« EDITORIAL » 
Expediente 
DIREÇÃO EXECUTIVA 
Guilherme Saraiva 
COORDENADOR 
DE PRODUÇÃO 
Caio Barbosa 
DIREÇÃO DE ARTE 
...
« sumário » 
Perfil 
Conheça 
mais sobre a 
professora de 
redação Carolina 
Pavanelli 
Acontece 
no QG 
Todas as 
novidad...
« PERFIL » 
Era uma 
vez... 
... uma menininha que tinha na leitura 
o seu passatempo preferido. Mas antes 
mesmo de apren...
« PERFIL » 
Infância 
Nasci e cresci no Rio de Janeiro. Minha infância foi bem diferente. Come-cei 
a trabalhar aos 6 anos...
« PERFIL » 
Curiosidades 
Eu coleciono coisas da Marilyn Monroe. Livros, canecas, filmes... Tudo 
que tem a cara dela, eu ...
« Acontece no QG » 
Evento 
QG do Enem participa 
da Feira Capital 
Estudante 
Depois de participar do Feirão Papo de Estu...
« Acontece no QG » 
Estudantes escolhem cursos 
por disciplina ou área 
O QG do Enem desmembrou os cursos Intensivo Teóric...
« DICAS DE ESTUDO » 
É tempo 
de revisar 
No período próximo à realização de uma prova, é prática comum rever 
Dar priorid...
Acesse 
do Enem. Segundo Marquinho, dessa maneira 
você terá a possibilidade de testar seus conheci-mentos, 
podendo focar...
« DICAS DE ESTUDO » 
TOP Atualidades 
O Enem é um exame que trabalha questões do cotidiano, atualizando 
conceitos históri...
Nacionais 
- Crise hídrica 
- Copa do Mundo 2014 
- 60 anos da morte de Getúlio Vargas 
- 50 anos do Golpe Militar e a Com...
« MATÉria de capa » 
Chegou a 
hora! 
Antes de sair rumo às 
provas, confira todos os 
detalhes das exigências e 
regras d...
« MATÉria de capa » 
Nos próximos dias 8 e 9 de novembro, 8,7 milhões de pessoas têm com-promisso 
Pode parecer um pouco ó...
« MATÉria de capa » 
Horários 
✓ Nos dois dias, os portões de acesso aos 
locais de prova abrirão às 12h e fecharão 
às 13...
« MATÉria de capa » 
Dia 8/11 
✓ Você deverá responder questões de Ciên-cias 
Humanas e Ciências da Natureza. 
✓ Cada prov...
Objetos Proibidos 
✓ Você não poderá portar lápis, lapiseira, borracha, impressos, ano-tações 
e quaisquer dispositivos el...
Fim de Prova 
✓ O candidato só pode deixar de vez o local do exame após 
duas horas de prova. Se sair antes, poderá ser el...
Eliminação 
Além dos motivos dispostos até aqui, 
fique atento às demais razões que podem 
levar a sua eliminação, conform...
« drops » 
Nossos professores dão dicas de filmes, documentários, 
livros e peças de teatro para reforçarem a compreensão ...
« drops » 
Uma verdade inconveniente 
(Davis Guggenheim) 
Por que assistir? Quando conheci o documentário, fiquei fascinad...
De corpo 
A maioria das pessoas tem o primeiro contato com um 
enfermeiro já na sala de parto, ao nascer. É esse profissio...
« profissões » 
Por que você optou pelo curso de enfermagem? 
O enfermeiro tem uma ampla área de atuação dentro da saúde; ...
« profissões » 
E quais são as principais atividades do enfermeiro? 
O enfermeiro atua como assistência dentro de programa...
« profissões » 
CARREIRA 
O enfermeiro é o profissional da saúde responsável pela 
recuperação e promoção da saúde e pela ...
« ABRA O OLHO » 
Marcelo Tavares * 
No dia 12 de setembro de 2014, a Casa Branca declarou oficialmente que os 
Estados Uni...
« ABRA O OLHO » 
muitos pensam, a Al Qaeda - principalmente 
após a morte de Bin Laden em 2011 - não 
é uma rede centraliz...
« É pra lá que eu vou » 
Uma universidade 
para todos 
Federal de Brasília foi 
pioneira na criação de cotas 
para negros ...
« É pra lá que eu vou » 
Quando a Universidade Federal de 
Brasília (UnB) nasceu, em 1962, 
a capital brasileira estava sa...
« É pra lá que eu vou » 
Estrutura 
Três grandes personagens protagonizaram 
a história do surgimento da universidade: 
o ...
« É pra lá que eu vou » 
Futuro 
A criação de novos cursos de pós-graduação está 
prevista no Plano de Desenvolvimento Ins...
« QG RESOLVE » 
Pronominais 
Oswald de Andrade 
Dê-me um cigarro 
Diz a gramática 
Do professor e do aluno 
E do mulato sa...
« QG RESOLVE » 
No século XVIII, durante a Revolução Francesa, Saint 
Domingue, uma pequena colônia na América Central, 
r...
(Uerj 2013) A mutação no DNA de uma célula eucariota acar-retou 
a substituição no RNA mensageiro de uma proteína, da 
15ª...
As possíveis 
soluções 
mostradas 
por você 
refletirão seu 
conhecimento 
de mundo e a 
coerência com 
o que você já 
apr...
utilize a substituição de termos ou expressões por pronomes 
pessoais, possessivos e demonstrativos, advérbios que indicam...
« tipo assim » 
Bruno Miranda* 
O Enem já acontece mês que vem e eu lembro do dia em que fiz 
a minha prova como se fosse ...
« tipo assim » 
Política 
pode parecer 
chato e 
complicado, 
mas, se 
você não 
entender, 
nunca será 
capaz de 
propor a...
852 revista qg_enem_6_ed.
852 revista qg_enem_6_ed.
852 revista qg_enem_6_ed.
Próximos SlideShares
Carregando em…5
×

852 revista qg_enem_6_ed.

768 visualizações

Publicada em

852 revista qg_enem_6_ed.

Publicada em: Educação
0 comentários
0 gostaram
Estatísticas
Notas
  • Seja o primeiro a comentar

  • Seja a primeira pessoa a gostar disto

Sem downloads
Visualizações
Visualizações totais
768
No SlideShare
0
A partir de incorporações
0
Número de incorporações
2
Ações
Compartilhamentos
0
Downloads
4
Comentários
0
Gostaram
0
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

852 revista qg_enem_6_ed.

  1. 1. « EDITORIAL » Expediente DIREÇÃO EXECUTIVA Guilherme Saraiva COORDENADOR DE PRODUÇÃO Caio Barbosa DIREÇÃO DE ARTE Samira Cardoso REDAÇÃO Fernanda Varela Revisão Amanda Fantini Bove DESIGN GRÁFICO E ILUSTRAÇÕES Taíssa Bach, Juliana Carvalho, Euller Camargo e Mazaroto Santos AUDIOVISUAL Diego Monteiro e Tagory Nascimento MIDIAS SOCIAIS Carlos Henrique Brandão Olá galera, Entre as descobertas geniais do físico Albert Einstein está a Teoria da Relatividade, a qual afirma que tempo e espaço são relativos e estão profundamente entre-laçados. Mas a gente não está citando Einstein nes-te editorial para indicar algum estudo para prova de Ciências da Natureza. Estamos lembrando da relativi-dade do tempo porque, tenha você sentido ele passar voando ou se arrastando, o fato é: o Enem está aí! Além dos assuntos que você estudou ao longo do ano, é preciso ficar atento também às regras que o Inep exige na hora da prova. Por exemplo, você sabia que é proibido entrar na sala com boné? E que há uma frase no Caderno de Questões que deve ser, obriga-toriamente, transcrita para o Cartão-Resposta? Essas informações você encontra na Matéria de Capa desta edição, uma espécie de guia, criado com base no edi-tal do Ministério da Educação. Já que estamos em contagem regressiva para o Enem, está na hora de começar a rever o que foi estudado até aqui. Esse é o assunto da Dica de Estudo, que vai te aju-dar a definir quais matérias devem fazer parte da sua revisão. Uma das formas indicada pelo professor Mar-quinho Laurindo é responder questões que já caíram no Enem. E por falar nelas, o QG desmembrou o Curso In-tensivo de Questões e está oferecendo pacotes de aulas por área do conhecimento. Você fica por dentro de todos os detalhes na seção Acontece no QG. E ainda tem entrevista sobre a profissão de enferma-gem, exercícios inéditos do QG Resolve e as colunas dos vlogueiros Luísa Clasen e Bruno Miranda. Espe-ramos que você tenha uma boa leitura e, claro, mande muito bem nas provas dos dias 8 e 9 de novembro! o/ Muita paz! 02
  2. 2. « sumário » Perfil Conheça mais sobre a professora de redação Carolina Pavanelli Acontece no QG Todas as novidades do nosso curso online Dicas de Estudo Veja como planejar a revisão e agende-se para o Desafio SEI Matéria de Capa Saiba o que o Inep exige para os dias de prova Drops Professores dão dicas culturais para o Enem Profissões Abra o Olho Marcelo Tavares comenta sobre o Estado Islâmico do Iraque e Levante Confira entrevista com Helana Renesto e fique por dentro da carreira de enfermagem É pra lá que eu vou UnB é pioneira no sistema de cotas para negros e indígenas QG Resolve: Exercícios e respostas em vídeos inéditos. Tem ainda dicas para redação nota mil no Enem Tipo Assim Confira os textos dos vlogueiros Luisa Clasen (Lully de Verdade) e Bruno Miranda (Minha Estante) Pag. 05 Pag. 08 Pag. 14 Pag. 10 Pag. 23 Pag. 21 Pag. 29 Pag. 27 Pag. 38 Pag. 33
  3. 3. « PERFIL » Era uma vez... ... uma menininha que tinha na leitura o seu passatempo preferido. Mas antes mesmo de aprender a ler, ela tinha um grande desejo: queria ser artista de TV. Convenceu a mãe e foi fazer um teste com outras 500 crianças. Foi escolhi-da e virou protagonista de novela. Os anos passaram e o gosto da menina pe-los livros só aumentou, tanto que virou escritora e teve duas obras publicadas. Mas ela queria mais. Queria estimular o gosto pela literatura em outras pesso-as e ajudar a despertar o senso crítico. Tornou-se professora. Conheça, no relato a seguir, alguns ca-pítulos da história de vida da professora de redação do QG, Carolina Pavanelli. Carolina Pavanelli 05
  4. 4. « PERFIL » Infância Nasci e cresci no Rio de Janeiro. Minha infância foi bem diferente. Come-cei a trabalhar aos 6 anos em TV, então, não tive uma infância como as de-mais crianças. Ainda assim, não me arrependo de nada. Foi incrível viver nesse universo da televisão dos 6 aos 12 anos. Aprendi muitas coisas, via-jei, conheci pessoas... Fora isso, meus pais tentavam fazer com que minha vida fosse a mais normal possível. Ia à escola, tinha amigos, mas sempre fui muito quieta. Desde criança, meu passatempo era ficar em casa lendo... Protagonista de novela Eu sempre pedia a minha mãe para me levar para fazer televisão, mas ela não levava muita fé, achava que era sonho de qualquer criança. Com 4 anos, ela se convenceu e me levou para fazer um book. Com 6, surgiu a oportunidade do teste para novela Sonho Meu, na rede Globo. Minha mãe viu um anúncio no jornal e me levou. Concorri com mais de 500 meninas, mas, no final, acabei sendo a escolhida para interpretar a Laleska. Depois, ainda atuei em outras duas novelas, participei do Criança Espe-rança, de especiais da Xuxa... Fiz também sete episódios do programa Você Decide. O que mais gostei foi um inspirado em O Príncipe e o mendigo, em que eu fiz gêmeas. Sala de aula Na adolescência, acabei me interessando por outras coisas, como li-teratura e cinema. Então, fiz faculdade de Comunicação Social com habilitação em Cinema. Sempre gostei de escrever, tenho dois livros lançados - Sonho de Criança, escrito aos oito anos, e Longe de alguém tão perto, lançado em 2011 - e me arrisco em roteiros. Um dia, em 2010, dei uma aula e gostei de trabalhar com redação. Não parei mais. Minha maior motivação é a capacidade de ajudar a desper-tar o senso crítico dos jovens. 06
  5. 5. « PERFIL » Curiosidades Eu coleciono coisas da Marilyn Monroe. Livros, canecas, filmes... Tudo que tem a cara dela, eu compro. Também tenho um blog, onde falo so-bre assuntos diversos. Recado para os alunos O conhecimento é a única coisa que ninguém nunca pode nos tirar e é o que de mais valioso podemos ter. Acesse O blog da Carol! Clique aqui: http://desaltonaareia.com/ 07
  6. 6. « Acontece no QG » Evento QG do Enem participa da Feira Capital Estudante Depois de participar do Feirão Papo de Estudante, no Recife (PE), a equipe do QG do Enem embarca para Brasília (DF) com destino à Feira Capital Estudante – O seu Guia do Futuro. De 29 a 31 de outubro, o QG estará presente com um estande e realizará três palestras sobre o Enem. No espaço do QG, os visitantes poderão se informar como revi-sar o conteúdo estudado, além de conhecer mais sobre os nossos cursos e as vantagens do estudo online. Como a feira é realizada às vésperas do exame nacional, o QG também oferecerá um am-biente com ações para relaxar os estudantes e sorterá um X-Box. A Capital Estudante ocorre no Pátio Brasil Shopping, das 9h às 20h. A expectativa dos organizadores é que mais de 20 mil alunos do Ensino Médio circulem por lá, em busca de informações sobre o ensino superior, cursos técnicos, intercâmbios culturais, cursos de idiomas, concursos públicos, carreiras e mercado de trabalho. A entrada na feira é gratuita. Mais informações no site do evento. Acesse Confira o calendário das palestras dos professores do QG: 29/10 | 16h - Prevendo a prova: estratégias de estudo na área de humanas a partir da contextualização - com Marcelo Tavares (História) 30/10 | 17h - Especial Updating: atualidades para Enem - com Orlando Stiebler (Atualidades) 31/10 | 11h - Enem: um grande desafio - com Marquinho Laurindo (Literatura). 08
  7. 7. « Acontece no QG » Estudantes escolhem cursos por disciplina ou área O QG do Enem desmembrou os cursos Intensivo Teórico e Intensivo de Questões, am-pliando acessadas no nosso site. Isoladas as possibilidades de estudo dos alunos. Isso porque, na modalidade Isoladas, é possível escolher o conteúdo por disciplinas específicas ou área do conhecimento. No Isoladas do curso teórico, há pacotes de aulas em nove disciplinas: geografia, his-tória, biologia, física, química, literatura, português, matemática e redação. Além das videoaulas, o aluno tem acesso ao material didático, que pode ser baixado em compu-tadores, Gratuito Foca na Específica para quem vai prestar vestibular O Ministério da Educação permite quatro formas de utilização do Enem: como fase única, com o Sisu; como primeira fase; com-binando com o vestibular da instituição; e como fase única para as vagas remanescen-tes do vestibular. Assim, apesar de todas as universidades federais terem adotado a nota do Exame, ainda há instituições que realizam processo seletivo próprio. De olho nisso, o QG produz a segunda temporada do Foca na Específica. No programa gratuito, nossos professores trabalham questões das principais universi-dades do país como Universidade do Estado do Rio de Janeiro (UERJ), Universidade Fe-deral do Rio Grande do Sul (UFRGS) e Uni-versidade de São Paulo (USP). Na grade de aulas estão as seguintes específicas: geo-grafia, história, português, matemática, físi-ca, química e biologia. As aulas podem ser celulares e tablets. “O curso também é destinado a quem pensa em prestar vestibula-res tradicionais”, ressalta o coordenador peda-gógico, Marquinho Laurindo. Já no Isoladas de questões, os módulos estão di-vididos conforme as áreas do conhecimento co-bradas no Enem: Ciências Humanas, Ciências da Natureza, Linguagens e Códigos, Matemática e Redação. O investimento é a partir de R$ 27,00, variando de acordo com a isolada escolhida. Acesse 09
  8. 8. « DICAS DE ESTUDO » É tempo de revisar No período próximo à realização de uma prova, é prática comum rever Dar prioridade para os conteúdos das disciplinas específicas é uma boa estratégia o conteúdo para refrescar a memória. Mas, no caso do Enem, um exa-me que engloba todos os componentes curriculares do Ensino Médio, como você pode definir o que revisar? Para o coordenador pedagógico e professor de literatura do QG, Marquinho Lau-rindo, a principal dica é que o aluno tenha em mente aquilo que possui mais re-levância para a sua pontuação. “Nesta fase, o estudo das disciplinas específicas, aquelas que possuem mais peso para carreira escolhida, é fundamental”, afirma. Outra forma de se organizar é traçar um plano priorizando o conteúdo após realizar exercícios, de preferência respondendo questões que caíram em edições anteriores 10
  9. 9. Acesse do Enem. Segundo Marquinho, dessa maneira você terá a possibilidade de testar seus conheci-mentos, podendo focar nos itens que não acer-tou ou naqueles que teve mais dificuldade em solucionar. Em relação ao período ideal para começar a passar um pente fino no que foi estudado, o professor diz que depende muito do perfil do candidato. “Se o aluno for extremamente organizado e conseguir manter uma rotina que associe teoria e, sobretudo, exercícios, terá condição de dedicar o último mês para revisão”, exemplifica. A última dica de Marquinho é que você não precisa ler o conteúdo todo novamente. A re-visão é hora de olhar os resumos que você fez enquanto aprendia a matéria, de criar esque-mas e anotar palavras-chaves para lembrar do assunto. “Claro, se houver algo que não foi bem compreendido, vale a pena olhar o ma-terial original. Mas, de maneira geral, atenha-se aos resumos.” Entre as provas - O Enem deste ano ocorre nos dias 8 e 9 de novembro. Com dois dias de exa-me, muitos candidatos também ficam em dúvi-da se devem revisar o conteúdo de um dia para outro. Ou seja, na noite de sábado consultar as anotações de Linguagens e Códigos, Redação e Matemática. Aqui, mais uma vez, a reco-mendação segue o perfil do estudante. O professor de matemática, Jairo Teixeira, conta que há alunos que encerram completamente o período de todas as revisões antes do primeiro dia. Já outros, simplesmente, não conse-guiriam ter a menor segurança sem dar pelo menos uma olhadinha nos conteúdos do dia seguinte. “Acho que as formas de lidar com isso devem ser respeitadas e creio que não há problemas, desde que não haja excessos”, tranquiliza Jairo. Agende-se - Já que o assunto da Dica de Estu-dos deste mês é revisão, não poderíamos dei-xar de mencionar o Desafio SEI - Sexta-feira dos Estudos Impossíveis, que será realizado no dia 7 de novembro, das 9h às 15h (horário de Brasília). No aulão de véspera do QG do Enem, os professores aproveitam toda a ex-periência que possuem no Enem para relem-brar os principais pontos em cada disciplina. O evento gratuito reunirá cerca de 800 alu-nos presencialmente, sendo transmitido ao vivo do Centro de Convenções SulAmérica, no Rio de Janeiro. Na primeira edição do De-safio SEI, em 2013, o número de acessos du-rante a transmissão foi superior a 50 mil. Para participar, basta acessar a fanpage do QG. « DICAS DE ESTUDO » 11
  10. 10. « DICAS DE ESTUDO » TOP Atualidades O Enem é um exame que trabalha questões do cotidiano, atualizando conceitos históricos e geográficos. Portanto, é extremamente importante estudar temas de atualidades, tendo base tanto para as provas objetivas quanto para a redação. Como o Enem está batendo à porta, pedimos para o professor do programa Updating, Orlando Stiebler, citar os temas que muito provavelmente serão cobrados em novembro e, por isso, devem fazer parte da sua revisão. Confira: Internacionais - Crise entre Ucrânia e Rússia - Guerra Israel x Palestina - Avanço do Estado Islâmico no Iraque e na Síria - Aumento do número de imigrantes ilegais e as tragédias no Mediterrâneo - Reformas econômicas em Cuba - Aliança do Pacífico - Ataque de piratas na Costa Africana - Sustentabilidade e o protocolo de Kyoto - 100 anos da Primeira Guerra Mundial - Ebola - Descriminalização das drogas e a experiência do Uruguai 12
  11. 11. Nacionais - Crise hídrica - Copa do Mundo 2014 - 60 anos da morte de Getúlio Vargas - 50 anos do Golpe Militar e a Comissão Nacional da Verdade - Mercosul e a Cúpula de Caracas - Marco Civil da Internet - Espionagem dos Estados Unidos - Eleições 2014 Clique no vídeo para assistir aos programas do Updating Vídeo 13
  12. 12. « MATÉria de capa » Chegou a hora! Antes de sair rumo às provas, confira todos os detalhes das exigências e regras do Exame Nacional do Ensino Médio © Ilustração / Shutterstock 14
  13. 13. « MATÉria de capa » Nos próximos dias 8 e 9 de novembro, 8,7 milhões de pessoas têm com-promisso Pode parecer um pouco óbvio para alguns, mas é preciso ressaltar que isso inclui a postagem da prova em redes sociais durante o exame.” © Ilustração / Shutterstock marcado na agenda: as provas do Exame Nacional do Ensino Médio (Enem). Ao longo do ano, a revista QG do Enem mostrou para que serve a nota do exame; como controlar a ansiedade até a prova; e apontou os assuntos mais cobrados pelo Inep em cada disciplina. Nesta última ma-téria de capa antes do Enem, nós organizamos uma espécie de guia, com base no edi-tal, para que você fi-que por dentro das exigências e reco-mendações do Mi-nistério da Educa-ção e chegue aos dias do exame mais tranquilo, focado no conteúdo estudado. Dessa forma, você encontrará informações como a proibição do uso de equipamen-tos eletrônicos, que, automaticamente, elimina o candidato. Pode parecer um pouco óbvio para alguns, mas é preciso ressaltar que isso inclui a postagem da prova em redes sociais durante o exame. Segundo o Inep, na edição de 2013, 36 candidatos foram eliminados do Enem por esse motivo. Então, para evitar situações como essa, fique atento nos tópicos a seguir e tenha uma ótima prova! Local de Provas ✓ Consulte o local de provas no cartão de confir-mação, entregue pelos Correios no endereço infor-mado por você no ato da inscrição. ✓ O local também está disponível no site: http://siste-masenem2. inep.gov.br/localdeprova. ✓ Procure conhecer o local e pensar o trajeto antes dos dias do exame, evitando atrasos. 15
  14. 14. « MATÉria de capa » Horários ✓ Nos dois dias, os portões de acesso aos locais de prova abrirão às 12h e fecharão às 13h, pelo horário de Brasília. ✓ Após às 13h, você não poderá entrar para realizar o exame. ✓ Os 69.396 candidatos que informaram guardar o sábado por motivo religioso também deverão comparecer ao local de exame às 12h. No entanto, só iniciarão as provas após às 19h (horário de Brasí-lia). Participantes de Roraima, Rondônia, Amazonas e Acre iniciarão às 19h confor-me horário local. © Ilustração / Shutterstock Identificação ✓ É obrigatório apresentar documento de identificação original com foto para a re-alização das provas. ✓ Cédulas de Identidade (RG) expedidas pelas Secretarias de Segurança Pública, pelas Forças Armadas e pelas polícias Mi-litar e Federal, passaporte e Carteira Na-cional de Habilitação com foto são alguns dos documentos aceitos. ✓ Certidão de Nascimento, Certidão de Casamento, Título Eleitoral e Carteira de Estudante não são válidos para identifi-cação do candidato. ✓ Em caso de perda, roubo, extravio ou furto do documento, é possível apresen-tar o boletim de ocorrência, expedido por órgão policial, com data de, no máxi-mo, 90 dias antes da prova. ✓ Neste ano, pela primeira vez, travestis e transexuais poderão utilizar o nome so-cial para se identificar no dia das provas. Ao todo, 95 candidatos solicitaram esse direito, preenchendo um formulário es-pecial, após as inscrições. 16
  15. 15. « MATÉria de capa » Dia 8/11 ✓ Você deverá responder questões de Ciên-cias Humanas e Ciências da Natureza. ✓ Cada prova contém 45 questões de múl-tipla escolha. ✓ Você terá quatro horas e meia para con-cluir as provas, contadas a partir da autori-zação do aplicador para o início das provas. NOV 08 Dia 9/11 ✓ No segundo dia são aplicadas as provas de Linguagens e Có-digos, Matemática e a Redação. ✓ Cada prova objetiva contém 45 questões de múltipla escolha. ✓ A redação deve ter no mínimo 8 linhas e no máximo 30. ✓ Você terá cinco horas e meia para concluir as provas, contadas a partir da autorização do aplicador para o início das provas. NOV 09 Objetos Permitidos ✓ Durante a prova, você só po-derá utilizar uma caneta esfero-gráfica preta, fabricada em ma-terial transparente. © Ilustração / Shutterstock 17
  16. 16. Objetos Proibidos ✓ Você não poderá portar lápis, lapiseira, borracha, impressos, ano-tações e quaisquer dispositivos eletrônicos como máquinas calcula-doras, telefones celulares, tablets, relógios e gravadores. ✓ Usar óculos escuros, chapéu, boné, viseira, gorro ou similares tam-bém é proibido. ✓ Caso você chegue à sala com algum desses objetos, deverá guar-dá- lo em embalagem fornecida pelo aplicador da prova, incluindo o telefone celular desligado. ✓ A embalagem porta-objetos será lacrada e identificada por você, e será mantida embaixo da carteira até a conclusão das suas provas, sob pena de eliminação. ✓ E atenção: neste ano, você poderá ser submetido à revista eletrônica com detectores de metais nos locais de prova, a qualquer momento. Questões e Respostas ✓ Os Cadernos de Questões do Enem possuem cores diversas. A capa des-ses cadernos contém informações sobre a cor e uma frase em destaque. ✓ Você deverá marcar a cor de seu caderno e transcrever a frase no Cartão -Resposta. Se isso não for feito, a sua prova não será corrigida. ✓ Também está a cargo do candidato checar seus dados pessoais; se o Ca-derno de Questões contém defeito gráfico que impossibilite a leitura e, ain-da, se ele possui a quantidade de perguntas indicadas no Cartão-Resposta. ✓ As respostas das provas objetivas deverão ser marcadas nos respectivos Cartões-Resposta. Lembre-se você só pode utilizar caneta esferográfica preta. ✓ A redação corrigida será aquela que constar na Folha de Redação. ✓ Os rascunhos e as marcações nos Cadernos de Questões e na Folha Ras-cunho (redação) não serão considerados na correção. © Ilustração / Shutterstock 18
  17. 17. Fim de Prova ✓ O candidato só pode deixar de vez o local do exame após duas horas de prova. Se sair antes, poderá ser eliminado. ✓ O Caderno de Questões só pode ser levado quando estiver faltando trinta minutos para o término do ho-rário de provas, sob pena de eliminação. ✓ Os três últimos participantes presentes na sala de provas só serão liberados juntos, após assinatura da Ata de Sala. Gabarito ✓ O gabarito oficial será divulgado no site do Inep até o dia 12 de novembro. ✓ Nos dias 8 e 9, logo após as provas, os profes-sores do QG do Enem irão divulgar e comentar o gabarito extraoficial em parceria com o Jor-nal o Globo, no site da publicação. Não perca! © Ilustração / Shutterstock 19
  18. 18. Eliminação Além dos motivos dispostos até aqui, fique atento às demais razões que podem levar a sua eliminação, conforme o Inep: • Prestar, em qualquer documento ou no sistema de inscrição, declaração falsa ou inexata. • Perturbar a ordem no local de aplicação das provas durante a realização do Exame. • Comunicar-se verbalmente, por escrito ou por qualquer outra forma, com outro participante. • Utilizar ou tentar utilizar meio fraudulento em benefício próprio ou de terceiros, em qualquer etapa, sem prejuízo de demais penalidades previstas em lei. • Sair da sala de provas sem o acompanhamento de um aplicador ou ausentar-se em definitivo antes de decorridas duas horas do início das provas. • Não entregar ao aplicador o Car tão- Resposta, a Folha de Redação e a Folha de Rascunho ao terminar as provas. • Ausentar-se da sala de provas com o Cartão-Resposta e/ou com a Folha de Redação e a Folha de Rascunho. • Não atender às orientações da equipe de aplicação do Exame. • Recusar-se, injustificadamente, a ser submetido ao detector de metais. © Ilustração 20
  19. 19. « drops » Nossos professores dão dicas de filmes, documentários, livros e peças de teatro para reforçarem a compreensão de assuntos importantes do Enem. Confiram aí: Os Botões de Napoleão: As 17 Moléculas que Mudaram a História (Penny Le Couteur e Jay Burreson) Por que ler? O livro é uma dica muito quente para ajudar vocês no aprendizado da química associada à história. Tem uma leitura leve e muito bacana para todos os candidatos ao Enem, sobretudo os que curtem a área de humanas, são avessos às ciências exatas e que vivem se fazendo a pergun-ta: pra que eu quero saber isso? A obra nos permite viajar pelos conteúdos estudados da química, contados sobre o plano de fundo da Revolução Francesa. Tudo acontece a partir do momento em que as fardas dos soldados de Napoleão eram fechadas com bo-tões feitos de um material de estanho. Quando exposto a temperaturas baixas, o estanho se torna quebradiço e as fardas se abrem em pleno frio da Guerra na Sibéria. Com escrita primorosa, recheada com diversas histórias interessantíssimas, a professora de química Penny Le Cou-teur e o químico industrial Jay Burreson fazem uma incrí-vel análise de 17 grupos de substâncias que, como o estanho dos botões, influenciaram o curso da história. Mostram ain-da como algumas moléculas produziram grandes avanços na engenharia e desencadearam avanços fundamentais na medicina e no direito, além de serem orientadoras do que comemos, bebemos e vestimos nos dias de hoje. Vale muito a pena ler, pessoal! Roberto Mazzei Professor de química 21
  20. 20. « drops » Uma verdade inconveniente (Davis Guggenheim) Por que assistir? Quando conheci o documentário, fiquei fascinado com a exposição feita pelo protagonista, o ex-vice-presidente dos Estados Uni-dos, Al Gore. Para mim, era como se fosse uma aula dos sonhos, onde o professor dispunha de todos os recursos necessários para a elaboração de sua apresentação. Al Gore decidiu bater forte na questão ambiental, uma vez que as nações que são extremamente desenvolvidas industrialmente evitam assinar qualquer acordo que aponte para redução da taxa de emis-são de CO2 – o gás vilão quando se fala em aumento do efeito estufa. Na minha opinião, o ápice da apresentação é quando ele mostra fotos de vários lugares em diversas partes do mundo, onde antes se via neve e, hoje, há muito pouca. Apesar de haver correntes de pesquisadores que não acreditam que as mudanças climáticas decorrem da taxa de emissão de gás carbônico, vale muito a pena ver o filme. Assistam como se estives-sem vendo a uma aula e vocês vão gostar. Beraldo Neto Professor de física 12 anos de escravidão (Steve McQueen) Por que assistir? O vencedor do Oscar de melhor filme retrata uma história verídica ocorrida nos Estados Unidos (EUA) do século XIX, um pouco antes da guerra civil (1861-1865), quando um homem negro e livre é sequestrado e vendido como escravo. As crueldades do sistema escravocrata são aqui evidenciadas, assim como a luta de Salomon Northup para manter sua dignidade em meio às covardias sofridas por ele. As sequelas da escravidão nos EUA são sentidas até os dias atuais – como no Brasil também – e exemplo disso foi a morte do jovem Michael Brown em Ferguson, no Mis-souri, neste ano. O Estado do Missouri fica no meio-oeste americano numa região que se empobreceu muito e, hoje, a maioria da população da cidade é negra, apesar da força policial ser majoritariamente branca. A morte do jovem, aparentemente por motivos banais, desencadeou uma série de ma-nifestações não só na região, mas em todo país, provocando mais uma vez o debate sobre o racismo e a violência racial. É sempre bom lembrar que os EUA viveram nas décadas de 1950 e 1960 uma intensa luta pelos direi-tos civis dos negros e personagens como Rosa Parks, Malcolm X e Martin Luther King marcaram definitivamente a história do vi-zinho do norte. Aqui no Brasil, manifestações de racismo nos campos de futebol e no dia a dia também evocam o debate. Tema que certamente pode aparecer no Enem. Assistam ao fil-me, imperdível! Orlando Stiebler Professor de atualidades 22
  21. 21. De corpo A maioria das pessoas tem o primeiro contato com um enfermeiro já na sala de parto, ao nascer. É esse profissio-nal da área da saúde que está mais próximo dos pacientes e familiares, seja em hospitais ou em programas da saúde pública. E essa ligação pede do futuro profissional mais do que técnica, demanda capacidade de comunicação e gosto por lidar com pessoas. A entrevistada deste mês, Helana Maria Renesto, pôde ver de perto essa dedicação quando seu avô, com câncer, pre-cisou receber cuidados de uma enfermeira em casa. “Foi muito importante o apoio e a assistência que ela pres-tou a meu avô. Acho que isso repercutiu na minha escolha como profissional”, relembra. Há 11 anos, Helana se formou no curso que, segun-do o Censo da Educação Superior de 2012, está na quinta posição em número de alunos matriculados em todo país. Atualmente, a enfermeira natural de Caruru (PE) trabalha na oncologia pediátrica do Hospital Universitário Oswaldo Cruz, no Recife. Ela também é professora da Faculdade Estácio de Sá, na disciplina de Saúde da Criança. Na entrevista a seguir, a pernambucana conta qual foi seu principal desafio durante o curso, fala sobre as áreas de atuação do enfermeiro e como foi a escolha de trabalhar com crianças. « profissões » e alma Proximidade entre enfermeiro e pacientes demanda do profissional dedicação e gosto por pessoas Helana Maria Renesto © Ilustração 23
  22. 22. « profissões » Por que você optou pelo curso de enfermagem? O enfermeiro tem uma ampla área de atuação dentro da saúde; é um pro-fissional indispensável ao funcionamento dos programas de saúde pública e hospitais. Particularmente, eu sempre tive interesse pela assistência hospita-lar, especificamente na área de oncologia, e a enfermagem permite ao pro-fissional o cuidado humanizado e individualizado. Dentre os profissionais da equipe de saúde, é aquele que está mais próximo da criança e familiares. Qual foi o principal desafio que teve durante o curso? Lidar com a morte, principalmente de crianças. Acredito que, mesmo com algum tempo de profissão, esta ainda é a minha maior dificuldade. Apesar disso, o que fez você continuar? O desejo que tinha de me tornar enfermeira e de atuar no cuidado à criança. Quais são as características necessárias para as pessoas que desejam ingressar na profissão? Ser proativo, ter capacidade de comunicação, de trabalho em equipe, ter liderança, gostar de lidar com pessoas, ser dinâmico e organizado. 24
  23. 23. « profissões » E quais são as principais atividades do enfermeiro? O enfermeiro atua como assistência dentro de programas do Ministério da Saúde; como assistência da gestação, parto de baixo risco; puericultura; sala de vacina; consulta de enfermagem para hipertensão e diabetes; clas-sificação de risco em emergências públicas. Na indústria dentro da área de saúde do trabalhador; serviços de homecare, estomoterapia. Pode atuar como gestor ou gerente de serviços, como auditor hospitalar e de clínicas de saúde, como representante de produtos hospitalares. Ainda como pes-quisador e professor, seja no curso de enfermagem do nível técnico e na graduação e pós-graduação multiprofissional. Existem várias áreas de atuação. Como foi o seu processo de escolha? Durante a graduação, o aluno tem oportunidade de estagiar em diferentes âmbitos de atuação do enfermeiro e de conhecer diferentes profissionais, o que pode ajudar na identificação no momento de optar por uma espe-cialidade. Mas acredito que essa escolha está ligada, antes de tudo, à reali-zação e identificação pessoal. Minha escolha em atuar em oncologia, por exemplo, teve motivações pessoais. E quais foram essas motivações? Minha principal motivação foi meu avô paterno, que teve câncer de pul-mão e passou algum tempo em cuidados paliativos em casa. Desde essa época eu tive contato com uma enfermeira em particular e foi muito im-portante o apoio e a assistência que ela prestou ao meu avô. Acho que isso repercutiu na minha escolha como profissional. Durante a faculdade fiz estágio extracurricular em oncologia pediátrica, então, tive certeza que essa seria minha área de trabalho. E é exatamente onde estou hoje. Por causa dessa escolha, fiz residência em hematologia e mestrado em saúde da criança. Meu próximo passo será especialização em Humanização das práticas em saúde e tenho muito interesse também por cuidados paliativos. 25
  24. 24. « profissões » CARREIRA O enfermeiro é o profissional da saúde responsável pela recuperação e promoção da saúde e pela prevenção de doenças. Cuida desde a higiene e a alimentação do paciente até a administração de remédios e curativos. É um profissional indispensável ao funcionamento dos programas de saúde pública e hospitais. Durante o curso, é obrigatório o estágio supervisionado. Duração do curso: 4 anos Onde atuar: Pode atuar desde a vigilância sanitária, assistência à gestação e parto até auditoria de serviços de saúde. Também possui campo de atuação na docência em faculdades e cursos técnicos. Concursos Públicos: Há oportunidades de concursos em prefeituras, universidades, conselhos regionais, secretarias de saúde, entre outras. Em setembro, por exemplo, havia vagas na Universidade Federal do Paraná, no Conselho Regional de Enfermagem (Coren) da Bahia, no Hospital das Clínicas de São Paulo, entre outros. RAIO-X Salário médio R$ 2.282,46 Jornada semanal 40 horas Empregabilidade 81,10% Cobertura previdenciária 90,76% Fonte: Censo Demográfico 2010/IBGE 2010 26
  25. 25. « ABRA O OLHO » Marcelo Tavares * No dia 12 de setembro de 2014, a Casa Branca declarou oficialmente que os Estados Unidos estavam em guerra contra o Estado Islâmico do Iraque e Levante (EIIL, ou simplesmente EI), organização que surgiu como um braço armado da Al Qaeda no Iraque. A reação norte-americana foi apresentada dois dias antes da terceira decapitação de um refém pelo EI, o britânico David Haines, de 44 anos. Antes dele, foram executados os jornalistas americanos Steven Sotloff e James Foley. As execuções foram gravadas e veiculadas na internet. Em todas, as mortes são justificadas pelo próprio carrasco que culpa a “arrogante política externa” do presidente americano, Barack Obama. Muitas dúvidas vêm à mente dos estudantes que precisam organizar informações e entender a ascensão do EI, preocupados com a possibilidade do Enem se dedicar à questão. O objetivo desse texto é ajudá-los. Vamos por partes. Primeiro: o que é a Al Qaeda (AQ)? A AQ é uma rede terrorista internacional criada pelo milionário saudita Osama Bin Laden e que ficou famosa no ocidente após ter assumido a responsabilidade pelos ataques de 11 de setembro de 2001 em Nova York. O objetivo maior da AQ é eliminar qualquer influência ocidental no Oriente Médio - notadamente a dos EUA - e estabelecer governos fundamentalistas na região. Mas, ao contrário do que © Shutterstock Iraque em chamas: o EI e a nova guerra contra o terror 27
  26. 26. « ABRA O OLHO » muitos pensam, a Al Qaeda - principalmente após a morte de Bin Laden em 2011 - não é uma rede centralizada e organizada. Na verdade, aí está o perigo. Na prática, a Al Qaeda é uma expressão da própria variedade dos movimentos jihadistas (radicais islâmicos que, em nome de uma guerra santa, justificam as ações terroristas), que existem atualmente. Muitos braços da organização acabam se tornando independentes, resultando em complexas ações para desmobilizá-los. Chegamos ao ponto. O Estado Islâmico, em sua origem, era um braço da Al Qaeda no Iraque. Mas desde 2014, o líder do EI, Abu Bakr al-Bagdadi, passou a contestar a subordinação à rede Al Qaeda, que insistia que o EI limitasse suas ações ao território iraquiano. Mas Abu Bakr al-Bagdadi tinha planos maiores, queria também dominar a Síria. Por isso o rompimento. Em junho, militantes do Estado Islâmico tomaram Mosul – a segunda cidade mais importante do Iraque. As potências ocidentais decidiram não intervir. Parecia que o EI era uma questão sectária regional, dentre várias que afligem o Iraque desde a intervenção dos EUA a qual derrubou o ditador sunita Saddam Houssein. Mas o EI se mostrou algo bem diferente. Continuou avançando e provocando verdadeiro caos no país: os territórios tomados pelo grupo acabaram se tornando um califado (governo sob controle de um califa, sucessor do profeta Maomé) tanto no Iraque quanto na Síria. É interessante notar que a ascensão dos xiitas no Iraque (desde a intervenção dos EUA que durou até 2011) não satisfez grupos sunitas, que acabaram nutrindo certa simpatia pelo EI nas áreas dominadas. Por outro lado, populações de origem curda são expulsas dessas mesmas áreas, gerando enorme movimento de refugiados. Cerca de cem mil curdos estão, agora, cruzando a fronteira com a Turquia. O EI é extraordinariamente bem organizado, bem equipado (armas e tanques tomados © Shutterstock - Rena Schild do Exército iraquiano derrotado) e sabem coordenar suas operações. O grupo, que antes era visto como pequeno e fanático, agora virou um exército determinado e perigoso. O Estado Islâmico estaria com mais de 15 mil combatentes e acesso a recursos de US$ 2 bilhões – oriundos de fontes diversas, entre as quais doações privadas, sequestros e roubos. Embaixadores da OTAN, reunidos no último dia 11 de setembro, discutiram acerca de uma ação militar sob a liderança dos EUA. A França deu o primeiro passo e, no dia 19, confirmou que seus caças lançaram ataques no Iraque, corroborando a ação militar conjunta. No dia 22, os EUA e cinco estados árabes atacaram bases do EI. A guerra está instaurada. Marcelo Tavares é professor de história do QG do Enem. Este artigo não representa, necessariamente, a opinião desta publicação ou de seus editores. 28
  27. 27. « É pra lá que eu vou » Uma universidade para todos Federal de Brasília foi pioneira na criação de cotas para negros e indígenas © Foto: UnB Agência / Edu Lauton 29
  28. 28. « É pra lá que eu vou » Quando a Universidade Federal de Brasília (UnB) nasceu, em 1962, a capital brasileira estava saindo das fraldas. Em meio ao clima de inovação, vivido com a então recente cons-trução do Distrito Federal, a universidade definiu, entre as principais diretrizes, ampliar oportunidades de educação. Anos depois, a UnB mostra à sociedade toda a extensão des-sa meta ao criar cotas no vestibular para inse-rir negros e indígenas. O objetivo? “Corrigir séculos de exclusão racial.” A medida implantada em 2003 foi consi-derada polêmica e, ainda hoje, divide opi-niões de especialistas e da população. No entanto, nove anos depois, o governo fede-ral aprovou a Lei de Cotas (12.711/2012), que prevê a destinação, até 2016, de 50% das vagas das universidades federais a es-tudantes que cursaram o Ensino Médio em escola pública. Dentro desse sistema, há reserva de vagas por renda e raça. Para a UnB, o pioneirismo no seu programa e os bons frutos colhidos com ele influenciaram na criação da lei federal. Ainda dentro da diretriz de ampliar opor-tunidades, a federal de Brasília também foi precursora no Programa de Avaliação Se-riada (PAS), onde os candidatos às vagas são avaliados ao final de cada série do En-sino Médio. Segundo a instituição, em 13 anos, mais de 80 mil estudantes participa-ram do processo seletivo, sendo que 13.402 se tornaram calouros da UnB. Recentemente, o ingresso na universidade ganhou mais um novo caminho: o Sistema de Seleção Unificada (Sisu), que utiliza ex-clusivamente as notas do Enem. Das vagas oferecidas no primeiro semestre, a UnB de-cidiu ofertar 50% para o Sisu e a outra me-tade para entrada pelo PAS. © Foto: UnB Agência / Emilia Silberstein 30
  29. 29. « É pra lá que eu vou » Estrutura Três grandes personagens protagonizaram a história do surgimento da universidade: o antropólogo Darcy Ribeiro, responsável pela definição das bases da instituição; o educador Anísio Teixeira, na elaboração do modelo pedagógico institucional; e o arquiteto Oscar Niemeyer, cujas ideias re-sultaram nas formas físicas dos prédios do campus universitário Darcy Ribeiro. As bases levantadas por eles se alargaram para um conjunto de quatro campi – Planal-tina, Gama e Ceilândia – e foram criados em 2008 com recursos do programa Reuni, do governo federal. Além dessas áreas, há ainda 31 polos de apoio presencial à Educação a Distância nos quais a UnB oferta cursos. O Reuni também levou à criação de 4.240 vagas em 36 novos cursos como Engenha-ria Aeroespacial, Teoria Crítica e História da Arte e Bacharelado em Educação Físi-ca; além de aumentar vagas em outros 48. Assim, atualmente, a instituição conta com 105 cursos de graduação presencial e 12 a distância. O total de alunos é de 30.075, sendo a sexta federal em número de matri-culados no país, segundo o Censo Superior de Educação de 2011. Pesquisa Em relação aos cursos de pós-graduação, a UnB possui 163 divididos em 84 progra-mas. Segundo a avaliação Trienal de 2013 da Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (Capes), dois desses programas despontaram entre os melhores do país, recebendo a nota máxi-ma 7: Antropologia Social e Matemática. A avaliação também apontou dez progra-mas da UnB com média 6 no período. São eles: Biologia Molecular, Desenvolvimento Sustentável, Direito, Ecologia, Economia, Geologia, Geotecnia, Política Social, Re-lações Internacionais e Sociologia. Para o decano de Pesquisa e Pós-Graduação em exercício, Cristiano Melo, os resultados “foram excelentes e reforçam a posição da UnB entre as melhores universidades do país”. Entre os destaques de pesquisas recentes está uma realizada pelo Laboratório de Ge-nética do Instituto de Ciências Biológicas com o pequi, fruto típico do Cerrado. O es-tudo concluiu que ele é capaz de proteger as células dos efeitos colaterais das drogas usadas no tratamento contra o câncer, os quais costumam ser muito agressivos. © Foto: UnB Agência / Isa Lima 31
  30. 30. « É pra lá que eu vou » Futuro A criação de novos cursos de pós-graduação está prevista no Plano de Desenvolvimento Institucional (PDI) 2014-2017 da UnB. Para 2015, serão abertos cursos de mestrado e doutorado em Ciências Contá-beis e Ciências Ambientais, por exemplo. Há, ainda, previsão de abertura de um único curso de graduação – Licenciatura em Língua de Sinais Brasileira (LSB)/ Português como Segunda Língua (PSL), com previ-são de 30 vagas e funcionamento em 2015, no campus Darcy Ribeiro. A cautela na abertura de vagas a curto prazo pode es-tar relacionada à nova visão estabelecida para a UnB: “Estar entre as melhores universidades do Brasil, in-serida internacionalmente, com excelência em gestão de processos que fortaleça o ensino, pesquisa e exten-são”. Resumidamente, a meta agora é focar na quali-dade acadêmica, trabalhando para aprimorar o que já existe. * Com informações da UnB Agência A UnB em números:* Matrículas graduação - 30.075 Professores - 2.594 Cursos presenciais - 105 Cursos de pós-graduação - 163 Cursos EAD - 12 Campi - 4 (Campus Darcy Ribeiro, Campus Planaltina, Campus Ceilândia e Campus Gama) *Fonte: Censo 2011 e Decanato de Planejamento e Orçamento (DPO)/ UnB © Foto: UnB Agência / Mariana Costa 32
  31. 31. « QG RESOLVE » Pronominais Oswald de Andrade Dê-me um cigarro Diz a gramática Do professor e do aluno E do mulato sabido Mas o bom negro e o bom branco Da Nação Brasileira Dizem todos os dias Deixa disso camarada Me dá um cigarro O projeto modernista buscou a valorização dos elementos nacionais e o povo brasileiro passou a ser protagonista da representação cultural a partir da semana de arte moder-na de 1922. Na obra de Oswald de Andrade, a preocupação com a linguagem era também parte dessa incorporação do povo brasileiro a nossa cultura, como é possível perceber pelo (a): a) tratamento dado a ideia de Nação Brasileira a partir de uma aborda-gem coletiva b) referência ao negro e ao branco c) pela valorização da linguagem coloquial d) pela ideia de miscigenação representada pela figura do “mulato”. e) referência às diferentes classes sociais presentes na sociedade brasileira Resposta correta e explicação aqui: Vídeo 33
  32. 32. « QG RESOLVE » No século XVIII, durante a Revolução Francesa, Saint Domingue, uma pequena colônia na América Central, rebelou-se contra sua metrópole, dando início à luta pela independência do Haiti, em um processo diferente daqueles que ocorreram nas demais colônias do continente americano. Aponte uma proposta da Revolução Francesa que influenciou a independência do Haiti e a principal diferença entre este processo e as outras lutas pela independência das colônias americanas. Resposta correta e explicação aqui: Vídeo (UEL 2011) Você tem um dinheiro a receber em pagamentos mensais. Se você recebesse R$ 100,00 no primeiro pagamento e, a partir do segundo pagamento, recebesse R$ 150,00 a mais do que no pagamento anterior, você receberia todo o dinheiro em 9 pagamentos. Porém, se o valor do primeiro pagamento fosse mantido, mas, a partir do segundo pagamento, você recebesse o dobro do que recebeu no mês anterior, em quantos pagamentos receberia todo o dinheiro? a) 4 d) 10 b) 6 e) 12 c) 8 Resposta correta e explicação aqui: Vídeo 34
  33. 33. (Uerj 2013) A mutação no DNA de uma célula eucariota acar-retou a substituição no RNA mensageiro de uma proteína, da 15ª base nitrogenada por uma base C. A disposição de bases da porção inicial do RNA mensageiro da célula, antes de sua mutação, é apresentada a seguir: Início da tradução [ augcuucucaucuuuuuagcu Observe os códons correspondentes a alguns aminoácidos: Sabe-se que o códon de iniciação de leitura é AUG. A probabilidade de que a proteína a ser traduzida pelo RNA mensageiro da célula que sofreu mutação não apresente alterações na disposição de seus aminoácidos é de: a) 0 b) 0,25 c) 0,50 d) 1,00 Resposta correta e explicação aqui: Vídeo « QG RESOLVE » aminoácido codificado códon fenilalanina UUU fenilalanina UUC leucina UUA leucina UUG leucina CUC metionina AUG valina GUU valina GUA 35
  34. 34. As possíveis soluções mostradas por você refletirão seu conhecimento de mundo e a coerência com o que você já apresentou ao longo do texto.” * Carla Carmelita é professora de redação do QG do Enem. « QG RESOLVE » Tiro de Letra Carla Carmelita* As competências 4 e 5 Olá, pessoal! Bem, estamos chegando à reta final. Ansiedade e apreensão são as palavras do momento para muitos. Mas para você, que nos acompanha e estudou com o QG do Enem até aqui, o senti-mento é de expectativa para arrasar na produção textual. Para deixá-lo ainda mais seguro, vamos conversar um pouco sobre as competências 4 e 5 da redação do Enem. Na competência 4, exige-se que o candidato demonstre conhecimentos linguísti-cos necessários para a construção da argumentação, ou seja, será observada a estruturação lógica e formal entre as partes do texto. Diante disso, os avaliadores analisarão a organização tex-tual, a qual necessita que as frases e os parágrafos estabeleçam entre si uma relação que garanta a sequenciação coerente do texto e a interdependência entre as ideias. Esse encadeamento pode ser expresso por conjunções, por determinadas palavras ou pode ser inferido a partir da articulação dessas ideias. As-sim, para garantir a nota máxima na competência 4, deve-se utilizar variados recursos linguísticos, que garantam as relações de continuidade essenciais à elaboração de um texto coeso. A fim de alcançar a coesão textual, procure: • estruturar bem os parágrafos – lembre-se de que eles apresen-tam uma estrutura básica (tópico frasal + ideias complementa-res + fechamento); • estruturar bem os períodos – evite períodos longos, eles rami-ficam- se em muitas frases, as quais dificultam a compreensão; • cuidado com a referenciação – para ter êxito nesse processo, 36
  35. 35. utilize a substituição de termos ou expressões por pronomes pessoais, possessivos e demonstrativos, advérbios que indicam localização, artigos; substituição de termos ou expressões por sinônimos, antônimos, hipônimos, hiperônimos, expressões resumitivas ou expressões metafóricas; • E, por fim, use e abuse dos conectivos, procurando diversifi-cá- los, é claro. Falando em fim, vamos para a competência 5. Esse item ava-liativo exige que você elabore uma proposta de intervenção (possíveis soluções) para o problema apresentado no tema. As-sim, é bom atentar para a seguinte questão: a sua proposta de intervenção na vida social deve ter uma relação direta com os pontos abordados na argumentação do seu texto, deve manter vínculo direto com a tese desenvolvida e coerência com os ar-gumentos utilizados. Não esqueça também que essa proposta precisa ser detalhada, permitindo ao leitor o julgamento sobre sua possibilidade de ser implementada, ou seja, se ela é exequível. Com isso, deve conter a exposição da intervenção sugerida e o detalhamento dos meios para realizá-la. As possíveis soluções mostradas por você refletirão seu conhecimento de mundo e a coerência com o que você já apresentou ao longo do texto. Nada de ideias mi-rabolantes ou utópicas... Foque no mundo real e na possibilida-de de transformar suas sugestões em realidade. Nessa fase final da sua produção textual, procure fazer um fe-chamento que respeite os direitos humanos, que não rompa com valores como cidadania, liberdade, solidariedade e diver-sidade cultural, as leis e as normas vigentes no país, assim como a moral e os bons costumes. O respeito é a palavra de ordem para esta competência. Pessoal, espero, de coração, ter ajudado a todos vocês nesta co-luna. Desejo uma boa prova e que tudo que foi lido, tudo que foi trabalhado seja lembrado na hora do exame. Não tenham medo. Estou torcendo por vocês! Boa prova e até a próxima. 37
  36. 36. « tipo assim » Bruno Miranda* O Enem já acontece mês que vem e eu lembro do dia em que fiz a minha prova como se fosse ano passado... Talvez seja porque eu realmente tenha feito no ano passado. Eu estava lembrando dessa época enquanto eu viajava nessas férias da faculdade para conhecer o QG em Recife. No ano anterior, eu não fazia a MENOR IDEIA do que iria acontecer da minha vida no próximo ano. Eu já tinha meu curso decidido: jornalismo! Mas vai que eu não passo? Vai que eu nem saio do ensino médio?! Como eu poderia sobreviver a mais um ano de matemática? Além de que, a cada ano, as letras passam a se misturar ainda mais com os números nas con-tas... Sério, eu acredito que, se tivesse mais um ano de ensino mé-dio, a matemática ia ter só letras (e talvez eu começasse a entender alguma coisa). O que me deixou determinado a estudar para conseguir entrar na universidade foi ver meus colegas mais inteligentes estudando tanto quanto eu. Eu pensei: eu preciso estudar bastante para que possamos continuar juntos na faculdade! Mentira. Eu só pensava: vocês não vão roubar minha vaga! Estou brincando, entrar na faculdade não é igual à Guerra dos Tro-nos, onde o Trono de Ferro é a vaga e você precisa eliminar os seus adversários. Se você se preparar bem, vai dar tudo certo. A guerra mesmo começa depois de entrar na faculdade. Mas acabou que deu tudo certo pra mim. Consegui uma boa mé-dia no Enem e comecei a estudar este ano. Valeu a pena o esforço! Valeu a pena também espalhar o boato que os dias do Enem ti-nham sido trocados para todos os meus colegas inteligentes. Uma pena que eles não tenham conseguido fazer a prova. Mas acabou que deu tudo certo pra mim. Consegui uma boa média no Enem e comecei a estudar este ano. Valeu a pena o esforço!” Acesse * Bruno Miranda é vlogueiro do Minha Estante (www.youtube.com/ minhaestante). Esta coluna não representa, necessariamente, a opinião desta publicação ou de seus editores. A Guerra do vestibular 38
  37. 37. « tipo assim » Política pode parecer chato e complicado, mas, se você não entender, nunca será capaz de propor algo melhor.” Acesse * Luisa Clasen é vlogueira do Lully de Verdade (www.youtube.com/ lullydeverdade). Esta coluna não representa, necessariamente, a opinião desta publicação ou de seus editores. Luisa Clasen* Você e as eleições Em época de eleição, outubro se torna o mês dos debates quentes. Temas polêmicos vêm à tona para o grande público e chega a hora de tomar uma decisão. Se você ainda não vota, não se iluda: você tem, sim, que se informar sobre os candidatos e é bem interessante que desde já tenha uma opinião formada sobre o assunto. (Neste vídeo eu dei umas dicas sobre como escolher seu candidato...) Política pode parecer chato e complicado, mas, se você não en-tender, nunca será capaz de propor algo melhor. Já falei isso num texto sobre as manifestações de julho de 2013: tanta gente pro-testando sem saber pelo quê. Era por 20 centavos e mais várias outras coisas, mas como resolver? Quase ninguém sabia explicar. É importante entender que, por exemplo, o governo destina de-terminadas verbas para diferentes setores. É por isso que a gente vê dinheiro “sobrando” pra algumas coisas e faltando pra outras. Essa também é a razão pela qual é impossível “cancelar” a verba de X para destinar a Y. Na hora de escolher em quem votar, pense no que é bom pra todo mundo, sem esquecer de você. Você acha que é importante haver investimento em pesquisa, cultura, meio-ambiente? É lógico que precisamos de hospitais, policiamento, mas a SUA opinião im-porta, e é por isso que, a cada dois anos, o país INTEIRO é con-sultado. Esse é o momento de dizer quem é que vai responder em seu nome sobre as questões no país. Aproveite que estamos em ano de eleições e organize debates em sala de aula ou grupos de discussão para que cada um tenha que defender um lado dentre os candidatos. Dessa forma, você fica informado sobre todas as propostas e ainda aprende sobre retóri-ca e argumentação, já que seu grupo provavelmente vai precisar defender alguém com quem não concorda 100%. 39

×