas, publicado em 1 , Mendel representou os fatores hereditários determinantes dos estados amarelo e verde do caráter cor da semente pelas letras A e a, respectivamente. O conhecimento atual a respeito da natureza do material heredi- tário permite dizer que a letra A usada por Mendel simboliza: a) um segmento de DNA com informação para uma cadeia polipeptídica. b) um segmento de DNA com informação para um RNA ribossômico. c) um aminoácido em uma proteína. d) uma trinca de bases do RNA mensageiro. e) uma trinca de bases do RNA transportador. 3. ( uvest–2001) O anúncio do sequenciamento do genoma humano, em 21 de junho de 2000, signi ca que os cientistas determinaram: a) a sequência de nucleotídeos dos cromossomos humanos. b) todos os tipos de proteína codi cados pelos genes humanos. c) a sequência de aminoácidos do DNA humano. d) a sequência de aminoácidos de todas as proteínas humanas. e) o número correto de cromossomos da espécie humana. . (Comvest Vestibular Unicamp–1 ) O metabolismo celular é controlado por uma série de rea- ções em que estão envolvidas inúmeras proteínas. Uma mutação gênica pode determinar a alteração ou a ausência de algumas dessas proteínas, levando a mudanças no ciclo de vida da célula. 2 Biologia – 2ª série – Volume 2
  • 44. a) Explique a relação que existe entre gene e proteína. b) Por que podem ocorrer alterações nas proteínas quando o gene sofre mutação? c) Em que situação uma mutação não altera a molécula proteica? 5. ( uvest–1 ) Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo. Os indivíduos A, B e C têm mutações em um segmento de DNA desse gene, cuja sequência normal está representada a seguir: Sequência normal CAA AAC TGA GGA ATG CAT TTC (m) GTT TTG ACT CCT TAC GTA AAG Indivíduo A CAA AAC TGA GGA ATT CAT TTC (m) GTT TTG ACT CCT TAA GTA AAG Indivíduo B CAT AAC TGA GGA ATG CAT TTC (m) GTA TTG ACT CCT TAC GTA AAG Indivíduo C CAA TAC TGA GGA ATG CAT TTC (m) GTT ATG ACT CCT TAC GTA AAG 3 Biologia – 2ª série – Volume 2
  • 45. Códon Aminoácido Códon Aminoácido AAA lisina CUA leucina AAC asparagina GAU ácido glutâmico AAG lisina GCC alanina ACU treonina GUA valina AGU serina GUU valina AUG metionina UAA de parada CAA glutamina UAC tirosina CAU histidina UGA de parada CCU prolina UUG leucina Usando a tabela que relaciona alguns códons aos respectivos aminoácidos e considerando que a ta molde a ser transcrita é aquela assinalada com a letra m, responda: a) Quais serão os segmentos de proteínas produzidos, respectivamente, pelos indivíduos A, B e C? b) Como será o fenótipo (normal ou afetado) dos indivíduos A, B e C? Por quê? . O esquema a seguir representa uma simpli cação da relação entre genótipo e fenótipo. Com base nele e em outras informações trabalhadas ao longo deste ano, escreva um texto no caderno com o título: Do DNA à característica. Biologia – 2ª série – Volume 2
  • 46. transcrição tradução duplicação Característica biológica DNA RNA Proteínas 5 Biologia – 2ª série – Volume 2
  • 47. PARA SABER MA S Livros PERE RA, L gia V. Sequenciaram o genoma humano... e agora? São Paulo: Moderna, 2001. A autora explica as bases do sequenciamento de DNA e discute os impactos desse conhecimento. STRATHERN, Paul. Crick, Watson e o DNA em 90 minutos. Rio de Janeiro: Jorge ahar, 2001. O livro conta a história do trabalho de Watson e Crick e explica a estrutura do DNA. Sites (Acessos em: 27 fev. 201 .) GEN T CA NA ESCOLA. Disponível em: http: .sbg.org.br . O site apresenta atividades relacionadas aos conteúdos de Genética e Biologia Molecular. PROJETO GENOMA HUMANO. Disponível em: http: .videolog.tv video. php?id 311 7 . Neste endereço, está disponível um vídeo que aborda conteúdos de Biologia Molecular. Biologia – 2ª série – Volume 2
  • 48. 7 TEMA DNA: TECNOLOG AS DE MAN PULA O Neste Caderno, você e seus colegas vão trabalhar com algumas das aplicações tecnológicas desenvolvidas a partir do conhecimento acumulado sobre os mecanismos de herança. Entre elas estão a identificação por perfil de DNA e a produção de organismos transgênicos. S TUA O DE APREND AGEM 5 TESTE DE DENT CA O PELO DNA Para começo de conversa: montagem da molécula de DNA Nas páginas finais deste Caderno, você vai encontrar um esquema com modelos de nucleotídeos para recortar e montar moléculas de ácidos nucleicos. Com a orientação do professor, monte, com um colega, uma molécula de DNA com dez pares de nucleotídeos, considerando que 30% da molécula deve ser formada por adeninas. Depois duplique essa molécula com os nucleotídeos restantes. Por fim, transcreva essa molécula de DNA utilizando apenas uma das fitas como molde para produzir um RNA. Dica: os desoxirribonucleotídeos formam as moléculas de DNA e os ribonucleotídeos formam moléculas de RNA. A seguir, continuaremos o trabalho com biotecnologia mostrando como são feitos os testes de identificação pelo DNA. Trata-se de um tema bastante atual que contribui para a resolução de inúmeros casos de paternidade duvidosa, muitos deles divulgados pela mídia. Além disso, é uma técnica de amplo uso nas diversas áreas de Ciência e Tecnologia. O mistério de Dom Casmurro seria resolvido pelo teste de DNA? Um dos aspectos mais sedutores da obra Dom Casmurro, de Machado de Assis (1 ), é o mistério sobre a possível traição da personagem Capitu com Escobar, o melhor amigo de Bentinho, que é o protagonista e narrador da trama. Machado de Assis constrói um personagem atormentado pelo ciúme, colocando em dúvida, inclusive, a paternidade de seu filho, Ezequiel. Após a morte de Escobar, Bentinho começa a suspeitar da esposa, ao notar o grande sofrimento que ela demonstrou durante o enterro do amigo. A desconfiança de Bentinho chega ao ponto de provocar o rompimento e o fim do casamento. O filho, porém, fica sob a guarda do pai, que, a cada dia, acha que a criança fica mais parecida com Escobar. Essa é uma dúvida que o protagonista não tem como esclarecer; nem consegue provar se Capitu de fato o traiu. Se o romance Dom Casmurro estivesse ambientado nos dias de hoje, talvez não fosse tão encantador. O culpado? O teste de DNA. ! ? 7 Biologia – 2ª série – Volume 2
  • 49. 1. Como o teste de DNA poderia elucidar esse mistério? 2. Possivelmente, você já ouviu falar em teste de DNA. Em quais veículos de comunicação você tomou contato com esse assunto? Em que situações? Quais são os materiais biológicos coleta- dos dos indivíduos envolvidos para fazer o teste de DNA? Desvendando o mistério de Capitu Para resolver o mistério de Dom Casmurro, seria necessário realizar um teste de DNA. A primeira etapa seria coletar material biológico dos envolvidos: Capitu, Bentinho, Escobar (o melhor amigo de Bentinho) e Ezequiel (o filho). Geralmente, os pesquisadores empregam células presentes no sangue ou na mucosa da boca, mas podem utilizar células da pele ou presentes na raiz do cabelo. O DNA é extraído das células, isolado das demais estruturas celulares e purificado. Depois ele passa por um processo de clonagem molecular. Aqui, o termo “clonagem” refere-se à produção de cópias idênticas da sequência de DNA utilizando nucleotídeos livres e uma enzima já estudada neste volume: a polimerase do DNA. Atualmente, uma das técnicas mais adotadas para aumentar a quantidade de cópias (amplificar) de trechos específicos do DNA é a reação em cadeia da polimerase (PCR). Essa técnica permite que, em curto espaço de tempo, trechos específicos do DNA possam ser amplificados milhões de vezes. Depois de aumentar a quantidade de DNA por meio da clonagem molecular, os pesquisadores utilizam enzimas de restrição, proteínas capazes de cortar o DNA em pontos definidos, ou melhor, em sequências específicas. As “tesouras moleculares” foram descobertas em diferentes bactérias e, para cada uma delas, é quebrada uma sequência específica do DNA. No quadro a seguir, são apresentados algumas enzimas e seus pontos de corte. Biologia – 2ª série – Volume 2
  • 50. As setas que aparecem na primeira coluna do quadro simbolizam os pontos de quebra da ligação entre um nucleotídeo e outro. Quando isso acontece, os trechos se separam, formando fragmentos de DNA. Simulação do teste de DNA Para simular o teste de paternidade de Ezequiel, você terá acesso a algumas sequências fictícias de DNA humano. Sua tarefa será utilizar a enzima fictícia MDA para produzir os padrões de DNA característicos de cada pessoa. Essa proteína quebra as ligações apenas quando encontra a sequência de DNA apresentada a seguir. As ligações entre o T G e o A C são quebradas nesse local. t t t a t g g g c aaa t a c c c g Esquema para localizar o sítio de restrição da enzima utilizada. Sequência reconhecida Nome Origem 5’ GGATCC 3’ 3’ CCTAGG 5’ BamH Bacillus amyloliquefaciens H 5’ GAATTC 3’ 3’ CTTAAG 5’ EcoR E. coli R 13 5’ GGCC 3’ 3’ CCGG 5’ Hae Haemophilus aegyptius 5’ CTGCAG 3’ 3’ GACGTC 5’ Pst Providencia stuartii 5’ CTCGAG 3’ 3’ GAGCTC 5’ Xho Xanthomonas holcicola Especi cidade de algumas endonucleases de restrição. As setas indicam o ponto de clivagem na cadeia de DNA. onte: AHA, Arnaldo; ERRE RA, Henrique B.; PASSAGL A, Luciane M.P. (orgs.). Biologia molecular básica. . ed. Porto Alegre: Artmed, 2012. p. 33 . Biologia – 2ª série – Volume 2
  • 51. A seguir, cada dupla-fita de nucleotídeos faz parte de um cromossomo dos personagens de Dom Casmurro. Você deve utilizar a enzima de restrição MDA para separar o DNA dos envolvidos em frag- mentos menores. Para isso, localize no quadro os sítios de restrição da enzima MDA no DNA de todos os indivíduos. gcaatggcacccgttttatgggctggaatggcccctcccaatggcacccgtcacccgtttaaacc cgttaccgtgggcaaaatacccgaccttaccggggagggttaccgtgggcagtgggcaaatttgg tcgcacccgtatggaccgagcccctccccgactccgctctccgaatggcgccctgaaaccgagca agcgtgggcatacctggctcggggaggggctgaggcgagaggcttaccgcgggactttggctcgt gcaatggcacccgttttatgggctggaatggcccctcccaatggcacccgtcacccgtttaaacc cgttaccgtgggcaaaatacccgaccttaccggggagggttaccgtgggcagtgggcaaatttgg ctatgggctgggaatccatggccgcgcgcaatggcacccgtttaaaatggcccctccccgactcc gatacccgacccttaggtaccggcgcgcgttaccgtgggcaaatttttaccgggaggggctgagg cacccgacccgtatggaatggcacccgtcccgaccgacgggccgatgggcccgtcgggcccgtcg gtgggctgggcataccttaccgtgggcagggctggctccccggctgcccgggcagcccgggcagc tcgcacccgtatggaccgagcccctccccgactccgctctccgaatggcgccctgaaaccgagca agcgtgggcatacctggctcggggaggggctgaggcgagaggcttaccgcgggactttggctcgt tcgcacccgtatgcatggagcccctccccgactccgctctccgaatggcgccctgaaaccgagca agcgtgggcatacgtacctcggggaggggctgaggcgagaggcttaccgcgggactttggctcgt cacccgtcgagcacccgtatggacccaatggcacccgtccatggccatggcggacgggcccgtcg gtgggcagctcgtgggcatacctgggttaccgtgggcaggtaccggtaccgcctgcccgggcagc Capitu Ezequiel Bentinho Escobar Simulação de sequências de DNA dos personagens. 50 Biologia – 2ª série – Volume 2
  • 52. Depois de localizar e indicar os locais de corte pela enzima, confira seus resultados com os dos colegas da classe. Medindo fragmentos de DNA Esquema simpli cado da eletroforese. Após a produção dos fragmentos de diversos tamanhos, é preciso comparar o DNA dos envol- vidos. Para isso, vamos usar uma técnica conhecida como eletroforese. Após as explicações de seu professor sobre a técnica de eletroforese, descreva-a no espaço a seguir. polo negativo polo positivo gelatina banda de DNA + ©JurandirRibeiro SASSON, Sezar; S LVA JUN OR, Cesar da. Biologia – volume único. São Paulo: Saraiva, 2007. p. 5 5. 51 Biologia – 2ª série – Volume 2
  • 53. O quadro a seguir representa os sítios de restrição do DNA dos envolvidos no caso. Na tabela da próxima página, você deve indicar as bandas de cada um dos envolvidos, de acordo com os números dos pares de nucleotídeos de seu DNA. Quadro indicando os sítios de restrição para enzima do DNA dos personagens. tcgcacccgtatggaccgagcccctccccgactccgctctccgaatggcgccctgaaaccgagca agcgtgggcatacctggctcggggaggggctgaggcgagaggcttaccgcgggactttggctcgt 123419 cacccgacccgtatggaatggcacccgtcccgaccgacgggccgatgggcccgtcgggcccgtcg gtgggctgggcataccttaccgtgggcagggctggctccccggctgcccgggcagcccgggcagc 14546 tcgcacccgtatggaccgagcccctccccgactccgctctccgaatggcgccctgaaaccgagca agcgtgggcatacctggctcggggaggggctgaggcgagaggcttaccgcgggactttggctcgt123419 tcgcacccgtatgcatggagcccctccccgactccgctctccgaatggcgccctgaaaccgagca agcgtgggcatacgtacctcggggaggggctgaggcgagaggcttaccgcgggactttggctcgt 163019 cacccgtcgagcacccgtatggacccaatggcacccgtccatggccatggcggacgggcccgtcg gtgggcagctcgtgggcatacctgggttaccgtgggcaggtaccggtaccgcctgcccgggcagc20913617 gcaatggcacccgttttatgggctggaatggcccctcccaatggcacccgtcacccgtttaaacc cgttaccgtgggcaaaatacccgaccttaccggggagggttaccgtgggcagtgggcaaatttgg514101323 gcaatggcacccgttttatgggctggaatggcccctcccaatggcacccgtcacccgtttaaacc cgttaccgtgggcaaaatacccgaccttaccggggagggttaccgtgggcagtgggcaaatttgg514101323 ctatgggctgggaatccatggccgcgcgcaatggcacccgtttaaaatggcccctccccgactcc gatacccgacccttaggtaccggcgcgcgttaccgtgggcaaatttttaccgggaggggctgagg415131617 Capitu Ezequiel Bentinho Escobar 52 Biologia – 2ª série – Volume 2
  • 54. Com base no padrão de bandas de DNA de todos os envolvidos é possível determinar as relações de parentesco entre eles. Considere que, em caso de paternidade, deve-se, inicialmente, comparar o perfil de fragmentos de DNA da criança com o da mãe e identificar todos os possíveis fragmentos de DNA da criança que também estão presentes no da mãe. Depois, compare os fragmentos de DNA da criança que sobraram (que não têm correspondência com o DNA da mãe) com os perfis de DNA dos possíveis pais. O provável pai será aquele cujo perfil de DNA contenha todos os fragmentos de DNA complementares aos fragmentos de DNA da criança que não estão presentes no DNA da mãe. Escala em pares de base (pb) Envolvidos Capitu Ezequiel Bentinho Escobar 1 2 3 5 7 10 11 12 13 1 15 1 17 1 1 20 21 22 23 2 Escala em pares de base (pb) Envolvidos Capitu Ezequiel Bentinho Escobar 25 2 27 2 2 30 31 32 33 3 35 3 37 3 3 0 1 2 3 5 7 53 Biologia – 2ª série – Volume 2
  • 55. Agora, a partir da leitura do padrão de bandas de todos os indivíduos, responda às questões: 1. Quais são as bandas presentes na mãe e no lho? 2. Quais bandas sobraram no padrão do lho sem correspondência com o padrão da mãe? 3. Quem possui todas essas bandas que não têm correspondência com o padrão da mãe? . De acordo com a simulação feita, quem é o provável pai de Ezequiel? 5. Elabore uma história em quadrinhos propondo um desfecho para a obra de Machado de Assis, Dom Casmurro, com base em um suposto teste de DNA. Esse teste não precisa ter o mesmo resultado da simulação feita, ou seja, o pai de Ezequiel pode ser outro personagem de Dom Casmurro. 5 Biologia – 2ª série – Volume 2
  • 56. L O DE CASA Etapas para obtenção e análise do DNA 1. Complete o quadro a seguir com informações sobre cada uma das etapas, a partir das explica- ções de seu professor e de consultas ao livro didático. 2. Pesquise em seu livro o que são enzimas de restrição e como elas atuam. Extração Quantificação Amplificação Separação Análise e interpretação 55 Biologia – 2ª série – Volume 2
  • 57. VOCÊ APRENDEU? 1. Cinco casais procuraram a polícia e a rmaram ser os verdadeiros pais de Gabriela. A garota teria sido roubada de uma maternidade em 1 0. Ao assistir à entrevista da garota na TV, esses casais descon aram de que poderiam ser os pais. Todos se submeteram ao teste de identi cação pelo DNA e os resultados são apresentados a seguir. Quem são os verdadeiros pais de Gabriela? Assinale a alternativa correta. 2. Com relação às enzimas de restrição, é correto a rmar que: a) os sítios de restrição nunca acontecem dentro de um gene. b) para um ser vivo, os sítios de restrição são úteis apenas para a técnica inventada para analisar o DNA. c) todo sítio de restrição marca também o início da síntese de proteínas. d) indivíduos de uma mesma espécie possuem o mesmo número de sítios de restrição. e) irmãos sempre apresentam a mesma quantidade de sítios de restrição. 3. ( uvest – 1 7) Enzimas de restrição são fundamentais à Engenharia Genética porque permitem: a) a passagem de DNA através da membrana celular. b) inibir a síntese de RNA a partir de DNA. Gabriela a) Pai Mãe b) Pai Mãe c) Pai Mãe d) Pai Mãe e) Pai Mãe 5 Biologia – 2ª série – Volume 2
  • 58. c) inibir a síntese de DNA a partir de RNA. d) cortar DNA onde ocorrem sequências especí cas de bases. e) modi car sequências de bases do DNA. . Explique se as a rmações seguintes, sobre o teste de DNA, são verdadeiras ou falsas: a) “O exame de DNA só pode ser feito com sangue.” b) “O resultado mostrou que nós possuímos algumas bandas do mesmo tamanho; logo, está provado que ele é o meu pai.” 5. Com as técnicas estudadas, podemos veri car se existem regiões de interesse na ta de DNA. Chamamos essas regiões de marcadores, já que podemos associá-las a alguma característica em particular. A presença de um marcador no genoma de um indivíduo pode ser visualizada como uma banda de DNA em um gel de eletroforese. Dessa forma, podemos descobrir se um embrião poderá apresentar determinada característica ou doença genética com base na análise de seus marcadores. O esquema a seguir representa a análise de marcadores de DNA de quatro embriões humanos ( , , e V). Apenas a presença de duas bandas (A e B) indica que o indivíduo pode apresentar certa doença quando adulto. I II III IV DNA dos embriões eletroforese Banda A Banda B + – Observe o padrão de bandas do DNA de cada embrião e responda: a) Entre os embriões analisados, quais N O deverão apresentar a doença quando adultos? 57 Biologia – 2ª série – Volume 2
  • 59. b) Supondo que os quatro embriões sejam irmãos, qual é o padrão de bandas ( , , e V) mais provável PARA CADA UM de seus pais? c) Qual banda é formada por fragmentos de DNA de MENOR tamanho? Justi que. . A síndrome de Do n é ocasionada por uma trissomia do cromossomo 21. Em uma situação hipotética, um casal teve uma criança com a síndrome (C1 ) e, na segunda gravidez, resolveu sub- meter-se a um teste de DNA para veri car se a segunda criança (C2 ) também teria a síndrome. O teste de DNA analisa marcadores para os diferentes cromossomos presentes nas células das pessoas e foi feito a partir do DNA extraído de células sanguíneas dos pais e do primeiro filho (C1 ) e de uma punção do líquido amniótico (amniocentese) para analisar o segundo filho (C2 ). Mãe MãePai Pai Kb Kb C1 C2 7 6 5 4 7 6 5 4 Com base na análise dos resultados expressos na ilustração, responda: a) Qual a origem do cromossomo extra da criança? b) A segunda criança apresenta ou não a síndrome? Justi que. c) aça uma pesquisa e descubra qual a principal razão para que se forme um embrião com trissomia do cromossomo 21. 5 Biologia – 2ª série – Volume 2
  • 60. APRENDENDO A APRENDER Há diferentes situações nas quais o teste de identificação por DNA pode ser aplicado. Para cada uma das situações a seguir, encontre um exemplo real ou descreva de que forma esse teste é útil. Criminalística Crimes ambientais Tráfico de animais silvestres Pedigree de animais Doenças hereditárias dentificação de vírus e bactérias causadores de doenças 5 Biologia – 2ª série – Volume 2
  • 61. 0 Biologia – 2ª série – Volume 2
  • 62. S TUA O DE APREND AGEM COMO PRODU R UM TRANSGÊN CO? Eles estão entre nós. Se perguntar aos outros alunos da escola se já viram um organismo trans- gênico, é provável que a maioria diga que não. No entanto, é possível que a maioria, se não todos, já tenha tido algum contato com produtos derivados de organismos transgênicos. Muitos alimentos industrializados, por exemplo, usam produtos desse tipo em seu processo de fabricação. Da mesma forma, há diversos medicamentos feitos a partir de organismos transgênicos. aça uma pesquisa em seu livro didático ou em outras fontes de informação confiáveis e descubra exemplos de alimentos e medicamentos produzidos a partir de transgênicos. Leitura e análise de imagem 1. Quais são os organismos representados nessa imagem? 2. Os organismos estão representados do modo como os conhecemos? Comente. ©AlexandreCamanho 3. Se a imagem sugerir a representação de um transgênico, que características dos organismos podem ter sido combinadas para gerar um organismo desse tipo? ! ? 1 Biologia – 2ª série – Volume 2
  • 63. Leitura e análise de texto Troca-troca genético Já viu porco com patas e focinho coloridos? E cabra que dá leite capaz de acelerar a cicatrização de ferimentos? Ao contrário do que você possa estar pensando, não estamos falando de criaturas de filmes de ficção. Esses animais são resultado de experimentos cien- tíficos de verdade! Se você tiver curiosidade, podemos conversar sobre como essas e outras modificações nos seres vivos são possíveis e por que os cientistas fazem isso. Que tal? A cabra e o porco citados na abertura deste texto são apenas exemplos curiosos de seres vivos que receberam características de outras espécies. O porco ganhou a coloração de um tipo de alga marinha. Já na cabra foi introduzida uma característica do sangue responsável pela coagulação, isto é, por evitar hemorragias em cirurgias ou quando você se corta. Como assim? Bem, todos os animais e plantas têm dentro de suas células um conjunto de códigos que os fazem ser do jeito que são. Nos seres humanos, por exemplo, esse conjunto de códigos é responsável por termos dois braços, duas pernas, dois olhos, duas orelhas, um nariz, uma boca, um coração, dois rins... Enfim, por tudo que nos faz ter aparência humana por dentro e por fora. No caso de uma galinha, seu conjunto de códigos é responsável pelas características físicas que ela apresenta. E, assim, cada ser vivo tem o seu próprio conjunto de códigos, que se chama DNA. Guardou isso? Então, vamos adiante porque a conversa só está esquentando! Você, agora, precisa saber que cada código que forma esse conjunto recebe o nome de gene e que cada gene tem sua função. De novo, vamos pensar em nós, humanos: temos genes responsáveis pelo formato das nossas orelhas; pela cor dos nossos olhos; pela produção de substâncias que nos permitem digerir os alimentos... Enfim, como temos muitas caracterís- ticas, nosso DNA é formado por milhares de genes. Pense bem: se cada espécie de animal e de planta tem características próprias determi- nadas pelo conjunto de seus genes – isto é, pelo seu DNA –, o que acontece se os cientistas transferirem genes de uma espécie para outra? A espécie que receber os genes irá desenvolver uma ou mais características que não eram suas naturalmente, certo? Pois foi exatamente isso que aconteceu com a cabra ao receber o gene do homem responsável pelo desenvolvimento do fator de coagulação humano no seu leite. E também com o porco, que recebeu da alga marinha o gene responsável pela sua cor. Quando um ser vivo recebe um gene de outra espécie de animal ou vegetal, ele é chamado transgênico. Mas os cientistas podem, também, transferir genes entre seres da mesma espécie; estes são chamados organismos geneticamente modificados. ODA, Leila M.; CARNE RO, Júlia D. Troca-troca genético. Revista Ciência Hoje das Crianças. Rio de Janeiro: nstituto Ciência Hoje, mar. 2002. 2 Biologia – 2ª série – Volume 2
  • 64. 1. Quais relações você faz entre a imagem anterior e o título do texto Troca-troca genético? 2. Utilize os termos “seres vivos”, “células”, “DNA”, “genes”, “características biológicas”, “transgê- nicos” e “organismos geneticamente modi cados” (OGMs) e construa um mapa de conceitos. Para isso, explore as informações do texto e pesquise também em seu livro didático ou em outras fontes con áveis. 3 Biologia – 2ª série – Volume 2
  • 65. Leitura e análise de texto Para que trocar genes? Ao transferir genes de uma espécie para outra, os cientistas não estão pensando apenas em produzir porcos coloridos ou cabras com genes humanos. Experimentos como esses são válidos para testar se a troca genética é realmente possível. Se for, plantas podem receber genes de vírus, por exemplo. Este é o caso da alface transgênica, desenvolvida recentemente. Ela recebeu o gene que produz o antígeno do vírus da hepatite B e que pode virar uma vacina! Você comeria uma alface dessas? Pense duas vezes antes de dizer que não, porque o antígeno é a parte do vírus usada nas vacinas. Quando ele entra em nosso corpo, estimula o organismo a se defender da doença causada pelo vírus. Logo, a alface transgênica funciona como uma vacina para a hepatite B. Então, você prefere alface ou injeção? Gostou da vacina de alface? Melhor é a bebida láctea transgênica! Você sabe do que se trata: são aquelas pequenas garrafinhas que contêm leite fermentado com lactobacilos, bactérias que ajudam a proteger o intestino. Em breve, teremos lactobacilos transgênicos, com os antígenos de seis vírus diferentes. A vacina de leite fermentado vai combater doenças como a difteria, a coqueluche, o tétano, a caxumba, a rubéola e o sarampo, entre outras. No futuro, é provável que as vacinas sejam todas assim. Como é bom sonhar com o adeus às agulhadas... Podemos, ainda, citar as chances de os organismos transgênicos se tornarem substitutos de remédios, vitaminas e outras substâncias que nosso organismo necessita. Veja: em 1 5, começou a ser vendido o primeiro produto proveniente de um transgênico – a insulina, substância que controla a quantidade de açúcar no sangue. O gene humano responsável pela produção de insulina foi retirado de uma célula do pâncreas de uma pessoa saudável e transferido para uma bactéria, que começou a produzir a substância. Hoje, a insulina trans- gênica ajuda a salvar vidas de pessoas que têm diabetes, uma doença causada pela falha do corpo na produção dessa substância. Quer saber um pouco mais sobre a cabra que pode ser usada para melhorar a saúde das pessoas? Pois anote: a cabra transgênica (a vaca também pode ser usada), que recebe o gene humano responsável pela coagulação do sangue, produz no próprio leite a substância que possibilita a cicatrização de cortes e machucados nas pessoas. Essa substância é muito impor- tante para tratar os hemofílicos, que não a produzem em quantidades suficientes e podem ter grandes hemorragias a partir do mais simples sangramento. ODA, Leila M.; CARNE RO, Júlia D. Troca-troca genético. Revista Ciência Hoje das Crianças. Rio de Janeiro: nstituto Ciência Hoje, mar. 2002. Biologia – 2ª série – Volume 2
  • 66. 1. denti que, no texto, exemplos de uso dos transgênicos. 2. O que esses exemplos apresentam em comum? Leitura e análise de imagem A imagem a seguir é um esquema que busca explicar como se produz insulina transgênica. Após a leitura, responda às questões a seguir. Esquema da produção de insulina. Bactéria DNA da bactéria ragmento de DNA humano com o gene responsável pela produção de insulina nsulina transgênica produzida pela bactéria Célula humana 1 1 1 2 2 3 3 4 4 Isolamento do DNA bacteriano e do DNA humano Corte de ambos os DNAs com enzima de restrição Mistura de ambos os DNAs. Eles se juntam, formando uma molécula de DNA recombinante O DNA recombinante é introduzido em bactérias ©Aeroestudio 5 Biologia – 2ª série – Volume 2
  • 67. 1. Elabore um texto descrevendo os eventos representados. 2. Como são produzidos os fragmentos de DNA de interesse? 3. Por que o fragmento de interesse pode se ligar ao DNA da bactéria? . Como é possível aumentar o número de cópias desse DNA recombinante? Biologia – 2ª série – Volume 2
  • 68. Consolidando os conceitos Leitura e análise de texto Troca entre iguais Agora, vamos falar da troca de genes entre seres da mesma espécie: os organismos geneticamente modificados! Alguém poderia perguntar: para que trocar genes entre seres iguais? Que diferença isso pode fazer? hora de dizer que, embora organismos da mesma espécie tenham DNA exageradamente semelhante, existem mínimas diferenças que fazem cada ser ter o seu próprio código genético. Por isso, mesmo tendo dois braços, duas pernas, um nariz etc. etc. etc. como o seu vizinho, você é diferente dele! Com os bichos e as plantas também é assim: mesmo tendo um DNA que os caracteriza como sendo de determinada espécie, cada ser tem um código genético só seu. O uso de plantas geneticamente modificadas também pode aumentar a produção agrí- cola, o que traz vantagens para o meio ambiente. Quando as lavouras produzem mais vegetais de melhor qualidade, diminui a necessidade de desmatar novas áreas para plantações. Além disso, as plantas podem ser modificadas para que consumam menos água durante o cresci- mento. Assim o planeta economiza, pois cerca de dois terços de toda a água doce do mundo são consumidas na agricultura. A transferência de genes entre iguais também pode melhorar a qualidade dos alimentos, tornando-os mais nutritivos. o caso, por exemplo, de um arroz transgênico chamado golden rice (ou “arroz dourado”, em português). Ele é mais rico em vitamina A e ferro do que o arroz comum. A carência dessas substâncias no organismo pode causar problemas sérios, como cegueira e anemia. Olha que os animais também podem ser modificados para melhorar sob o ponto de vista alimentar. Cuba, por exemplo, criou uma tilápia transgênica e o Canadá, o salmão transgênico. Esses peixes tiveram alterado o gene responsável pelo crescimento e, por isso, crescem mais e concentram maior quantidade de proteínas. Apesar das vantagens, muitas pessoas temem as consequências do consumo de produtos transgênicos ou geneticamente modificados. Afinal de contas, esses experimentos são muito recentes. Os próprios cientistas trabalham com cautela, avaliando, a cada nova descoberta, se ela não oferece riscos ao homem e à natureza. E é normal que muitas pessoas tenham receio das novas tecnologias; as maiores descobertas científicas da História também encon- traram resistência na sua época. Mas quem sabe? Talvez esse troca-troca genético não pareça nada estranho daqui a um tempo. ODA, Leila M.; CARNE RO, Júlia D. Troca-troca genético. Revista Ciência Hoje das Crianças. Rio de Janeiro: nstituto Ciência Hoje, mar. 2002. 7 Biologia – 2ª série – Volume 2
  • 69. Após a leitura do texto, responda às questões: 1. Qual o termo mais apropriado para substituir a expressão “código genético” no texto? 2. Com base no texto, faça uma lista de benefícios decorrentes do uso de transgênicos. 3. As autoras se posicionam em relação aos transgênicos ou são imparciais? Criação de um título para o texto O texto a seguir trata do tema que estamos estudando. Leia com atenção e crie um título. Lembre-se de que, nesse caso, além de indicar o assunto tratado, o título deve ser atraente para o leitor. Título: Ocorreu em um dos melhores hospitais de São Paulo. azia menos de 2 horas que ele havia nascido quando me apresentaram um papel para assinar autorizando o procedimento. Consultei o médico, que me assegurou que era o recomendado. azer o quê? Autorizei. A injeção foi indolor e logo depois me entregaram a carteira de vacinação. iquei feliz, meu filho havia sido vacinado contra o vírus da hepatite B. Se você acha que isso é uma grande novidade, ainda em fase experimental, está enganado. Neste ano, o Ministério da Saúde adquiriu milhões de doses dessa vacina e agora ela faz parte do programa de imunização do governo brasileiro. Nos próximos anos, praticamente todas as crianças recém-nascidas serão imunizadas com esta vacina “recombinante”, um nome mais “delicado” e que sofre menos discriminação que “transgênica”, apesar de significar exatamente a mesma coisa. Biologia – 2ª série – Volume 2
  • 70. 1. Qual parece ser a posição do autor em relação ao uso dos transgênicos? O termo significa que o produto injetado foi produzido por um organismo genetica- mente modificado (OGM), assim como o óleo de soja que consumimos, o algodão de muitas das roupas que vestimos ou a insulina que a maioria dos diabéticos recebe todos os dias. Ao contrário da hepatite A, que geralmente não deixa sequelas, uma infecção pelo vírus da hepatite B é muito mais séria. Ela pode deixar sequelas crônicas no fígado e uma parte dos pacientes pode desenvolver câncer. Como é difícil produzir grandes quantidades desse vírus, o desenvolvimento de uma vacina eficaz e segura só foi possível devido aos avanços da biotecnologia. A partir do sequenciamento do genoma do vírus, foi identificado o gene que codifica a proteína capaz de tornar as pessoas imunes ao próprio vírus. Esse gene foi retirado do vírus e transferido para um fungo (semelhante àquele que utili- zamos para fazer cerveja). O fungo modificado, por ter em seu genoma um gene originário do vírus, é denominado transgênico. Ele se torna capaz de produzir grandes quantidades da proteína viral. O fungo é cultivado, a proteína purificada e utilizada na produção da vacina. Se neste ano estamos comemorando nossa autossuficiência em petróleo, nos últimos anos deveríamos ter comemorado nossa autossuficiência na produção dessa vacina. A vacina recombinante contra o vírus da hepatite B foi desenvolvida no nstituto Butantan com a ajuda de um cientista que emigrou da ex-União Soviética, na década de 0. A adoção em larga escala dessa vacina nos programas de vacinação do governo vai permitir diminuir a incidência da doença e, de quebra, diminuir o número de casos de câncer de fígado. Espero que ela também ajude a diminuir a desinformação que ronda os transgênicos e os OGMs, afinal é um produto comercial, desenvolvido, aprovado e distribuído pelo governo brasileiro. Quando recebi meu filho na saída da maternidade, tive a curiosidade de verificar se tinham pendurado nele um “rótulo” com a advertência “pode conter transgênicos”, como exigido pelo governo brasileiro para qualquer produto contendo derivados da soja transgênica. Não encon- trei. Tampouco vejo a frase “contém transgênico” tatuada nos diabéticos que devem sua sobre- vivência exatamente ao fato de receber, todos os dias, uma dose de insulina transgênica. RE NACH, ernando. njetaram proteína transgênica no meu lho! São Paulo. O Estado de S.Paulo, 2 abr. 200 . Vida . Disponível em: http: .reinach.com Estado Colunas 200 7 ---2 -abr-200 .doc . Acesso em: 27 fev. 201 . Biologia – 2ª série – Volume 2
  • 71. 2. O conceito de organismo geneticamente modi cado apresentado no terceiro parágrafo do texto é semelhante ao apresentado no texto Troca-troca genético? 3. O que signi ca “autossu ciência” em vacinas? . Qual é a posição do autor em relação à legislação brasileira de identi cação dos produtos que contêm transgênicos? 5. Qual é a principal ideia do texto Troca-troca genético? E do texto de ernando Reinach? 70 Biologia – 2ª série – Volume 2
  • 72. . Do que você mais gostou nos textos? L O DE CASA Construção de um texto argumentativo Leitura e análise de texto Consumo de organismos transgênicos No blog do jornalista Marcelo Leite (disponível em: http: cienciaemdia.folha. blog.uol.com.br ; acesso em: 27 fev. 201 ), ele comenta o artigo do cientista ernando Reinach reproduzido neste Caderno. O jornalista considera que o cientista usou apenas exemplos em que produtos extraídos de organismos transgênicos são isolados antes de ser utilizados. Por exemplo, quando o bebê citado no texto recebe a vacina contra hepatite, nada proveniente do fungo transgênico é consumido, apenas a vacina purifi- cada. sso, segundo o jornalista, é bem diferente de um produto como biscoitos ou bolachas feitos com farinha de soja. Para a produção da farinha, a semente de soja transgênica inteira é triturada e consumida. Todas as proteínas da semente, bem como todo o DNA de cada célula, serão consumidas também. Apesar da visão crítica do jornalista, sua posição quanto aos alimentos transgênicos não fica evidente. Ele critica que Reinach tenha usado um exemplo que subestima o problema dos alimentos transgênicos, afinal, ingerir DNA transgênico não é igual a se alimentar de um produto obtido desse material. Para Marcelo Leite, a adoção da vacina seria comparada ao uso do óleo de soja, mas não à ingestão do alimento contendo a semente da soja, como o salgadinho. Elaborado por Paulo Cunha especialmente para o São Paulo faz escola. 71 Biologia – 2ª série – Volume 2
  • 73. Tomando por base as considerações do jornalista, faça uma redação analisando o artigo do cientista ernando Reinach. No primeiro parágrafo, você deve apresentar o texto que será analisado. No segundo, você pode destacar os aspectos positivos do texto. No terceiro, seus aspectos negativos. Ao longo da redação, deve estar bem explícito o que é fato, o que é opinião do cientista e o que é sua opinião. 72 Biologia – 2ª série – Volume 2
  • 74. VOCÊ APRENDEU? 1. Pesquisadores inseriram dois genes bacterianos na Arabidopsis thaliana, uma espécie de agrião, e criaram uma planta que não tolera solos contaminados. Nesse caso, é correto a rmar que: a) houve melhoramento genético e, além da qualidade desejada, outras qualidades foram transferidas, porque, invariavelmente, a planta resultante é melhor. b) a planta recebeu naturalmente os genes, pois o próprio ar ou os insetos realizam a troca do pólen contido nas ores das plantas. c) foi realizada uma transformação genética e apenas os genes de interesse foram transfe- ridos, o que resultou em uma bactéria transgênica. d) os pesquisadores construíram uma bactéria e uma planta transgênicas com os dois genes de interesse. e) foi realizada uma transformação genética e apenas os genes de interesse foram transfe- ridos, o que resultou em uma planta transgênica. 2. Com relação aos organismos transgênicos, é correto a rmar que: a) são seres cuja informação genética provém de outra espécie. b) são seres que possuem parte de sua informação genética proveniente de outra espécie. c) são seres que apresentam substâncias mais saudáveis e devem ser consumidos por toda a população. d) devem ser evitados, uma vez que, por apresentarem composição química modi cada, não são produtos saudáveis. e) são seres que, durante o processo de alimentação, incorporam material genético das espécies ingeridas. 3. (Enem – 2012) O milho transgênico é produzido a partir da manipulação do milho original, com a transferência, para este, de um gene de interesse retirado de outro organismo de espécie diferente. A característica de interesse será manifestada em decorrência: a) do incremento do DNA a partir da duplicação do gene transferido. b) da transcrição do RNA transportador a partir do gene transferido. c) da expressão de proteínas sintetizadas a partir do DNA não hibridizado. d) da síntese de carboidratos a partir da ativação do DNA do milho original. e) da tradução do RNA mensageiro sintetizado a partir do DNA recombinante. 73 Biologia – 2ª série – Volume 2
  • 75. . Analise a charge a seguir: Mariano. Jornal da Ciência, ed. 515, 10 out. 2003. Qual deve ser a opinião do autor da charge sobre a liberação das plantações de soja transgênica? A partir dos elementos presentes na imagem, elabore um texto justi cando sua resposta. 5. A soja transgênica resistente a uma marca de herbicida foi produzida pela Empresa Brasileira de Pesquisa Agropecuária (Embrapa) e está passando por testes de segurança alimentar e ambiental. Esse processo dura aproximadamente três anos e consiste na produção de 200 plantas resistentes ao herbicida. A partir desse lote, os pesquisadores escolhem as dez plantas com maior capacidade de gerar descendentes também resistentes. Esses lhotes do lote inicial são expostos a doses de herbicida três vezes maiores que as aplicadas convencionalmente. Por m, as melhores são separa- das e apenas uma delas é levada a testes de segurança. Não existe a possibilidade de cruzamento dessas plantas com outras e o risco de polinização cruzada com outro tipo de soja é de apenas 1%. Por isso, os riscos ambientais causados pela soja transgênica são pequenos. Com base no texto, explique por que a soja transgênica apresenta baixo risco ambiental. ©JornaldaCiência 7 Biologia – 2ª série – Volume 2
  • 76. 75 Biologia – 2ª série – Volume 2
  • 77. S TUA O DE APREND AGEM 7 DEBATE SOBRE TRANSGÊN COS Construindo argumentos e aprofundando o conhecimento Neste Caderno, tratamos das tecnologias do DNA e de suas possíveis aplicações. Acontece que a utilização dessas e de outras tecnologias não é um assunto que deve ficar restrito à comunidade científica. necessário que diferentes segmentos da sociedade opinem, atuem e ajudem a regularizar a aplicação e o uso de novas tecnologias. com essa intenção que convi- damos você e seus colegas a organizar um debate cujo tema é a implantação da unidade de uma empresa de biotecnologia (fictícia) que utiliza diferentes tipos de organismo transgênico no município de Ecoli (também fictício). Leitura e análise de texto Caros cidadãos de Ecoli, Gostaria de solicitar a participação de todos em um debate muito importante para a nossa cidade. A Transbio, que é uma empresa de biotecnologia, acaba de inaugurar suas instalações em Ecoli. Ela utiliza organismos transgênicos para a produção de diversos materiais. Nessa nova unidade, a empresa atua na área alimentícia, produzindo óleo de soja trans- gênica e arroz com vitamina B; na área da saúde, insulina humana transgênica; e, na área agropecuária, agrotóxico e soja transgênica resistente a esse agrotóxico. Além de plantar esses organismos na região, ela quer vender tais produtos para nossa população. Gostaria de contar com a ajuda de vocês, representantes de diversos setores de nossa sociedade, para elaborar uma carta manifestando a posição dos cidadãos de Ecoli sobre alguns questionamentos: 1. Devemos liberar a produção de todos esses materiais? E a venda? Quais condições devem ser atendidas pela empresa? 2. Que cuidados devemos ter com a saúde de nossa população? 3. Quais são os benefícios dessa atividade para nossa cidade? E os riscos? Conto com a colaboração de todos. Atenciosamente, O prefeito. Elaborado especialmente para o São Paulo faz escola. ! ? 7 Biologia – 2ª série – Volume 2
  • 78. Depois de ler a carta, siga a orientação de seu professor a respeito da organização do debate. A turma será dividida em equipes que representarão os diferentes grupos sociais envolvidos na situação. Grupos sociais Cada grupo vai elaborar uma pesquisa, selecionar e organizar argumentos para defender seu ponto de vista durante o debate. Essa pesquisa pode ser feita em sites, em revistas ou em livros didáticos. Seu professor vai marcar uma data para que os grupos apresentem os resultados dessa pesquisa. Veja os grupos participantes do debate. Empresa de biotecnologia ormado por administradores e técnicos em biotecnologia, este grupo representa os interesses da indústria Transbio. Seus principais produtos são: na área alimentícia, óleo de soja transgênica e arroz com vitamina B; na área da saúde, insulina humana transgênica; e, na área agropecuária, agrotóxico e soja transgênica resistente a esse agrotóxico. A empresa paga todos os seus impostos e está instalada em cidades do interior de São Paulo com baixa renda per capita, como Ecoli. Suas plantações transgênicas são acompanhadas por órgãos de fiscalização e estão de acordo com as regras estabelecidas até o momento. Profissionais de saúde ormado por médicos, nutricionistas, enfermeiros e outros profissionais ligados à saúde humana, este grupo representa os interesses da população relacionados ao bem-estar físico. Preocupados com a presença da indústria Transbio na região, esses profissionais começaram a levantar dados sobre a população local para verificar os efeitos do trabalho em plantações trans- gênicas e, principalmente, as consequências do consumo de alimentos e medicamentos transgê- nicos. Além da toxicidade de produtos utilizados pela indústria, os profissionais de saúde preocupam-se com as taxas de alergia dos moradores locais. Setor agropecuário ormado por proprietários de fazendas de pequeno, médio e grande portes e por trabalhadores rurais, este grupo representa os interesses dos produtores agrícolas, que visam aumentar a produtividade do setor. Segundo eles, a indústria Transbio traria benefícios para a cidade por meio da geração de empregos e de maior atividade econômica na região. No entanto, o setor agropecuário está preocupado com os gastos com matéria-prima e com a rejeição do mercado consumidor. Poder público ormada por vereadores e secretários municipais, esta parte do poder público deve avaliar quais seriam os benefícios das atividades da Transbio para a economia local assim como analisar 77 Biologia – 2ª série – Volume 2
  • 79. as relações comerciais entre a empresa e o setor agropecuário, principalmente no que diz respeito aos royalties ou direitos intelectuais. A legislação sobre a venda de transgênicos ao consumidor é responsabilidade deste setor. Cabe também ao poder público propor às empresas estratégias de investimento na qualidade de vida da população, como investir nos hospitais da região parte do dinheiro que pagariam em impostos. Pesquisadores da área de ecologia ormado por biólogos, ambientalistas e ONGs de preservação do meio ambiente, este setor está preocupado com os impactos das atividades da Transbio na área natural da cidade. Ecoli apresenta uma vegetação de cerrado e de mata atlântica, dois importantes biomas no Brasil que estão em risco, pois se encontram muito reduzidos. Este setor deve avaliar os impactos em espécies nativas da região, pensando em como monitorá-los, e levantar infor- mações sobre pesquisas na área. Elaborado especialmente para o São Paulo faz escola. Apresentando os resultados da pesquisa Após a pesquisa, você e seus colegas de grupo devem discutir seus argumentos e elaborar uma resposta à solicitação do prefeito, considerando o ponto de vista que representam. importante que vocês esgotem todas as dúvidas e verifiquem a exatidão das informações dos colegas de grupo para que os dados e os argumentos sejam consistentes. No espaço a seguir, anote resumidamente os argumentos apresentados separadamente pelos grupos sociais. 7 Biologia – 2ª série – Volume 2
  • 80. Agora a turma será reorganizada para iniciar o debate entre os representantes dos diferentes grupos. Após o debate, os representantes devem elaborar uma carta de consenso. Nela, os diferentes pontos de vista devem ser incorporados caso não seja possível uma proposta única. Registre, no espaço a seguir, a carta de consenso elaborada pela turma. 7 Biologia – 2ª série – Volume 2
  • 81. PARA SABER MA S Livros BRAS L. M N ST R O DA AGR CULTURA, PECUÁR A E ABASTEC MENTO. Produtos orgânicos: o olho do consumidor. Secretaria de Desenvolvimento Agropecuário e Cooperativismo. Brasília: Mapa ACS, 200 . Trata-se de uma cartilha do Ministério da Agricultura produzida para orientar o consumidor sobre o novo selo de certificação de produtos orgânicos, o Sistema Brasileiro de Avaliação da Conformidade Orgânica (Sisorg). A publicação é ilustrada pelo cartunista iraldo e explica o que é produto orgânico, suas qualidades e como ele deve ser produzido para ganhar o selo. LE TE, Marcelo. Os alimentos transgênicos. São Paulo: Publifolha, 2000. O jornalista explica os diferentes aspectos do tema. LORETO, lgion L.S.; SEPEL, Lenira M.N. Atividades experimentais e didáticas de Biologia Molecular e Celular. São Paulo: Editora da Sociedade Brasileira de Genética, 2003. v. 1. Esta obra apresenta materiais simples que podem ser utilizados na pro- dução de atividades práticas sobre o tema. Site e revista REV STA DE B OTECNOLOG A. Disponível em: http: biotecnologia.com.br . Revista eletrônica com atualidades em biotecnologia. Acesso em: 27 fev. 201 . RUMJANEK, ranklin D.; R N LER, Conc M.C. Os exames de DNA nos tri- bunais. Revista Ciência Hoje, Rio de Janeiro, v. 2 , n. 1 , mar. 2001. Documentários e filme Gattaca: a experiência genética (Gattaca). Direção: Andre Niccol. EUA, 1 7. 112 min. 1 anos. icção científica sobre uma sociedade organizada com base nas carac- terísticas genéticas das pessoas. Genoma humano: decodificando a vida (Decoding life: the blueprint of the human body). Produção: Télé mages. rança, 1 . 50 min. Série transmitida pela TV Escola que apresenta diferentes situações relacionadas ao estudo do genoma humano (câncer, herança e envelhecimento, entre outras). Mendel e a manipulação dos genes (Big questions: Mendel and the gene splicers). Produção: Channel Learning England. nglaterra, 200 . 1 min. Exibido pela TV Escola, este episódio da série Ciência em foco retrata o trabalho de Mendel e seus desdobramentos no conhecimento atual sobre a herança biológica. 0 Biologia – 2ª série – Volume 2
  • 82. Desafio! Conforme proposto no início da Situação de Aprendizagem 1, recorte os nucleotídeos do esquema a seguir e monte as moléculas de DNA e de RNA complementar. Seu professor vai orientá-lo nessa tarefa. Boa sorte! Desoxirribose Desoxirribose Desoxirribose Desoxirribose DesoxirriboseDesoxirriboseDesoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Ribose Ribose P P P PCCCC CU P P P PCCCC CU A G TTTU A G TTTU Desoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Desoxirribose Ribose A A Ribose Ribose Ribose Ribose Ribose Ribose Ribose Ribose Ribose Ribose Ribose Ribose Ribose AAA AAA GGG G GGG G P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P P 1 Biologia – 2ª série – Volume 2
  • 83.
  • 84. 3 Biologia – 2ª série – Volume 2
  • 85. Biologia – 2ª série – Volume 2
  • 86. 5 Biologia – 2ª série – Volume 2
  • 87. Biologia – 2ª série – Volume 2
  • 88. CONCEPÇÃO E COORDENAÇÃO GERAL NOVA EDIÇÃO 2014-2017 COORDENADORIA DE GESTÃO DA EDUCAÇÃO BÁSICA – CGEB Coordenadora Maria Elizabete da Costa Diretor do Departamento de Desenvolvimento Curricular de Gestão da Educação Básica João Freitas da Silva Diretora do Centro de Ensino Fundamental dos Anos Finais, Ensino Médio e Educação Profissional – CEFAF Valéria Tarantello de Georgel Coordenadora Geral do Programa São Paulo faz escola Valéria Tarantello de Georgel Coordenação Técnica Roberto Canossa Roberto Liberato Suely Cristina de Albuquerque Bomfim EQUIPES CURRICULARES Área de Linguagens Arte: Ana Cristina dos Santos Siqueira, Carlos Eduardo Povinha, Kátia Lucila Bueno e Roseli Ventrella. Educação Física: Marcelo Ortega Amorim, Maria Elisa Kobs Zacarias, Mirna Leia Violin Brandt, Rosângela Aparecida de Paiva e Sergio Roberto Silveira. Língua Estrangeira Moderna (Inglês e Espanhol): Ana Beatriz Pereira Franco, Ana Paula de Oliveira Lopes, Marina Tsunokawa Shimabukuro e Neide Ferreira Gaspar. Língua Portuguesa e Literatura: Angela Maria Baltieri Souza, Claricia Akemi Eguti, Idê Moraes dos Santos, João Mário Santana, Kátia Regina Pessoa, Mara Lúcia David, Marcos Rodrigues Ferreira, Roseli Cordeiro Cardoso e Rozeli Frasca Bueno Alves. Área de Matemática Matemática: Carlos Tadeu da Graça Barros, Ivan Castilho, João dos Santos, Otavio Yoshio Yamanaka, Rosana Jorge Monteiro, Sandra Maira Zen Zacarias e Vanderley Aparecido Cornatione. Área de Ciências da Natureza Biologia: Aparecida Kida Sanches, Elizabeth Reymi Rodrigues, Juliana Pavani de Paula Bueno e Rodrigo Ponce. Ciências: Eleuza Vania Maria Lagos Guazzelli, Gisele Nanini Mathias, Herbert Gomes da Silva e Maria da Graça de Jesus Mendes. Física: Anderson Jacomini Brandão, Carolina dos Santos Batista, Fábio Bresighello Beig, Renata Cristina de Andrade Oliveira e Tatiana Souza da Luz Stroeymeyte. Química: Ana Joaquina Simões S. de Mattos Carvalho, Jeronimo da Silva Barbosa Filho, João Batista Santos Junior, Natalina de Fátima Mateus e Roseli Gomes de Araujo da Silva. Área de Ciências Humanas Filosofia: Emerson Costa, Tânia Gonçalves e Teônia de Abreu Ferreira. Geografia: Andréia Cristina Barroso Cardoso, Débora Regina Aversan e Sérgio Luiz Damiati. História: Cynthia Moreira Marcucci, Maria Margarete dos Santos Benedicto e Walter Nicolas Otheguy Fernandez. Sociologia: Alan Vitor Corrêa, Carlos Fernando de Almeida e Tony Shigueki Nakatani. PROFESSORES COORDENADORES DO NÚCLEO PEDAGÓGICO Área de Linguagens Educação Física: Ana Lucia Steidle, Eliana Cristine Budiski de Lima, Fabiana Oliveira da Silva, Isabel Cristina Albergoni, Karina Xavier, Katia Mendes e Silva, Liliane Renata Tank Gullo, Marcia Magali Rodrigues dos Santos, Mônica Antonia Cucatto da Silva, Patrícia Pinto Santiago, Regina Maria Lopes, Sandra Pereira Mendes, Sebastiana Gonçalves Ferreira Viscardi, Silvana Alves Muniz. Língua Estrangeira Moderna (Inglês): Célia Regina Teixeira da Costa, Cleide Antunes Silva, Ednéa Boso, Edney Couto de Souza, Elana Simone Schiavo Caramano, Eliane Graciela dos Santos Santana, Elisabeth Pacheco Lomba Kozokoski, Fabiola Maciel Saldão, Isabel Cristina dos Santos Dias, Juliana Munhoz dos Santos, Kátia Vitorian Gellers, Lídia Maria Batista Bomfim, Lindomar Alves de Oliveira, Lúcia Aparecida Arantes, Mauro Celso de Souza, Neusa A. Abrunhosa Tápias, Patrícia Helena Passos, Renata Motta Chicoli Belchior, Renato José de Souza, Sandra Regina Teixeira Batista de Campos e Silmara Santade Masiero. Língua Portuguesa: Andrea Righeto, Edilene Bachega R. Viveiros, Eliane Cristina Gonçalves Ramos, Graciana B. Ignacio Cunha, Letícia M. de Barros L. Viviani, Luciana de Paula Diniz, Márcia Regina Xavier Gardenal, Maria Cristina Cunha Riondet Costa, Maria José de Miranda Nascimento, Maria Márcia Zamprônio Pedroso, Patrícia Fernanda Morande Roveri, Ronaldo Cesar Alexandre Formici, Selma Rodrigues e Sílvia Regina Peres. Área de Matemática Matemática: Carlos Alexandre Emídio, Clóvis Antonio de Lima, Delizabeth Evanir Malavazzi, Edinei Pereira de Sousa, Eduardo Granado Garcia, Evaristo Glória, Everaldo José Machado de Lima, Fabio Augusto Trevisan, Inês Chiarelli Dias, Ivan Castilho, José Maria Sales Júnior, Luciana Moraes Funada, Luciana Vanessa de Almeida Buranello, Mário José Pagotto, Paula Pereira Guanais, Regina Helena de Oliveira Rodrigues, Robson Rossi, Rodrigo Soares de Sá, Rosana Jorge Monteiro, Rosângela Teodoro Gonçalves, Roseli Soares Jacomini, Silvia Ignês Peruquetti Bortolatto e Zilda Meira de Aguiar Gomes. Área de Ciências da Natureza Biologia: Aureli Martins Sartori de Toledo, Evandro Rodrigues Vargas Silvério, Fernanda Rezende Pedroza, Regiani Braguim Chioderoli e Rosimara Santana da Silva Alves. Ciências: Davi Andrade Pacheco, Franklin Julio de Melo, Liamara P. Rocha da Silva, Marceline de Lima, Paulo Garcez Fernandes, Paulo Roberto Orlandi Valdastri, Rosimeire da Cunha e Wilson Luís Prati. Física: Ana Claudia Cossini Martins, Ana Paula Vieira Costa, André Henrique Ghelfi Rufino, Cristiane Gislene Bezerra, Fabiana Hernandes M. Garcia, Leandro dos Reis Marques, Marcio Bortoletto Fessel, Marta Ferreira Mafra, Rafael Plana Simões e Rui Buosi. Química: Armenak Bolean, Cátia Lunardi, Cirila Tacconi, Daniel B. Nascimento, Elizandra C. S. Lopes, Gerson N. Silva, Idma A. C. Ferreira, Laura C. A. Xavier, Marcos Antônio Gimenes, Massuko S. Warigoda, Roza K. Morikawa, Sílvia H. M. Fernandes, Valdir P. Berti e Willian G. Jesus. Área de Ciências Humanas Filosofia: Álex Roberto Genelhu Soares, Anderson Gomes de Paiva, Anderson Luiz Pereira, Claudio Nitsch Medeiros e José Aparecido Vidal. Geografia: Ana Helena Veneziani Vitor, Célio Batista da Silva, Edison Luiz Barbosa de Souza, Edivaldo Bezerra Viana, Elizete Buranello Perez, Márcio Luiz Verni, Milton Paulo dos Santos, Mônica Estevan, Regina Célia Batista, Rita de Cássia Araujo, Rosinei Aparecida Ribeiro Libório, Sandra Raquel Scassola Dias, Selma Marli Trivellato e Sonia Maria M. Romano. História: Aparecida de Fátima dos Santos Pereira, Carla Flaitt Valentini, Claudia Elisabete Silva, Cristiane Gonçalves de Campos, Cristina de Lima Cardoso Leme, Ellen Claudia Cardoso Doretto, Ester Galesi Gryga, Karin Sant’Ana Kossling, Marcia Aparecida Ferrari Salgado de Barros, Mercia Albertina de Lima Camargo, Priscila Lourenço, Rogerio Sicchieri, Sandra Maria Fodra e Walter Garcia de Carvalho Vilas Boas. Sociologia: Anselmo Luis Fernandes Gonçalves, Celso Francisco do Ó, Lucila Conceição Pereira e Tânia Fetchir. Apoio: Fundação para o Desenvolvimento da Educação - FDE CTP, Impressão e acabamento Plural Indústria Gráfica Ltda.