SlideShare uma empresa Scribd logo
1 de 15
Baixar para ler offline
GABARITO                       Caderno do Aluno                 Biologia – 2a série – Volume 3




 SITUAÇÃO DE APRENDIZAGEM 1

 A ESTRUTURA DO DNA




Para começo de conversa

Página 3
• Espera-se que os alunos abordem temas relacionados a exames de paternidade,
   genética forense e material genético.



  Leitura e Análise de Imagem


Página 3
1. A imagem é formada com várias fotografias de seres humanos.
2. Um significado possível é que todos os seres humanos compartilham um mesmo tipo
   de DNA. O significado biológico será apresentado em outro momento, mas, para
   uma primeira aproximação, essa interpretação é suficiente.
3. O formato da molécula de DNA, que é semelhante a uma “escada” retorcida.



  Leitura e Análise de Texto


Página 5
1. A canção retrata a relação de um pai com sua filha, Daniela. Os versos a seguir
   reforçam essa ideia: “Quando você nasceu ouvi seu grito”; “Não me sentir capaz de
   ser seu pai”.
2. Esse elo é o DNA.
3. As palavras são: DANça ; oNDA; NADa; DNA; DANiela.
4. As letras se alternam, da mesma forma que os componentes do DNA se alternam ao
   longo da molécula.


                                                                                            1
GABARITO                      Caderno do Aluno                 Biologia – 2a série – Volume 3




     LIÇÃO DE CASA


Página 8
• Só são formados pares entre cores específicas, como ocorre entre as bases
     nitrogenadas.



     VOCÊ APRENDEU?


Página 8
1. Alternativa e.
2. Alternativa a.
3. Alternativa c.
4.
     a) Os “corrimãos” correspondem a uma sucessão alternada de fosfato e
     desoxirribose (açúcar). Os “degraus” são constituídos por pares de bases
     nitrogenadas, unidas por ligações de hidrogênio, onde adenina pareia com timina, e
     citosina com guanina.
     b) A molécula de DNA contém genes que codificam as proteínas. Primeiramente, a
     informação contida nos genes é transcrita para uma molécula de RNA mensageiro,
     que será lido pelos ribossomos no citoplasma. Ao ler os RNAm, os ribossomos
     sintetizam cadeias de aminoácidos (proteínas), cuja sequência é determinada pela
     sequência de nucleotídeos do RNAm.
     c) Duas proteínas podem ser diferenciadas por suas sequências de aminoácidos.
     Outra diferença diz respeito às suas estruturas tridimensionais, que definirão suas
     funções. A estrutura tridimensional de uma proteína depende da sequência de seus
     aminoácidos.




                                                                                           2
GABARITO                      Caderno do Aluno               Biologia – 2a série – Volume 3




 SITUAÇÃO DE APRENDIZAGEM 2

 A DUPLICAÇÃO DO DNA




Para começo de conversa

Página 10
1. Durante a mitose, a quantidade de DNA da célula duplicada durante a interfase está
   se dividindo para originar as duas células-filhas.
2. A quantidade de DNA duplicou, passou de C para 2 C.
3. Começa com C e acaba com o mesmo valor, C. Isso mostra que durante a mitose são
   formadas novas células com a mesma quantidade de DNA da célula original.


A duplicação do DNA

Página 11
1. Não se espera que o aluno produza uma resposta elaborada sobre a replicação do
   DNA. No entanto, seria muito salutar que ele pudesse estabelecer alguma relação
   entre o pareamento de bases (pares A/T e C/G) e o processo de replicação.
2. Neste momento, não são esperadas respostas elaboradas e explicações corretas e
   detalhadas às questões, pois os alunos ainda não têm elementos para construí-las.
   Entretanto, as respostas dadas serão muito úteis para relacionar o conhecimento
   prévio dos alunos e direcionar suas explicações.


Atividade coletiva: simulando a replicação do DNA

Página 12

      Espera-se que os alunos descrevam os passos de formação de novas moléculas de
DNA de acordo com a formação das novas fileiras.



                                                                                         3
GABARITO                     Caderno do Aluno                 Biologia – 2a série – Volume 3



       Espera-se que eles compreendam que o processo de replicação do DNA ocorre
pela adição de novos nucleotídeos (alunos) à cadeia em formação (fileira). Essa adição é
feita tendo como molde a fita antiga de DNA. O que realiza o processo de leitura da fita
antiga e construção da nova fita é a enzima DNA polimerase.

1. Espera-se que aqui os alunos possam relacionar o período “S” da mitose com a
     dramatização que acabaram de realizar e que o aumento na quantidade de DNA (de
     C para 2C) deve-se à duplicação do DNA.
2.




       No esquema, a relação entre fita de DNA e fileira de carteiras é que cada
sequência de alunos corresponde a uma cadeia da molécula de DNA e o pareamento
entre os alunos corresponde ao pareamento de bases entre as duas cadeias
complementares do DNA. Uma molécula de DNA com duas cadeias abre-se e gera dois
moldes. Paralelamente, a cada molde irá se formar uma nova fita complementar (de
acordo com o pareamento AT e CG) e ao término haverá duas moléculas de DNA iguais

                                                                                          4
GABARITO                     Caderno do Aluno                 Biologia – 2a série – Volume 3



entre si. Esse processo de replicação é denominado semiconservativo, pois as moléculas
novas apresentam uma fita nova e outra antiga.



    LIÇÃO DE CASA


Página 14
    O aluno deverá estruturar um texto que mostre o processo de replicação do DNA. É
importante que esse texto apresente a estrutura da molécula e ressalte o fenômeno da
complementaridade entre as bases nitrogenadas. A seguir, o texto deve mostrar como
esse fenômeno possibilita a replicação – cada uma das fitas da molécula de DNA
servindo de molde para a síntese de duas novas fitas.



    PESQUISA INDIVIDUAL


Página 14
• O aluno deve compreender que o papel da enzima é utilizar nucleotídeos livres
    obtidos, por exemplo, por meio da alimentação e incorporá-los às fitas de DNA que
    estão sendo construídas. É importante que o aluno compreenda que a enzima DNA
    polimerase é dependente de molde, ou seja, ela produz uma nova fita tendo outra por
    molde. Além disso, o aluno deve construir a ideia de que a replicação deve começar
    em vários pontos ao longo da molécula de DNA.

•

            Espécie    Número de dias
                              61
            Jiboia
                              90
       Ser humano
                             269
        Gafanhoto
                             521
            Cebola
                             4 630
       Salamandra
                            19 387
            Ameba
                                                                                          5
GABARITO                   Caderno do Aluno               Biologia – 2a série – Volume 3




• Hipótese: é esperado que os alunos consigam perceber que a velocidade apresentada
  corresponde à de uma molécula de proteína, mas muitas moléculas de proteínas
  podem atuar simultaneamente, diminuindo o tempo necessário para duplicar o DNA
  de uma célula.




                                                                                      6
GABARITO                           Caderno do Aluno                  Biologia – 2a série – Volume 3




     SITUAÇÃO DE APRENDIZAGEM 3

     DO DNA À PROTEÍNA



     VOCÊ APRENDEU?


Página 16
1. Alternativa d.
2. Alternativa c.
3. Alternativa b.
4. Uma reta sem as fases S, G2 e M, pois, se a célula não se multiplica, ela não
     duplicará seu DNA.
5.
     a) No tubo B, a densidade é intermediária devido à presença do isótopo normal e
     do isótopo pesado, dada a característica da duplicação do DNA ser semiconservativa,
     ou seja, uma fita antiga servir de molde para a fita nova.
     b) Na faixa superior também há X de DNA, com densidade menor (isótopo
     normal).


Página 19

                                                                    DNA                        RNA
1. Qual é o significado da sigla?                                   Ácido
                                                                                        Ácido ribonucleico
                                                          desoxirribonucleico
2. O nucleotídio deste ácido nucleico é formado por
                                                             Desoxirribose                    Ribose
     qual tipo de açúcar?

3. Quais são as bases nitrogenadas que podem                Adenina, timina,            Adenina, uracila,
     formar um nucleotídio deste ácido nucleico?            guanina, citosina           guanina, citosina

4. A molécula deste ácido nucleico é formada por
                                                                  Dupla-fita               Fita simples
     fita simples ou dupla-fita?


                                                                                                 7
GABARITO                       Caderno do Aluno                 Biologia – 2a série – Volume 3




5. Quais podem ser as funções desempenhadas por         “Armazenar” a           Traduzir a informação
   moléculas deste ácido nucleico?                    informação genética        genética em proteína

6. Em uma célula humana, onde podemos encontrar          No núcleo (e                No núcleo e no
   as moléculas deste ácido nucleico?                     também na            citoplasma (e também na
                                                         mitocôndria)                 mitocôndria)


• Pode ser que alguns alunos interpretem a ideia de que os RNAs mensageiros trazem
   a informação do núcleo da célula para o citoplasma; porém, normalmente, o termo
   “mensageiro” suscita várias interpretações dos alunos, alguns acham que deve ser o
   próprio gene, outros acham que o RNA é quem copia a mensagem, e não que seja
   uma cópia da mensagem (do gene).



  Leitura e Análise de Texto


Página 20
1. Lembranças de um RNA mensageiro é um texto narrado pelo próprio RNA
   mensageiro. Nele, o narrador descreve um período de sua vida até o momento de sua
   “morte”.
2. RNA mensageiro, RNA transportador e RNA ribossômico. O RNA mensageiro é um
   molde do DNA que leva a informação do DNA até o ribossomo. O RNA
   transportador identifica sequências do RNA mensageiro e libera o aminoácido
   correspondente no ribossomo. O RNA ribossômico forma o ribosso, estrutura
   responsável pela ligação entre o RNA mensageiro e o RNA transportador, além da
   reunião dos aminoácidos.
3. AUG.
4. No núcleo.
5. No citoplasma.
6. Ao RNA mensageiro e ao ribossomo.
7. Na sequência UAG.
8. Podemos substituí-lo por “polipeptídio” ou por “proteína”.



                                                                                            8
GABARITO                       Caderno do Aluno                Biologia – 2a série – Volume 3



9. O texto deve conter todas as etapas descritas que ocorrem no citoplasma, tendo como
   narrador o ribossomo.


Decifrando o código genético

Página 22
1. Espera-se que o aluno relacione código a uma linguagem cifrada com símbolos que
   permitem escrever ou representar algum tipo de informação.
2. Há um equívoco muito comum entre os alunos, e também na mídia, de considerar
   código genético como sinônimo de DNA ou de genoma. Por isso, caso isso ocorra,
   não é preciso conceituar precisamente neste momento; porém, é bom chamar a
   atenção dos alunos para o fato.
3. Da bactéria Xylella, causadora do amarelinho em plantas cítricas, laranja.
4. É uma doença que acomete as plantas de laranja e que é causada por uma bactéria.
5. Projeto científico com o objetivo de mapear o DNA, genoma, da bactéria Xylella.
6. No caso, o genoma da Xylella é o conjunto de informações genéticas contido no
   DNA da bactéria e que define suas características biológicas.



  Aprendendo a Aprender


Página 23
• Códon: trinca de nucleotídeos presente no RNA mensageiro que codifica um
   aminoácido na proteína.



  Leitura e Análise de Texto


Página 24
1. A sequência de bases nitrogenadas do DNA humano, chamada de genoma humano, é
   confundida com a expressão “código genético” da espécie. Esse sequenciamento do
   genoma humano foi finalizado por volta do ano 2000. Dessa forma, a manchete



                                                                                           9
GABARITO                        Caderno do Aluno                    Biologia – 2a série – Volume 3



     apresentada contém um erro conceitual muito comum em alguns noticiários sobre
     Ciência.
2.
     a) AUG.
     b) Metionina, lisina, glicina.
3. Esse é um códon de parada e define quando a síntese da proteína, adição de novos
     aminoácidos, se encerra.
4. UGA, UAA.
5. Arginina – CGU, CGC, CGA, CGG; triptofano – UGG.
6. Que o código genético é degenerado, ou seja, existe mais de um códon para codificar
     o mesmo aminoácido.
7. Dizer que o código genético é universal significa dizer que essa relação entre códons
     e aminoácidos é encontrada em todos os seres vivos. Ou seja, tanto em seres
     humanos como em insetos ou plantas, a tradução de uma informação genética em
     proteína obedece ao mesmo código.
8.

                                      De DNA a Proteína
Fita do DNA a ser transcrita     TAC GGA GTA GCT ATA ATT

RNA mensageiro                                AUG CCU CAU CGA UAU UAA

Proteína                                           met – pro – his – arg – tyr




     VOCÊ APRENDEU?


Página 25
1. Alternativa c.
2. Alternativa c.
3. Não. De acordo com o código genético, diferentes trincas de nucleotídeos podem
     especificar o mesmo aminoácido.



                                                                                               10
GABARITO                           Caderno do Aluno            Biologia – 2a série – Volume 3



4.
     a) AUG AGU UGG CCU G
     b) Serina – triptofano – prolina
     c) Metionina – serina – glicina



     Aprendendo a Aprender


Página 28
1. Resposta esperada: valina – histidina – leucina – treonina – prolina – ácido glutâmico
     – ácido glutâmico – lisina.
2. Resposta esperada: apesar da mutação, não haverá alteração na proteína, porque tanto
     o códon CAC como o CTC codificam para o mesmo aminoácido – valina.
3. Resposta esperada: nesse caso, a mutação produz um códon que codifica um
     aminoácido diferente – metionina. Por isso, haverá mudança na proteína.
4.
     a) Resposta esperada: nesse caso, a primeira mutação causará a produção de um
     códon de parada e, portanto, os aminoácidos subsequentes não serão adicionados na
     proteína.
     b) A segunda mutação acarretará a reorganização de todos os códons a partir da
     mutação (…CAC – GTG – ACT – GAG – GAC – TCC – TCT – TC…), sendo que a
     terceira trinca (ACT) codifica um códon de parada.
5. É esperado que os alunos encontrem alguns exemplos de mutações relacionadas à
     anemia falciforme. O exemplo mais comum é a mutação pontual no gene beta-
     globina. Esse tipo de hemoglobina é chamado de hemoglobina S.




                                                                                          11
GABARITO                       Caderno do Aluno                 Biologia – 2a série – Volume 3




 SITUAÇÃO DE APRENDIZAGEM 4

 DO DNA À CARACTERÍSTICA




Para começo de conversa

Página 29
• Espera-se que os alunos retomem e relacionem os conceitos anteriormente
   trabalhados relacionados aos genes como instruções hereditárias das células. Solicite
   que os alunos prestem especial atenção na relação entre os genes e a manifestação
   das características.



  Leitura e Análise de Texto


Página 31
1. É uma proteína com função metabólica, controla determinada reação química. No
   caso da enzima SBE-1, ela controla a adição de novas moléculas de glicose nas
   ramificações do amido.
2. As células dos cotilédones podem armazenar mais ou menos água ao longo de seu
   desenvolvimento, dependendo do teor de amido ramificado. Cotilédones com muito
   amido não ramificado acumulam mais água e, quando secam, ficam com aspecto
   enrugado. Já os cotilédones com muito amido ramificado acumulam pouca água ao
   longo do desenvolvimento e, quando secam, perdem pouca água e permanecem com
   o volume praticamente inalterado, mantendo-se lisos.
3. Fita complementar de DNA:
   semente lisa: atgagatacttggagcaatttcatgatttgtga;
   semente rugosa: atgagatacttggagcaatttcatgatttatctttttgaaa.
4. RNA mensageiro:
   semente lisa: augagauacuuggagcaauuucaugauuuguga;
   semente rugosa: augagauacuuggagcaauuucaugauuuaucuuuuugaaa.
                                                                                           12
GABARITO                        Caderno do Aluno                  Biologia – 2a série – Volume 3




5.

                         Sequência de aminoácidos                    Proteína          Resposta
              met-arg-tyr-leu-glu-gln-phe-his-asp-leu                I               Semente lisa

              met-arg-tyr-leu-glu-gln-phe-his-asp-his                II

              met-arg-tyr-leu-glu-gln-phe-his-asp-leu-his            III

              met-arg-tyr-leu-glu-gln-phe-his-asp-leu-ser            IV

              met-arg-tyr-leu-glu-gln-phe-his-asp-leu-ser-phe        V             Semente rugosa



6.
     a)
          •      É a sequência de aminoácidos que compõe uma proteína.
          •      Representa a existência de diferentes domínios, regiões, na estrutura de
                 uma proteína, com formatos importantes para a função que a proteína
                 desempenha.
          •      É o formato final de uma proteína e está diretamente associado à função
                 que a proteína executa.
     b) tactctatgaacctcgttaaagtactaaatagaaaaacttt.


     c) tactctatgaacctcgttaaagtactaaacact.
7. O alelo R (codifica a proteína I) e o alelo r (codifica a proteína V).
8. Não, pois um tipo possui uma cópia do alelo R, e o outro, duas. Além disso, a ervilha
     heterozigota deve produzir cerca de metade de suas moléculas de amido com
     ramificações e a outra metade sem ramificações, enquanto a ervilha homozigota
     (RR) deve produzir apenas amido com ramificações.



     VOCÊ APRENDEU?


Página 37
1. Alternativa b.
                                                                                             13
GABARITO                      Caderno do Aluno                 Biologia – 2a série – Volume 3




2. Alternativa a.
3. Alternativa a.
4.
     a) Gene é um segmento do DNA localizado nos cromossomos. Possui um código
     químico representado por sequências de bases nitrogenadas (adenina, guanina,
     citosina e timina). Cada trinca de bases é capaz de codificar um aminoácido de uma
     proteína. A sequência de trincas determinará a sequência dos aminoácidos de um
     polipeptídeo.
     b)   Mutações são modificações na sequência ou na composição das bases do DNA
     (gene), que podem causar a produção de uma proteína alterada ou mesmo a não
     produção da proteína.
     c) A substituição de uma base nitrogenada no DNA pode não causar nenhuma
     alteração na proteína produzida pela célula porque o código genético é degenerado,
     ou seja, um mesmo aminoácido pode ser codificado por diferentes trincas de bases.
5.
     a)
          •     Proteína normal: Val – Leu – Tre – Pro – Tir – Val – Lis
          •     Indivíduo A: Val – Leu – Tre – Pro
          •     Indivíduo B: Val – Leu – Tre – Pro – Tir – Val – Lis
          •     Indivíduo C: Val – Met – Tre – Pro – Tir – Val – Lis


     b) A é afetado porque produz uma proteína menor. B é normal, apesar da
     substituição de uma base nitrogenada em seu DNA, porque o código genético é
     degenerado. C é afetado porque possui um aminoácido diferente em sua proteína.




                                                                                          14
GABARITO                     Caderno do Aluno                Biologia – 2a série – Volume 3




  Aprendendo a Aprender


Página 39

   Espera-se que os alunos possam relacionar o papel fundamental das proteínas na
organização e no funcionamento das células e dos seres vivos com os processos
moleculares envolvendo as informações genéticas: replicação, transcrição e tradução.




                                                                                        15

Mais conteúdo relacionado

Mais procurados

Biologia geologia 11
Biologia geologia 11Biologia geologia 11
Biologia geologia 11João Soares
 
Crescimento e renovação celular
Crescimento e renovação celularCrescimento e renovação celular
Crescimento e renovação celularCecilferreira
 
PhD Thesis of Rafael Cossiello
PhD Thesis of Rafael CossielloPhD Thesis of Rafael Cossiello
PhD Thesis of Rafael CossielloRafael Cossiello
 
Ficha de Trabalho nr 5 - Unidade 5
Ficha de Trabalho nr 5 - Unidade 5Ficha de Trabalho nr 5 - Unidade 5
Ficha de Trabalho nr 5 - Unidade 5Isaura Mourão
 
Teste 5 de novembro revisto
Teste 5 de novembro revistoTeste 5 de novembro revisto
Teste 5 de novembro revistoEstela Costa
 
Ppt 8 Aula PráTica
Ppt 8   Aula PráTicaPpt 8   Aula PráTica
Ppt 8 Aula PráTicaNuno Correia
 
Ficha de Trabalho nr 5 - Unidade 5 (soluções)
Ficha de Trabalho nr 5 - Unidade 5 (soluções)Ficha de Trabalho nr 5 - Unidade 5 (soluções)
Ficha de Trabalho nr 5 - Unidade 5 (soluções)Isaura Mourão
 
BioGeo11-estrutura adn
BioGeo11-estrutura adnBioGeo11-estrutura adn
BioGeo11-estrutura adnRita Rainho
 
Bg 6 a estrutura da molécula de dna
Bg 6   a estrutura da molécula de dnaBg 6   a estrutura da molécula de dna
Bg 6 a estrutura da molécula de dnaNuno Correia
 
Ficha de Trabalho nr 4 - Experiência de Meselson e Stahl (correcção)
Ficha de Trabalho nr 4 - Experiência de Meselson e Stahl (correcção)Ficha de Trabalho nr 4 - Experiência de Meselson e Stahl (correcção)
Ficha de Trabalho nr 4 - Experiência de Meselson e Stahl (correcção)Isaura Mourão
 
Biologia 11 preparação para exame 1
Biologia 11   preparação para exame 1Biologia 11   preparação para exame 1
Biologia 11 preparação para exame 1Nuno Correia
 
Teste BG - Síntese Proteica
Teste BG - Síntese ProteicaTeste BG - Síntese Proteica
Teste BG - Síntese ProteicaJosé Luís Alves
 
25268324 resumos-de-biologia-de-11âº-ano
25268324 resumos-de-biologia-de-11âº-ano25268324 resumos-de-biologia-de-11âº-ano
25268324 resumos-de-biologia-de-11âº-anoRita_Brito
 
Plano de luzia alterado 10
Plano de luzia alterado 10Plano de luzia alterado 10
Plano de luzia alterado 10luziabiologa2010
 
Bgpt 1 modelos de dna
Bgpt 1   modelos de dnaBgpt 1   modelos de dna
Bgpt 1 modelos de dnaNuno Correia
 
1o teste pratico_v1prof-15-16 (1)
1o teste pratico_v1prof-15-16 (1)1o teste pratico_v1prof-15-16 (1)
1o teste pratico_v1prof-15-16 (1)ecolealcamara
 

Mais procurados (20)

Recurso
RecursoRecurso
Recurso
 
Biologia geologia 11
Biologia geologia 11Biologia geologia 11
Biologia geologia 11
 
Plano ii luciana
Plano  ii   lucianaPlano  ii   luciana
Plano ii luciana
 
Crescimento e renovação celular
Crescimento e renovação celularCrescimento e renovação celular
Crescimento e renovação celular
 
Td 05 bio i síntese proteica
Td 05 bio i síntese proteicaTd 05 bio i síntese proteica
Td 05 bio i síntese proteica
 
PhD Thesis of Rafael Cossiello
PhD Thesis of Rafael CossielloPhD Thesis of Rafael Cossiello
PhD Thesis of Rafael Cossiello
 
Ficha de Trabalho nr 5 - Unidade 5
Ficha de Trabalho nr 5 - Unidade 5Ficha de Trabalho nr 5 - Unidade 5
Ficha de Trabalho nr 5 - Unidade 5
 
Teste 5 de novembro revisto
Teste 5 de novembro revistoTeste 5 de novembro revisto
Teste 5 de novembro revisto
 
Ppt 8 Aula PráTica
Ppt 8   Aula PráTicaPpt 8   Aula PráTica
Ppt 8 Aula PráTica
 
Ficha de Trabalho nr 5 - Unidade 5 (soluções)
Ficha de Trabalho nr 5 - Unidade 5 (soluções)Ficha de Trabalho nr 5 - Unidade 5 (soluções)
Ficha de Trabalho nr 5 - Unidade 5 (soluções)
 
BioGeo11-estrutura adn
BioGeo11-estrutura adnBioGeo11-estrutura adn
BioGeo11-estrutura adn
 
Bg 6 a estrutura da molécula de dna
Bg 6   a estrutura da molécula de dnaBg 6   a estrutura da molécula de dna
Bg 6 a estrutura da molécula de dna
 
Ficha de Trabalho nr 4 - Experiência de Meselson e Stahl (correcção)
Ficha de Trabalho nr 4 - Experiência de Meselson e Stahl (correcção)Ficha de Trabalho nr 4 - Experiência de Meselson e Stahl (correcção)
Ficha de Trabalho nr 4 - Experiência de Meselson e Stahl (correcção)
 
Biologia 11 preparação para exame 1
Biologia 11   preparação para exame 1Biologia 11   preparação para exame 1
Biologia 11 preparação para exame 1
 
Plano aula 9
Plano aula 9Plano aula 9
Plano aula 9
 
Teste BG - Síntese Proteica
Teste BG - Síntese ProteicaTeste BG - Síntese Proteica
Teste BG - Síntese Proteica
 
25268324 resumos-de-biologia-de-11âº-ano
25268324 resumos-de-biologia-de-11âº-ano25268324 resumos-de-biologia-de-11âº-ano
25268324 resumos-de-biologia-de-11âº-ano
 
Plano de luzia alterado 10
Plano de luzia alterado 10Plano de luzia alterado 10
Plano de luzia alterado 10
 
Bgpt 1 modelos de dna
Bgpt 1   modelos de dnaBgpt 1   modelos de dna
Bgpt 1 modelos de dna
 
1o teste pratico_v1prof-15-16 (1)
1o teste pratico_v1prof-15-16 (1)1o teste pratico_v1prof-15-16 (1)
1o teste pratico_v1prof-15-16 (1)
 

Semelhante a 2009 Volume3 C A D E R N O D O A L U N O B I O L O G I A Ensino Medio 2aserie Gabarito

Crescimento
 Crescimento Crescimento
Crescimento vhnkxv
 
Ácidos Nucleicos
Ácidos NucleicosÁcidos Nucleicos
Ácidos NucleicosURCA
 
Crescimento e Renovação Celular, Biologia // 11º ano
Crescimento e Renovação Celular, Biologia // 11º anoCrescimento e Renovação Celular, Biologia // 11º ano
Crescimento e Renovação Celular, Biologia // 11º anoAna Mestre
 
Telecurso 2000 aula 49 as bactérias operárias
Telecurso 2000 aula 49   as bactérias operáriasTelecurso 2000 aula 49   as bactérias operárias
Telecurso 2000 aula 49 as bactérias operáriasnetoalvirubro
 
aula Acidos Nucleicos - Duplicacao do DNA e Sintese Proteica.ppt
aula Acidos Nucleicos - Duplicacao do DNA e Sintese Proteica.pptaula Acidos Nucleicos - Duplicacao do DNA e Sintese Proteica.ppt
aula Acidos Nucleicos - Duplicacao do DNA e Sintese Proteica.pptJoseAugustoAragao
 
aula Acidos Nucleicos - Duplicacao do DNA e Sintese Proteica.ppt
aula Acidos Nucleicos - Duplicacao do DNA e Sintese Proteica.pptaula Acidos Nucleicos - Duplicacao do DNA e Sintese Proteica.ppt
aula Acidos Nucleicos - Duplicacao do DNA e Sintese Proteica.pptJoseAugustoAragao
 
Aula estrutura e_replicacao_do_dna_christian
Aula estrutura e_replicacao_do_dna_christianAula estrutura e_replicacao_do_dna_christian
Aula estrutura e_replicacao_do_dna_christianAndressa Souza
 
Questoes para 1 s respondidas
Questoes para 1 s respondidasQuestoes para 1 s respondidas
Questoes para 1 s respondidasCotucaAmbiental
 
Ácidos Nucléicos
Ácidos NucléicosÁcidos Nucléicos
Ácidos NucléicosBIOGERALDO
 
Código Genético e Síntese Proteica
Código Genético e Síntese ProteicaCódigo Genético e Síntese Proteica
Código Genético e Síntese Proteicaguestdb5b7a
 
Replicacao
ReplicacaoReplicacao
Replicacaocrysboy
 
(1) crescimento, renovação celular e reprodução
(1) crescimento, renovação celular e reprodução(1) crescimento, renovação celular e reprodução
(1) crescimento, renovação celular e reproduçãoHugo Martins
 
Unid. 6 - GENÉTICA - Tema 1 - Bases da Genética - 9º ano.pptx
Unid. 6 - GENÉTICA - Tema 1 - Bases da Genética - 9º ano.pptxUnid. 6 - GENÉTICA - Tema 1 - Bases da Genética - 9º ano.pptx
Unid. 6 - GENÉTICA - Tema 1 - Bases da Genética - 9º ano.pptxHellendosAnjos
 
Replicação de DNA.pptx
Replicação de DNA.pptxReplicação de DNA.pptx
Replicação de DNA.pptxNivaldoJnior16
 

Semelhante a 2009 Volume3 C A D E R N O D O A L U N O B I O L O G I A Ensino Medio 2aserie Gabarito (20)

Crescimento
 Crescimento Crescimento
Crescimento
 
Questoes para 1 s respondidas
Questoes para 1 s respondidasQuestoes para 1 s respondidas
Questoes para 1 s respondidas
 
ReplicaçãO Do Dna
ReplicaçãO Do DnaReplicaçãO Do Dna
ReplicaçãO Do Dna
 
Ácidos Nucleicos
Ácidos NucleicosÁcidos Nucleicos
Ácidos Nucleicos
 
Crescimento e Renovação Celular, Biologia // 11º ano
Crescimento e Renovação Celular, Biologia // 11º anoCrescimento e Renovação Celular, Biologia // 11º ano
Crescimento e Renovação Celular, Biologia // 11º ano
 
áCidos nucleicos
áCidos nucleicosáCidos nucleicos
áCidos nucleicos
 
Telecurso 2000 aula 49 as bactérias operárias
Telecurso 2000 aula 49   as bactérias operáriasTelecurso 2000 aula 49   as bactérias operárias
Telecurso 2000 aula 49 as bactérias operárias
 
aula Acidos Nucleicos - Duplicacao do DNA e Sintese Proteica.ppt
aula Acidos Nucleicos - Duplicacao do DNA e Sintese Proteica.pptaula Acidos Nucleicos - Duplicacao do DNA e Sintese Proteica.ppt
aula Acidos Nucleicos - Duplicacao do DNA e Sintese Proteica.ppt
 
aula Acidos Nucleicos - Duplicacao do DNA e Sintese Proteica.ppt
aula Acidos Nucleicos - Duplicacao do DNA e Sintese Proteica.pptaula Acidos Nucleicos - Duplicacao do DNA e Sintese Proteica.ppt
aula Acidos Nucleicos - Duplicacao do DNA e Sintese Proteica.ppt
 
Aula estrutura e_replicacao_do_dna_christian
Aula estrutura e_replicacao_do_dna_christianAula estrutura e_replicacao_do_dna_christian
Aula estrutura e_replicacao_do_dna_christian
 
Questoes para 1 s respondidas
Questoes para 1 s respondidasQuestoes para 1 s respondidas
Questoes para 1 s respondidas
 
áCidos nucleicos dna e rna
áCidos nucleicos  dna e rnaáCidos nucleicos  dna e rna
áCidos nucleicos dna e rna
 
Ácidos Nucléicos
Ácidos NucléicosÁcidos Nucléicos
Ácidos Nucléicos
 
Código Genético e Síntese Proteica
Código Genético e Síntese ProteicaCódigo Genético e Síntese Proteica
Código Genético e Síntese Proteica
 
GenéTico e Síntese Proteica
GenéTico e Síntese ProteicaGenéTico e Síntese Proteica
GenéTico e Síntese Proteica
 
Disciplinas enem 2012
Disciplinas enem 2012Disciplinas enem 2012
Disciplinas enem 2012
 
Replicacao
ReplicacaoReplicacao
Replicacao
 
(1) crescimento, renovação celular e reprodução
(1) crescimento, renovação celular e reprodução(1) crescimento, renovação celular e reprodução
(1) crescimento, renovação celular e reprodução
 
Unid. 6 - GENÉTICA - Tema 1 - Bases da Genética - 9º ano.pptx
Unid. 6 - GENÉTICA - Tema 1 - Bases da Genética - 9º ano.pptxUnid. 6 - GENÉTICA - Tema 1 - Bases da Genética - 9º ano.pptx
Unid. 6 - GENÉTICA - Tema 1 - Bases da Genética - 9º ano.pptx
 
Replicação de DNA.pptx
Replicação de DNA.pptxReplicação de DNA.pptx
Replicação de DNA.pptx
 

Mais de BIOLOGO TOTAL

2009 Volume3 C A D E R N O D O A L U N O B I O L O G I A Ensino Medio 1ase...
2009 Volume3  C A D E R N O D O A L U N O  B I O L O G I A  Ensino Medio 1ase...2009 Volume3  C A D E R N O D O A L U N O  B I O L O G I A  Ensino Medio 1ase...
2009 Volume3 C A D E R N O D O A L U N O B I O L O G I A Ensino Medio 1ase...BIOLOGO TOTAL
 
2009 Volume3 Cadernodoaluno Biologia Ensino Medio 3aserie Gabarito[1]
2009 Volume3 Cadernodoaluno Biologia Ensino Medio 3aserie Gabarito[1]2009 Volume3 Cadernodoaluno Biologia Ensino Medio 3aserie Gabarito[1]
2009 Volume3 Cadernodoaluno Biologia Ensino Medio 3aserie Gabarito[1]BIOLOGO TOTAL
 
Simulado Enem 2009 CiêNcias Da Natureza 30 07 09
Simulado Enem 2009 CiêNcias Da Natureza 30 07 09Simulado Enem 2009 CiêNcias Da Natureza 30 07 09
Simulado Enem 2009 CiêNcias Da Natureza 30 07 09BIOLOGO TOTAL
 
Enem2009 Linguagens Codigos
Enem2009 Linguagens CodigosEnem2009 Linguagens Codigos
Enem2009 Linguagens CodigosBIOLOGO TOTAL
 
Enem2009 Ciencias Humanas
Enem2009 Ciencias HumanasEnem2009 Ciencias Humanas
Enem2009 Ciencias HumanasBIOLOGO TOTAL
 

Mais de BIOLOGO TOTAL (11)

2009 Volume3 C A D E R N O D O A L U N O B I O L O G I A Ensino Medio 1ase...
2009 Volume3  C A D E R N O D O A L U N O  B I O L O G I A  Ensino Medio 1ase...2009 Volume3  C A D E R N O D O A L U N O  B I O L O G I A  Ensino Medio 1ase...
2009 Volume3 C A D E R N O D O A L U N O B I O L O G I A Ensino Medio 1ase...
 
2009 Volume3 Cadernodoaluno Biologia Ensino Medio 3aserie Gabarito[1]
2009 Volume3 Cadernodoaluno Biologia Ensino Medio 3aserie Gabarito[1]2009 Volume3 Cadernodoaluno Biologia Ensino Medio 3aserie Gabarito[1]
2009 Volume3 Cadernodoaluno Biologia Ensino Medio 3aserie Gabarito[1]
 
Equinodermos
EquinodermosEquinodermos
Equinodermos
 
Moluscos
MoluscosMoluscos
Moluscos
 
Artropodes
ArtropodesArtropodes
Artropodes
 
Trabalhos
TrabalhosTrabalhos
Trabalhos
 
Trabalhos
TrabalhosTrabalhos
Trabalhos
 
Simulado Enem 2009 CiêNcias Da Natureza 30 07 09
Simulado Enem 2009 CiêNcias Da Natureza 30 07 09Simulado Enem 2009 CiêNcias Da Natureza 30 07 09
Simulado Enem 2009 CiêNcias Da Natureza 30 07 09
 
Enem2009 Matematica
Enem2009 MatematicaEnem2009 Matematica
Enem2009 Matematica
 
Enem2009 Linguagens Codigos
Enem2009 Linguagens CodigosEnem2009 Linguagens Codigos
Enem2009 Linguagens Codigos
 
Enem2009 Ciencias Humanas
Enem2009 Ciencias HumanasEnem2009 Ciencias Humanas
Enem2009 Ciencias Humanas
 

2009 Volume3 C A D E R N O D O A L U N O B I O L O G I A Ensino Medio 2aserie Gabarito

  • 1. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 SITUAÇÃO DE APRENDIZAGEM 1 A ESTRUTURA DO DNA Para começo de conversa Página 3 • Espera-se que os alunos abordem temas relacionados a exames de paternidade, genética forense e material genético. Leitura e Análise de Imagem Página 3 1. A imagem é formada com várias fotografias de seres humanos. 2. Um significado possível é que todos os seres humanos compartilham um mesmo tipo de DNA. O significado biológico será apresentado em outro momento, mas, para uma primeira aproximação, essa interpretação é suficiente. 3. O formato da molécula de DNA, que é semelhante a uma “escada” retorcida. Leitura e Análise de Texto Página 5 1. A canção retrata a relação de um pai com sua filha, Daniela. Os versos a seguir reforçam essa ideia: “Quando você nasceu ouvi seu grito”; “Não me sentir capaz de ser seu pai”. 2. Esse elo é o DNA. 3. As palavras são: DANça ; oNDA; NADa; DNA; DANiela. 4. As letras se alternam, da mesma forma que os componentes do DNA se alternam ao longo da molécula. 1
  • 2. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 LIÇÃO DE CASA Página 8 • Só são formados pares entre cores específicas, como ocorre entre as bases nitrogenadas. VOCÊ APRENDEU? Página 8 1. Alternativa e. 2. Alternativa a. 3. Alternativa c. 4. a) Os “corrimãos” correspondem a uma sucessão alternada de fosfato e desoxirribose (açúcar). Os “degraus” são constituídos por pares de bases nitrogenadas, unidas por ligações de hidrogênio, onde adenina pareia com timina, e citosina com guanina. b) A molécula de DNA contém genes que codificam as proteínas. Primeiramente, a informação contida nos genes é transcrita para uma molécula de RNA mensageiro, que será lido pelos ribossomos no citoplasma. Ao ler os RNAm, os ribossomos sintetizam cadeias de aminoácidos (proteínas), cuja sequência é determinada pela sequência de nucleotídeos do RNAm. c) Duas proteínas podem ser diferenciadas por suas sequências de aminoácidos. Outra diferença diz respeito às suas estruturas tridimensionais, que definirão suas funções. A estrutura tridimensional de uma proteína depende da sequência de seus aminoácidos. 2
  • 3. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 SITUAÇÃO DE APRENDIZAGEM 2 A DUPLICAÇÃO DO DNA Para começo de conversa Página 10 1. Durante a mitose, a quantidade de DNA da célula duplicada durante a interfase está se dividindo para originar as duas células-filhas. 2. A quantidade de DNA duplicou, passou de C para 2 C. 3. Começa com C e acaba com o mesmo valor, C. Isso mostra que durante a mitose são formadas novas células com a mesma quantidade de DNA da célula original. A duplicação do DNA Página 11 1. Não se espera que o aluno produza uma resposta elaborada sobre a replicação do DNA. No entanto, seria muito salutar que ele pudesse estabelecer alguma relação entre o pareamento de bases (pares A/T e C/G) e o processo de replicação. 2. Neste momento, não são esperadas respostas elaboradas e explicações corretas e detalhadas às questões, pois os alunos ainda não têm elementos para construí-las. Entretanto, as respostas dadas serão muito úteis para relacionar o conhecimento prévio dos alunos e direcionar suas explicações. Atividade coletiva: simulando a replicação do DNA Página 12 Espera-se que os alunos descrevam os passos de formação de novas moléculas de DNA de acordo com a formação das novas fileiras. 3
  • 4. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 Espera-se que eles compreendam que o processo de replicação do DNA ocorre pela adição de novos nucleotídeos (alunos) à cadeia em formação (fileira). Essa adição é feita tendo como molde a fita antiga de DNA. O que realiza o processo de leitura da fita antiga e construção da nova fita é a enzima DNA polimerase. 1. Espera-se que aqui os alunos possam relacionar o período “S” da mitose com a dramatização que acabaram de realizar e que o aumento na quantidade de DNA (de C para 2C) deve-se à duplicação do DNA. 2. No esquema, a relação entre fita de DNA e fileira de carteiras é que cada sequência de alunos corresponde a uma cadeia da molécula de DNA e o pareamento entre os alunos corresponde ao pareamento de bases entre as duas cadeias complementares do DNA. Uma molécula de DNA com duas cadeias abre-se e gera dois moldes. Paralelamente, a cada molde irá se formar uma nova fita complementar (de acordo com o pareamento AT e CG) e ao término haverá duas moléculas de DNA iguais 4
  • 5. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 entre si. Esse processo de replicação é denominado semiconservativo, pois as moléculas novas apresentam uma fita nova e outra antiga. LIÇÃO DE CASA Página 14 O aluno deverá estruturar um texto que mostre o processo de replicação do DNA. É importante que esse texto apresente a estrutura da molécula e ressalte o fenômeno da complementaridade entre as bases nitrogenadas. A seguir, o texto deve mostrar como esse fenômeno possibilita a replicação – cada uma das fitas da molécula de DNA servindo de molde para a síntese de duas novas fitas. PESQUISA INDIVIDUAL Página 14 • O aluno deve compreender que o papel da enzima é utilizar nucleotídeos livres obtidos, por exemplo, por meio da alimentação e incorporá-los às fitas de DNA que estão sendo construídas. É importante que o aluno compreenda que a enzima DNA polimerase é dependente de molde, ou seja, ela produz uma nova fita tendo outra por molde. Além disso, o aluno deve construir a ideia de que a replicação deve começar em vários pontos ao longo da molécula de DNA. • Espécie Número de dias 61 Jiboia 90 Ser humano 269 Gafanhoto 521 Cebola 4 630 Salamandra 19 387 Ameba 5
  • 6. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 • Hipótese: é esperado que os alunos consigam perceber que a velocidade apresentada corresponde à de uma molécula de proteína, mas muitas moléculas de proteínas podem atuar simultaneamente, diminuindo o tempo necessário para duplicar o DNA de uma célula. 6
  • 7. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 SITUAÇÃO DE APRENDIZAGEM 3 DO DNA À PROTEÍNA VOCÊ APRENDEU? Página 16 1. Alternativa d. 2. Alternativa c. 3. Alternativa b. 4. Uma reta sem as fases S, G2 e M, pois, se a célula não se multiplica, ela não duplicará seu DNA. 5. a) No tubo B, a densidade é intermediária devido à presença do isótopo normal e do isótopo pesado, dada a característica da duplicação do DNA ser semiconservativa, ou seja, uma fita antiga servir de molde para a fita nova. b) Na faixa superior também há X de DNA, com densidade menor (isótopo normal). Página 19 DNA RNA 1. Qual é o significado da sigla? Ácido Ácido ribonucleico desoxirribonucleico 2. O nucleotídio deste ácido nucleico é formado por Desoxirribose Ribose qual tipo de açúcar? 3. Quais são as bases nitrogenadas que podem Adenina, timina, Adenina, uracila, formar um nucleotídio deste ácido nucleico? guanina, citosina guanina, citosina 4. A molécula deste ácido nucleico é formada por Dupla-fita Fita simples fita simples ou dupla-fita? 7
  • 8. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 5. Quais podem ser as funções desempenhadas por “Armazenar” a Traduzir a informação moléculas deste ácido nucleico? informação genética genética em proteína 6. Em uma célula humana, onde podemos encontrar No núcleo (e No núcleo e no as moléculas deste ácido nucleico? também na citoplasma (e também na mitocôndria) mitocôndria) • Pode ser que alguns alunos interpretem a ideia de que os RNAs mensageiros trazem a informação do núcleo da célula para o citoplasma; porém, normalmente, o termo “mensageiro” suscita várias interpretações dos alunos, alguns acham que deve ser o próprio gene, outros acham que o RNA é quem copia a mensagem, e não que seja uma cópia da mensagem (do gene). Leitura e Análise de Texto Página 20 1. Lembranças de um RNA mensageiro é um texto narrado pelo próprio RNA mensageiro. Nele, o narrador descreve um período de sua vida até o momento de sua “morte”. 2. RNA mensageiro, RNA transportador e RNA ribossômico. O RNA mensageiro é um molde do DNA que leva a informação do DNA até o ribossomo. O RNA transportador identifica sequências do RNA mensageiro e libera o aminoácido correspondente no ribossomo. O RNA ribossômico forma o ribosso, estrutura responsável pela ligação entre o RNA mensageiro e o RNA transportador, além da reunião dos aminoácidos. 3. AUG. 4. No núcleo. 5. No citoplasma. 6. Ao RNA mensageiro e ao ribossomo. 7. Na sequência UAG. 8. Podemos substituí-lo por “polipeptídio” ou por “proteína”. 8
  • 9. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 9. O texto deve conter todas as etapas descritas que ocorrem no citoplasma, tendo como narrador o ribossomo. Decifrando o código genético Página 22 1. Espera-se que o aluno relacione código a uma linguagem cifrada com símbolos que permitem escrever ou representar algum tipo de informação. 2. Há um equívoco muito comum entre os alunos, e também na mídia, de considerar código genético como sinônimo de DNA ou de genoma. Por isso, caso isso ocorra, não é preciso conceituar precisamente neste momento; porém, é bom chamar a atenção dos alunos para o fato. 3. Da bactéria Xylella, causadora do amarelinho em plantas cítricas, laranja. 4. É uma doença que acomete as plantas de laranja e que é causada por uma bactéria. 5. Projeto científico com o objetivo de mapear o DNA, genoma, da bactéria Xylella. 6. No caso, o genoma da Xylella é o conjunto de informações genéticas contido no DNA da bactéria e que define suas características biológicas. Aprendendo a Aprender Página 23 • Códon: trinca de nucleotídeos presente no RNA mensageiro que codifica um aminoácido na proteína. Leitura e Análise de Texto Página 24 1. A sequência de bases nitrogenadas do DNA humano, chamada de genoma humano, é confundida com a expressão “código genético” da espécie. Esse sequenciamento do genoma humano foi finalizado por volta do ano 2000. Dessa forma, a manchete 9
  • 10. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 apresentada contém um erro conceitual muito comum em alguns noticiários sobre Ciência. 2. a) AUG. b) Metionina, lisina, glicina. 3. Esse é um códon de parada e define quando a síntese da proteína, adição de novos aminoácidos, se encerra. 4. UGA, UAA. 5. Arginina – CGU, CGC, CGA, CGG; triptofano – UGG. 6. Que o código genético é degenerado, ou seja, existe mais de um códon para codificar o mesmo aminoácido. 7. Dizer que o código genético é universal significa dizer que essa relação entre códons e aminoácidos é encontrada em todos os seres vivos. Ou seja, tanto em seres humanos como em insetos ou plantas, a tradução de uma informação genética em proteína obedece ao mesmo código. 8. De DNA a Proteína Fita do DNA a ser transcrita TAC GGA GTA GCT ATA ATT RNA mensageiro AUG CCU CAU CGA UAU UAA Proteína met – pro – his – arg – tyr VOCÊ APRENDEU? Página 25 1. Alternativa c. 2. Alternativa c. 3. Não. De acordo com o código genético, diferentes trincas de nucleotídeos podem especificar o mesmo aminoácido. 10
  • 11. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 4. a) AUG AGU UGG CCU G b) Serina – triptofano – prolina c) Metionina – serina – glicina Aprendendo a Aprender Página 28 1. Resposta esperada: valina – histidina – leucina – treonina – prolina – ácido glutâmico – ácido glutâmico – lisina. 2. Resposta esperada: apesar da mutação, não haverá alteração na proteína, porque tanto o códon CAC como o CTC codificam para o mesmo aminoácido – valina. 3. Resposta esperada: nesse caso, a mutação produz um códon que codifica um aminoácido diferente – metionina. Por isso, haverá mudança na proteína. 4. a) Resposta esperada: nesse caso, a primeira mutação causará a produção de um códon de parada e, portanto, os aminoácidos subsequentes não serão adicionados na proteína. b) A segunda mutação acarretará a reorganização de todos os códons a partir da mutação (…CAC – GTG – ACT – GAG – GAC – TCC – TCT – TC…), sendo que a terceira trinca (ACT) codifica um códon de parada. 5. É esperado que os alunos encontrem alguns exemplos de mutações relacionadas à anemia falciforme. O exemplo mais comum é a mutação pontual no gene beta- globina. Esse tipo de hemoglobina é chamado de hemoglobina S. 11
  • 12. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 SITUAÇÃO DE APRENDIZAGEM 4 DO DNA À CARACTERÍSTICA Para começo de conversa Página 29 • Espera-se que os alunos retomem e relacionem os conceitos anteriormente trabalhados relacionados aos genes como instruções hereditárias das células. Solicite que os alunos prestem especial atenção na relação entre os genes e a manifestação das características. Leitura e Análise de Texto Página 31 1. É uma proteína com função metabólica, controla determinada reação química. No caso da enzima SBE-1, ela controla a adição de novas moléculas de glicose nas ramificações do amido. 2. As células dos cotilédones podem armazenar mais ou menos água ao longo de seu desenvolvimento, dependendo do teor de amido ramificado. Cotilédones com muito amido não ramificado acumulam mais água e, quando secam, ficam com aspecto enrugado. Já os cotilédones com muito amido ramificado acumulam pouca água ao longo do desenvolvimento e, quando secam, perdem pouca água e permanecem com o volume praticamente inalterado, mantendo-se lisos. 3. Fita complementar de DNA: semente lisa: atgagatacttggagcaatttcatgatttgtga; semente rugosa: atgagatacttggagcaatttcatgatttatctttttgaaa. 4. RNA mensageiro: semente lisa: augagauacuuggagcaauuucaugauuuguga; semente rugosa: augagauacuuggagcaauuucaugauuuaucuuuuugaaa. 12
  • 13. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 5. Sequência de aminoácidos Proteína Resposta met-arg-tyr-leu-glu-gln-phe-his-asp-leu I Semente lisa met-arg-tyr-leu-glu-gln-phe-his-asp-his II met-arg-tyr-leu-glu-gln-phe-his-asp-leu-his III met-arg-tyr-leu-glu-gln-phe-his-asp-leu-ser IV met-arg-tyr-leu-glu-gln-phe-his-asp-leu-ser-phe V Semente rugosa 6. a) • É a sequência de aminoácidos que compõe uma proteína. • Representa a existência de diferentes domínios, regiões, na estrutura de uma proteína, com formatos importantes para a função que a proteína desempenha. • É o formato final de uma proteína e está diretamente associado à função que a proteína executa. b) tactctatgaacctcgttaaagtactaaatagaaaaacttt. c) tactctatgaacctcgttaaagtactaaacact. 7. O alelo R (codifica a proteína I) e o alelo r (codifica a proteína V). 8. Não, pois um tipo possui uma cópia do alelo R, e o outro, duas. Além disso, a ervilha heterozigota deve produzir cerca de metade de suas moléculas de amido com ramificações e a outra metade sem ramificações, enquanto a ervilha homozigota (RR) deve produzir apenas amido com ramificações. VOCÊ APRENDEU? Página 37 1. Alternativa b. 13
  • 14. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 2. Alternativa a. 3. Alternativa a. 4. a) Gene é um segmento do DNA localizado nos cromossomos. Possui um código químico representado por sequências de bases nitrogenadas (adenina, guanina, citosina e timina). Cada trinca de bases é capaz de codificar um aminoácido de uma proteína. A sequência de trincas determinará a sequência dos aminoácidos de um polipeptídeo. b) Mutações são modificações na sequência ou na composição das bases do DNA (gene), que podem causar a produção de uma proteína alterada ou mesmo a não produção da proteína. c) A substituição de uma base nitrogenada no DNA pode não causar nenhuma alteração na proteína produzida pela célula porque o código genético é degenerado, ou seja, um mesmo aminoácido pode ser codificado por diferentes trincas de bases. 5. a) • Proteína normal: Val – Leu – Tre – Pro – Tir – Val – Lis • Indivíduo A: Val – Leu – Tre – Pro • Indivíduo B: Val – Leu – Tre – Pro – Tir – Val – Lis • Indivíduo C: Val – Met – Tre – Pro – Tir – Val – Lis b) A é afetado porque produz uma proteína menor. B é normal, apesar da substituição de uma base nitrogenada em seu DNA, porque o código genético é degenerado. C é afetado porque possui um aminoácido diferente em sua proteína. 14
  • 15. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 Aprendendo a Aprender Página 39 Espera-se que os alunos possam relacionar o papel fundamental das proteínas na organização e no funcionamento das células e dos seres vivos com os processos moleculares envolvendo as informações genéticas: replicação, transcrição e tradução. 15