SlideShare uma empresa Scribd logo
Regents Biology
Transcrição e tradução
Regents Biology
Síntese de proteínas
Fazendo proteínas
Regents Biology
 Corpos são feitos de células
 Todas as células operam com várias
instruções estipuladas no DNA
Corpos dos seres vivos→ cells → DNA
Regents Biology
 Como o DNA faz células & corpos?
 Como as células e corpos são feito a
partir de instruções do DNA?
DNA → Células → Corpos
Regents Biology
 DNA tem a informação para construir
as proteins
 genes
DNA → Proteínas → Células → Corpos
proteínas
células
corpos
DNA tem toda a fama,
Proteínas fazem todo o
trabalho
Regents Biology
Como as proteínas fazem todo o trabalho
 Proteínas
 proteínas controlam organismos vivos
 enzimas
 Controle de todas as reações químicas dos
seres vivos
 structure
 Todos os seres vivos são feitos de proteínas
Regents Biology
citoplasma
núcleo
Organização celular
 DNA
 DNA está dentro do núcleo
 genes = instruções para fazer proteínas
 Precisa ser mantido lá = proteção
 “trancada no cofre”
Regents Biology
Organização celular
 Proteínas
 Cadeias de aminoácidos
 Feitas pela “fábrica de proteína” no citoplasma
 Fábrica de proteína = ribosoma
núcleo
citoplasma
ribossoma
Proteínas
construídas
Regents Biology
Passando a informação do DNA
 É necessário buscar a informação no
gene
 Do núcleo para o citoplasma
 É preciso uma cópia do DNA
 RNA mensageiro
núcleo
citoplasma
ribosoma
RNAm
Proteínas
construídas
Regents Biology
RNAm
Do núcleo para o citoplasma
DNA
transcrição
núcleo
citoplasma
tradução
anticorpos
proteína
Regents Biology
DNA vs. RNA
DNA
 desoxirribose
açúcar
 bases nitrogenadas
 G, C, A, T
 T : A
 C : G
 dupla fita
RNA
 ribose açúcar
 bases nitrogenadas
 G, C, A, U
 U : A
 C : G
 Única fita
Regents Biology
Transcrição – síntese de RNA
 Fazendo RNAm a partir do DNA
 Uma fita de DNA
é o modelo
 Par de bases
 U : A
 G : C
 Enzima
 RNA polimerase
Regents Biology
Pareamento de bases de DNA & RNA
 Dupla fita de DNA
A G GGGGGT T A C A C T T T T TC C C CA A
Regents Biology
Pareamento de bases de DNA & RNA
 A dupla fita de DNA se abre
A G GGGGGT T A C A C T T T T TC C C CA A
Regents Biology
Pareamento de bases de DNA & RNA
 uma das fitas de DNA é
usada
 bases de RNA pareiam com
bases de DNA
U
A G GGGGGT T A C A C T T T T TC C C CA A
U
U
U
U
U
G
G
A
A
A C C
RNA
polymerase
C
C
C
C
C
G
G
G
G
A
A
A
A
A
Regents Biology
Pareamento de bases de DNA & RNA
 U ao invés de T é pareado com A
G C A C A T T T A C G T A C GDNA
G C G U G U A A A U G C A U G CmRNA
U C CCCCCA A U G U G A A A A AG G G GU U
Regents Biology
O RNA vai para o citoplasma
U C CCCCCA A U G U G A A A A AG G G GU U
ribosome
Regents Biology
Processamento de RNAm
Regents Biology
Splicing alternativo
Regents Biology
proteína
citoplasma
núcleo
hormônios
U C CCCCCA A U G U G A A A A AG G G GU U
ribosoma
Regents Biology
Como o RNAm codifica proteínas
 RNAm sai do núcleo
 RNAm encontra ribosomos no citoplasma
 Proteins são construídas a partir de
instruções do RNAm
aa aa aa aa aa aa aa aa
Como?
mRNA
U C CCCCCA A U G U G A A A A AG G G GU U
Regents Biology
Como o RNAm codifica proteínas?
TACGCACATTTACGTACGCGGDNA
AUGCGUGUAAAUGCAUGCGCCmRNA
Met Arg Val Asn Ala Cys Alaproteína
?
Como você pode cofificar 20 aminoácidos
com somente 4 bases de RNA (A,U,G,C)?
ribosome
aa aa aa aa aa aa aa aa
Regents Biology
AUGCGUGUAAAUGCAUGCGCCmRNA
mRNA codifica proteínas em trincas
TACGCACATTTACGTACGCGGDNA
AUGCGUGUAAAUGCAUGCGCCmRNA
proteína
?
 Códon = bloco de 3 bases de RNAm
códon
ribosoma
MetArgValAsnAlaCysAla
Regents Biology
 Para TODOS seres
vivos!
 Forte suporte para
origem comum de todos
os seres vivos
 O código é degenerado
 Vários códons para
 cada aminoácido
 Seguro para mutação !
 Códon de início
 AUG
 methionine
 Codons de parada
 UGA, UAA, UAG
O código de mRNA
Regents Biology
ribossoma
Como os códons combinam com
os aminoácidos?
AUGCGUGUAAAUGCAUGCGCCmRNA
anticódon
códon
tRNA
UAC
Met
GCA
Arg CAU
Val
Amino-
ácido
Regents Biology
ribossoma
Pareamento códon e anticódon
AUGCGUGUAAAUGCAUGCGCC
UAC
Met
GCA
Arg
CAU
Val
UUA
leu
Regents Biology
ribossoma
Pareamento códon e anticódon
AUGCGUGUAAAUGCAUGCUGA
Met
Arg
CAU
Val
UUA
leuCGU
ArgACG
Cis
ACU
FIM
Regents Biology
mRNA para proteína = Tradução
 As instruções de como fazer→ mRNA
 O leitor → ribossoma
 O transportador → RNA transportador
(tRNA)
mRNA
U C CCCCCA A U G U G A A A A AG G G GU U
aa
tRNA
GGU
aa
tRNA
U A C
aa
tRNA
GA C
tRNA
aa
A GU
ribossoma
Regents Biology
aa
aa
aa
aa
aa
aa
aa
mRNA
Do gene para proteína
DNA
transcrição
núcleo
citoplasma
proteína
tradução
enzimas
U C CCCCCA A U G U G A A A A AG G G GU U
ribosome
tRNAaa
Regents Biology
proteína
transcrição
citoplasma
núcleo
tradução
hemoglobina
Regents Biology
Do gene para proteina
transcriptiontranscription
translationtranslation
proteinprotein
Regents Biology
Assista aos videos…
 http://www.youtube.com/watch?v=h3b9Arup
 https://www.youtube.com/watch?
v=rD9sDfvOxy8
Regents Biology
Shiii!
Veja o que acontece quando
seus genes não funcionam
bem!
Regents Biology
Mutação Gênica – não correção de
emparelhamentos errados
Regents Biology
G C A C A T T T A C G T A C GDNA
G C G U G U A A A U G C A U G C
DNA
RNA
RNA
Met Arg Leu Asp Ala Cis Ala
Iso Ala Cis Lis Cis Met Cis
Regents Biology
Regents Biology
Antibióticos e síntese proteica das bactérias
O ribossomo da bactéria é diferente do
ribossomo do eucarionte

Mais conteúdo relacionado

Mais procurados

Dna e RNA
Dna e RNADna e RNA
Dna e RNA
Maysa Caldas
 
4 Mutae E Reparo 1194453935533277 1[1]
4 Mutae E Reparo 1194453935533277 1[1]4 Mutae E Reparo 1194453935533277 1[1]
4 Mutae E Reparo 1194453935533277 1[1]
Eunice Palma
 
1EM #23 Transcrição e Tradução
1EM #23 Transcrição e Tradução1EM #23 Transcrição e Tradução
1EM #23 Transcrição e Tradução
Professô Kyoshi
 
Genética
GenéticaGenética
Genética
NICKSON ♥
 
07 mutação e reparo do dna
07 mutação e reparo do dna07 mutação e reparo do dna
07 mutação e reparo do dna
Eliane Cardoso
 
Alteração química do dna
Alteração química do dnaAlteração química do dna
Alteração química do dna
Alexandre Queiroz
 
áCidos nucléicos dna e rna
áCidos nucléicos   dna e rnaáCidos nucléicos   dna e rna
áCidos nucléicos dna e rna
Silvana Sanches
 
Biologia gabarito 173 a 175 e links
Biologia gabarito 173 a 175 e linksBiologia gabarito 173 a 175 e links
Biologia gabarito 173 a 175 e links
ManuEmbu
 
Dna, rna, síntese protéica
Dna, rna, síntese protéicaDna, rna, síntese protéica
Dna, rna, síntese protéica
Larissa Yamazaki
 
Replicação do dna
Replicação do dnaReplicação do dna
Replicação do dna
Diogo Costa
 
Tradução - síntese proteica
Tradução - síntese proteicaTradução - síntese proteica
Tradução - síntese proteica
ceap
 
Aula5 dna duplicação
Aula5  dna duplicaçãoAula5  dna duplicação
Aula5 dna duplicação
Adila Trubat
 
Dna e sintese proteínas
Dna e sintese proteínasDna e sintese proteínas
Dna e sintese proteínas
César Milani
 
Transcrição e tradução
Transcrição e traduçãoTranscrição e tradução
Transcrição gênica
Transcrição gênicaTranscrição gênica
Transcrição gênica
Alpha Colégio e Vestibulares
 
Dna, rna e síntese proteíca
Dna, rna e síntese proteícaDna, rna e síntese proteíca
Dna, rna e síntese proteíca
LarissaComparini
 
Ácidos Nucléicos (DNA e RNA)
Ácidos Nucléicos (DNA e RNA)Ácidos Nucléicos (DNA e RNA)
Ácidos Nucléicos (DNA e RNA)
Gabriel Resende
 
ReplicaçãO Do Dna
ReplicaçãO Do DnaReplicaçãO Do Dna
ReplicaçãO Do Dna
Cidalia Aguiar
 
3EM #16 Revisão: Dna à proteína
3EM #16 Revisão: Dna à proteína3EM #16 Revisão: Dna à proteína
3EM #16 Revisão: Dna à proteína
Professô Kyoshi
 
Genes apresentação
Genes   apresentaçãoGenes   apresentação
Genes apresentação
Turma Olímpica
 

Mais procurados (20)

Dna e RNA
Dna e RNADna e RNA
Dna e RNA
 
4 Mutae E Reparo 1194453935533277 1[1]
4 Mutae E Reparo 1194453935533277 1[1]4 Mutae E Reparo 1194453935533277 1[1]
4 Mutae E Reparo 1194453935533277 1[1]
 
1EM #23 Transcrição e Tradução
1EM #23 Transcrição e Tradução1EM #23 Transcrição e Tradução
1EM #23 Transcrição e Tradução
 
Genética
GenéticaGenética
Genética
 
07 mutação e reparo do dna
07 mutação e reparo do dna07 mutação e reparo do dna
07 mutação e reparo do dna
 
Alteração química do dna
Alteração química do dnaAlteração química do dna
Alteração química do dna
 
áCidos nucléicos dna e rna
áCidos nucléicos   dna e rnaáCidos nucléicos   dna e rna
áCidos nucléicos dna e rna
 
Biologia gabarito 173 a 175 e links
Biologia gabarito 173 a 175 e linksBiologia gabarito 173 a 175 e links
Biologia gabarito 173 a 175 e links
 
Dna, rna, síntese protéica
Dna, rna, síntese protéicaDna, rna, síntese protéica
Dna, rna, síntese protéica
 
Replicação do dna
Replicação do dnaReplicação do dna
Replicação do dna
 
Tradução - síntese proteica
Tradução - síntese proteicaTradução - síntese proteica
Tradução - síntese proteica
 
Aula5 dna duplicação
Aula5  dna duplicaçãoAula5  dna duplicação
Aula5 dna duplicação
 
Dna e sintese proteínas
Dna e sintese proteínasDna e sintese proteínas
Dna e sintese proteínas
 
Transcrição e tradução
Transcrição e traduçãoTranscrição e tradução
Transcrição e tradução
 
Transcrição gênica
Transcrição gênicaTranscrição gênica
Transcrição gênica
 
Dna, rna e síntese proteíca
Dna, rna e síntese proteícaDna, rna e síntese proteíca
Dna, rna e síntese proteíca
 
Ácidos Nucléicos (DNA e RNA)
Ácidos Nucléicos (DNA e RNA)Ácidos Nucléicos (DNA e RNA)
Ácidos Nucléicos (DNA e RNA)
 
ReplicaçãO Do Dna
ReplicaçãO Do DnaReplicaçãO Do Dna
ReplicaçãO Do Dna
 
3EM #16 Revisão: Dna à proteína
3EM #16 Revisão: Dna à proteína3EM #16 Revisão: Dna à proteína
3EM #16 Revisão: Dna à proteína
 
Genes apresentação
Genes   apresentaçãoGenes   apresentação
Genes apresentação
 

Semelhante a Cap 13

Aulamolecular2 120606181016-phpapp01
Aulamolecular2 120606181016-phpapp01Aulamolecular2 120606181016-phpapp01
Aulamolecular2 120606181016-phpapp01
Leriaagro
 
áCidos nucléicos o código da vida und 3
áCidos nucléicos  o código da vida und 3áCidos nucléicos  o código da vida und 3
áCidos nucléicos o código da vida und 3
César Milani
 
A genética molecular 1 e
A genética molecular   1 eA genética molecular   1 e
A genética molecular 1 e
César Milani
 
Aula dna 2015
Aula dna 2015Aula dna 2015
Aula dna 2015
Andre Luiz Nascimento
 
Natureza do material genético
Natureza do material genético Natureza do material genético
Natureza do material genético
URCA
 
Estrutura do gene
Estrutura do geneEstrutura do gene
Estrutura do gene
Mateus Mondin
 
Acidos nucleicos
Acidos nucleicosAcidos nucleicos
Acidos nucleicos
Erica Cristina
 
áCidos nucleicos dna e rna
áCidos nucleicos  dna e rnaáCidos nucleicos  dna e rna
áCidos nucleicos dna e rna
SONALI NASCIMENTO
 
ÁCIDOS NUCLEICOS-PARTE 1
ÁCIDOS NUCLEICOS-PARTE 1ÁCIDOS NUCLEICOS-PARTE 1
ÁCIDOS NUCLEICOS-PARTE 1
César Milani
 
Acidosnucleicos
AcidosnucleicosAcidosnucleicos
Acidosnucleicos
Iuri Fretta Wiggers
 
Acidosnucleicos
AcidosnucleicosAcidosnucleicos
1 s äcidos nucleicos_maio
1 s äcidos nucleicos_maio1 s äcidos nucleicos_maio
1 s äcidos nucleicos_maio
Ionara Urrutia Moura
 
ESPECÍFICA REPLIC TRANSC E TRAD
ESPECÍFICA REPLIC TRANSC E TRADESPECÍFICA REPLIC TRANSC E TRAD
ESPECÍFICA REPLIC TRANSC E TRAD
MARCIAMP
 
BioquÍMica 5 ÁCidos NuclÉIcos E CÓDigo GenÉTico
BioquÍMica 5   ÁCidos NuclÉIcos E CÓDigo GenÉTicoBioquÍMica 5   ÁCidos NuclÉIcos E CÓDigo GenÉTico
BioquÍMica 5 ÁCidos NuclÉIcos E CÓDigo GenÉTico
Diego Yamazaki Bolano
 
BioquíMica 5 áCidos NucléIcos E CóDigo GenéTico
BioquíMica 5   áCidos NucléIcos E CóDigo GenéTicoBioquíMica 5   áCidos NucléIcos E CóDigo GenéTico
BioquíMica 5 áCidos NucléIcos E CóDigo GenéTico
guest67130e
 
Núcleo e a síntese protéica
Núcleo e a síntese protéicaNúcleo e a síntese protéica
Núcleo e a síntese protéica
URCA
 
Metabolismo dos nucleotídeos
Metabolismo dos nucleotídeosMetabolismo dos nucleotídeos
Metabolismo dos nucleotídeos
Biomedicina
 
1 s äcidos nucl[eicos_maio 2012
1 s äcidos nucl[eicos_maio 20121 s äcidos nucl[eicos_maio 2012
1 s äcidos nucl[eicos_maio 2012
CotucaAmbiental
 
Acidosnucleicos
AcidosnucleicosAcidosnucleicos
Acidosnucleicos
Iuri Fretta Wiggers
 
aula-4-nucleo-dogma-centra nucleo cel.pptx
aula-4-nucleo-dogma-centra nucleo cel.pptxaula-4-nucleo-dogma-centra nucleo cel.pptx
aula-4-nucleo-dogma-centra nucleo cel.pptx
Larissa Paiva
 

Semelhante a Cap 13 (20)

Aulamolecular2 120606181016-phpapp01
Aulamolecular2 120606181016-phpapp01Aulamolecular2 120606181016-phpapp01
Aulamolecular2 120606181016-phpapp01
 
áCidos nucléicos o código da vida und 3
áCidos nucléicos  o código da vida und 3áCidos nucléicos  o código da vida und 3
áCidos nucléicos o código da vida und 3
 
A genética molecular 1 e
A genética molecular   1 eA genética molecular   1 e
A genética molecular 1 e
 
Aula dna 2015
Aula dna 2015Aula dna 2015
Aula dna 2015
 
Natureza do material genético
Natureza do material genético Natureza do material genético
Natureza do material genético
 
Estrutura do gene
Estrutura do geneEstrutura do gene
Estrutura do gene
 
Acidos nucleicos
Acidos nucleicosAcidos nucleicos
Acidos nucleicos
 
áCidos nucleicos dna e rna
áCidos nucleicos  dna e rnaáCidos nucleicos  dna e rna
áCidos nucleicos dna e rna
 
ÁCIDOS NUCLEICOS-PARTE 1
ÁCIDOS NUCLEICOS-PARTE 1ÁCIDOS NUCLEICOS-PARTE 1
ÁCIDOS NUCLEICOS-PARTE 1
 
Acidosnucleicos
AcidosnucleicosAcidosnucleicos
Acidosnucleicos
 
Acidosnucleicos
AcidosnucleicosAcidosnucleicos
Acidosnucleicos
 
1 s äcidos nucleicos_maio
1 s äcidos nucleicos_maio1 s äcidos nucleicos_maio
1 s äcidos nucleicos_maio
 
ESPECÍFICA REPLIC TRANSC E TRAD
ESPECÍFICA REPLIC TRANSC E TRADESPECÍFICA REPLIC TRANSC E TRAD
ESPECÍFICA REPLIC TRANSC E TRAD
 
BioquÍMica 5 ÁCidos NuclÉIcos E CÓDigo GenÉTico
BioquÍMica 5   ÁCidos NuclÉIcos E CÓDigo GenÉTicoBioquÍMica 5   ÁCidos NuclÉIcos E CÓDigo GenÉTico
BioquÍMica 5 ÁCidos NuclÉIcos E CÓDigo GenÉTico
 
BioquíMica 5 áCidos NucléIcos E CóDigo GenéTico
BioquíMica 5   áCidos NucléIcos E CóDigo GenéTicoBioquíMica 5   áCidos NucléIcos E CóDigo GenéTico
BioquíMica 5 áCidos NucléIcos E CóDigo GenéTico
 
Núcleo e a síntese protéica
Núcleo e a síntese protéicaNúcleo e a síntese protéica
Núcleo e a síntese protéica
 
Metabolismo dos nucleotídeos
Metabolismo dos nucleotídeosMetabolismo dos nucleotídeos
Metabolismo dos nucleotídeos
 
1 s äcidos nucl[eicos_maio 2012
1 s äcidos nucl[eicos_maio 20121 s äcidos nucl[eicos_maio 2012
1 s äcidos nucl[eicos_maio 2012
 
Acidosnucleicos
AcidosnucleicosAcidosnucleicos
Acidosnucleicos
 
aula-4-nucleo-dogma-centra nucleo cel.pptx
aula-4-nucleo-dogma-centra nucleo cel.pptxaula-4-nucleo-dogma-centra nucleo cel.pptx
aula-4-nucleo-dogma-centra nucleo cel.pptx
 

Mais de Professora Raquel

Tipos de ovos
Tipos de ovosTipos de ovos
Tipos de ovos
Professora Raquel
 
Alterações cromossomiais 2016
Alterações cromossomiais 2016Alterações cromossomiais 2016
Alterações cromossomiais 2016
Professora Raquel
 
Duplicação, transcrição e tradução
Duplicação, transcrição e traduçãoDuplicação, transcrição e tradução
Duplicação, transcrição e tradução
Professora Raquel
 
Duplicação, transcrição e tradução
Duplicação, transcrição e traduçãoDuplicação, transcrição e tradução
Duplicação, transcrição e tradução
Professora Raquel
 
Cap 13
Cap 13Cap 13
Alterações cromossomiais 2016
Alterações cromossomiais 2016Alterações cromossomiais 2016
Alterações cromossomiais 2016
Professora Raquel
 
Núcleo cromatina e cromossomo
Núcleo cromatina e cromossomoNúcleo cromatina e cromossomo
Núcleo cromatina e cromossomo
Professora Raquel
 
Mitose e meiose
Mitose e meioseMitose e meiose
Mitose e meiose
Professora Raquel
 
Poríferos e cnidários
Poríferos e cnidáriosPoríferos e cnidários
Poríferos e cnidários
Professora Raquel
 
Platyhelminthes e nematoda
Platyhelminthes e nematodaPlatyhelminthes e nematoda
Platyhelminthes e nematoda
Professora Raquel
 
Introdução ao reino animal
Introdução ao reino animalIntrodução ao reino animal
Introdução ao reino animal
Professora Raquel
 
Fotossíntese e quimiossíntese
Fotossíntese e quimiossínteseFotossíntese e quimiossíntese
Fotossíntese e quimiossíntese
Professora Raquel
 
Respiração celular e fermentação
Respiração celular e fermentaçãoRespiração celular e fermentação
Respiração celular e fermentação
Professora Raquel
 
Parte escrita metabolismo
Parte escrita metabolismoParte escrita metabolismo
Parte escrita metabolismo
Professora Raquel
 
Ferramentas do metabolismo
Ferramentas do metabolismoFerramentas do metabolismo
Ferramentas do metabolismo
Professora Raquel
 
Horta escolar eixo_gerador_dinamicas_comunitarias
Horta escolar eixo_gerador_dinamicas_comunitariasHorta escolar eixo_gerador_dinamicas_comunitarias
Horta escolar eixo_gerador_dinamicas_comunitarias
Professora Raquel
 
Educando horta escolas_gastronomia
Educando horta escolas_gastronomiaEducando horta escolas_gastronomia
Educando horta escolas_gastronomia
Professora Raquel
 
Capítulo 9
Capítulo 9Capítulo 9
Capítulo 9
Professora Raquel
 
Cap 8
Cap 8Cap 8
Cap 2 e 7
Cap 2 e 7Cap 2 e 7

Mais de Professora Raquel (20)

Tipos de ovos
Tipos de ovosTipos de ovos
Tipos de ovos
 
Alterações cromossomiais 2016
Alterações cromossomiais 2016Alterações cromossomiais 2016
Alterações cromossomiais 2016
 
Duplicação, transcrição e tradução
Duplicação, transcrição e traduçãoDuplicação, transcrição e tradução
Duplicação, transcrição e tradução
 
Duplicação, transcrição e tradução
Duplicação, transcrição e traduçãoDuplicação, transcrição e tradução
Duplicação, transcrição e tradução
 
Cap 13
Cap 13Cap 13
Cap 13
 
Alterações cromossomiais 2016
Alterações cromossomiais 2016Alterações cromossomiais 2016
Alterações cromossomiais 2016
 
Núcleo cromatina e cromossomo
Núcleo cromatina e cromossomoNúcleo cromatina e cromossomo
Núcleo cromatina e cromossomo
 
Mitose e meiose
Mitose e meioseMitose e meiose
Mitose e meiose
 
Poríferos e cnidários
Poríferos e cnidáriosPoríferos e cnidários
Poríferos e cnidários
 
Platyhelminthes e nematoda
Platyhelminthes e nematodaPlatyhelminthes e nematoda
Platyhelminthes e nematoda
 
Introdução ao reino animal
Introdução ao reino animalIntrodução ao reino animal
Introdução ao reino animal
 
Fotossíntese e quimiossíntese
Fotossíntese e quimiossínteseFotossíntese e quimiossíntese
Fotossíntese e quimiossíntese
 
Respiração celular e fermentação
Respiração celular e fermentaçãoRespiração celular e fermentação
Respiração celular e fermentação
 
Parte escrita metabolismo
Parte escrita metabolismoParte escrita metabolismo
Parte escrita metabolismo
 
Ferramentas do metabolismo
Ferramentas do metabolismoFerramentas do metabolismo
Ferramentas do metabolismo
 
Horta escolar eixo_gerador_dinamicas_comunitarias
Horta escolar eixo_gerador_dinamicas_comunitariasHorta escolar eixo_gerador_dinamicas_comunitarias
Horta escolar eixo_gerador_dinamicas_comunitarias
 
Educando horta escolas_gastronomia
Educando horta escolas_gastronomiaEducando horta escolas_gastronomia
Educando horta escolas_gastronomia
 
Capítulo 9
Capítulo 9Capítulo 9
Capítulo 9
 
Cap 8
Cap 8Cap 8
Cap 8
 
Cap 2 e 7
Cap 2 e 7Cap 2 e 7
Cap 2 e 7
 

Último

Texto e atividade - O que fazemos com a água que usamos.
Texto e atividade -  O que fazemos com a água que usamos.Texto e atividade -  O que fazemos com a água que usamos.
Texto e atividade - O que fazemos com a água que usamos.
Mary Alvarenga
 
A experiência do professor. Publicado EM 08.07.2024
A experiência do professor. Publicado EM 08.07.2024A experiência do professor. Publicado EM 08.07.2024
A experiência do professor. Publicado EM 08.07.2024
Espanhol Online
 
Mini livro sanfona - Minha Escola Tem História.
Mini livro  sanfona - Minha Escola Tem História. Mini livro  sanfona - Minha Escola Tem História.
Mini livro sanfona - Minha Escola Tem História.
Mary Alvarenga
 
Relatório de Atividades 2011 CENSIPAM.pdf
Relatório de Atividades 2011 CENSIPAM.pdfRelatório de Atividades 2011 CENSIPAM.pdf
Relatório de Atividades 2011 CENSIPAM.pdf
Falcão Brasil
 
1°ao5°ano_HISTÓRIA_ORGANIZADOR CURRICULAR BIMESTRAL (1) educação infantil fu...
1°ao5°ano_HISTÓRIA_ORGANIZADOR CURRICULAR BIMESTRAL (1)  educação infantil fu...1°ao5°ano_HISTÓRIA_ORGANIZADOR CURRICULAR BIMESTRAL (1)  educação infantil fu...
1°ao5°ano_HISTÓRIA_ORGANIZADOR CURRICULAR BIMESTRAL (1) educação infantil fu...
antonio carlos
 
Temática – Projeto para Empreendedores Locais
Temática – Projeto para Empreendedores LocaisTemática – Projeto para Empreendedores Locais
Temática – Projeto para Empreendedores Locais
Colaborar Educacional
 
Relatório de Atividades 2021/2022 CENSIPAM.pdf
Relatório de Atividades 2021/2022 CENSIPAM.pdfRelatório de Atividades 2021/2022 CENSIPAM.pdf
Relatório de Atividades 2021/2022 CENSIPAM.pdf
Falcão Brasil
 
CALENDÁRIO GRADUAÇÃO 2024-07ddddd-04 (1).pdf
CALENDÁRIO GRADUAÇÃO 2024-07ddddd-04 (1).pdfCALENDÁRIO GRADUAÇÃO 2024-07ddddd-04 (1).pdf
CALENDÁRIO GRADUAÇÃO 2024-07ddddd-04 (1).pdf
CristviaFerreira
 
IV Jornada Nacional Tableau - Apresentações.pptx
IV Jornada Nacional Tableau - Apresentações.pptxIV Jornada Nacional Tableau - Apresentações.pptx
IV Jornada Nacional Tableau - Apresentações.pptx
Ligia Galvão
 
Guia referencial de Apoio - Planejamento Escolar 2024.pdf
Guia referencial de Apoio - Planejamento Escolar 2024.pdfGuia referencial de Apoio - Planejamento Escolar 2024.pdf
Guia referencial de Apoio - Planejamento Escolar 2024.pdf
FLAVIOROBERTOGOUVEA
 
Apostila em LIBRAS - Curso Básico ENAP 2019.pdf
Apostila em LIBRAS - Curso Básico ENAP 2019.pdfApostila em LIBRAS - Curso Básico ENAP 2019.pdf
Apostila em LIBRAS - Curso Básico ENAP 2019.pdf
pattyhsilva271204
 
Acróstico - Bullying é crime!
Acróstico - Bullying é crime!Acróstico - Bullying é crime!
Acróstico - Bullying é crime!
Mary Alvarenga
 
Folha de Atividades (Virei Super-Herói! Projeto de Edição de Fotos) com Grade...
Folha de Atividades (Virei Super-Herói! Projeto de Edição de Fotos) com Grade...Folha de Atividades (Virei Super-Herói! Projeto de Edição de Fotos) com Grade...
Folha de Atividades (Virei Super-Herói! Projeto de Edição de Fotos) com Grade...
marcos oliveira
 
Licao de adultos Topico 1 CPAD edit.pptx
Licao de adultos Topico 1 CPAD edit.pptxLicao de adultos Topico 1 CPAD edit.pptx
Licao de adultos Topico 1 CPAD edit.pptx
jetroescola
 
Guerra de reconquista da Península ibérica
Guerra de reconquista da Península ibéricaGuerra de reconquista da Península ibérica
Guerra de reconquista da Península ibérica
felipescherner
 
Slides Lição 2, Betel, A Igreja e a relevância, para a adoração verdadeira no...
Slides Lição 2, Betel, A Igreja e a relevância, para a adoração verdadeira no...Slides Lição 2, Betel, A Igreja e a relevância, para a adoração verdadeira no...
Slides Lição 2, Betel, A Igreja e a relevância, para a adoração verdadeira no...
LuizHenriquedeAlmeid6
 
Slides Lição 2, CPAD, O Livro de Rute, 3Tr24.pptx
Slides Lição 2, CPAD, O Livro de Rute, 3Tr24.pptxSlides Lição 2, CPAD, O Livro de Rute, 3Tr24.pptx
Slides Lição 2, CPAD, O Livro de Rute, 3Tr24.pptx
LuizHenriquedeAlmeid6
 
oficia de construção de recursos para aluno DI.pdf
oficia de construção de recursos para aluno DI.pdfoficia de construção de recursos para aluno DI.pdf
oficia de construção de recursos para aluno DI.pdf
marcos oliveira
 
As Ideias Têm Consequências - Richard M. Weaver
As Ideias Têm Consequências - Richard M. WeaverAs Ideias Têm Consequências - Richard M. Weaver
As Ideias Têm Consequências - Richard M. Weaver
C4io99
 

Último (20)

Texto e atividade - O que fazemos com a água que usamos.
Texto e atividade -  O que fazemos com a água que usamos.Texto e atividade -  O que fazemos com a água que usamos.
Texto e atividade - O que fazemos com a água que usamos.
 
A experiência do professor. Publicado EM 08.07.2024
A experiência do professor. Publicado EM 08.07.2024A experiência do professor. Publicado EM 08.07.2024
A experiência do professor. Publicado EM 08.07.2024
 
Mini livro sanfona - Minha Escola Tem História.
Mini livro  sanfona - Minha Escola Tem História. Mini livro  sanfona - Minha Escola Tem História.
Mini livro sanfona - Minha Escola Tem História.
 
Relatório de Atividades 2011 CENSIPAM.pdf
Relatório de Atividades 2011 CENSIPAM.pdfRelatório de Atividades 2011 CENSIPAM.pdf
Relatório de Atividades 2011 CENSIPAM.pdf
 
1°ao5°ano_HISTÓRIA_ORGANIZADOR CURRICULAR BIMESTRAL (1) educação infantil fu...
1°ao5°ano_HISTÓRIA_ORGANIZADOR CURRICULAR BIMESTRAL (1)  educação infantil fu...1°ao5°ano_HISTÓRIA_ORGANIZADOR CURRICULAR BIMESTRAL (1)  educação infantil fu...
1°ao5°ano_HISTÓRIA_ORGANIZADOR CURRICULAR BIMESTRAL (1) educação infantil fu...
 
Temática – Projeto para Empreendedores Locais
Temática – Projeto para Empreendedores LocaisTemática – Projeto para Empreendedores Locais
Temática – Projeto para Empreendedores Locais
 
Relatório de Atividades 2021/2022 CENSIPAM.pdf
Relatório de Atividades 2021/2022 CENSIPAM.pdfRelatório de Atividades 2021/2022 CENSIPAM.pdf
Relatório de Atividades 2021/2022 CENSIPAM.pdf
 
CALENDÁRIO GRADUAÇÃO 2024-07ddddd-04 (1).pdf
CALENDÁRIO GRADUAÇÃO 2024-07ddddd-04 (1).pdfCALENDÁRIO GRADUAÇÃO 2024-07ddddd-04 (1).pdf
CALENDÁRIO GRADUAÇÃO 2024-07ddddd-04 (1).pdf
 
IV Jornada Nacional Tableau - Apresentações.pptx
IV Jornada Nacional Tableau - Apresentações.pptxIV Jornada Nacional Tableau - Apresentações.pptx
IV Jornada Nacional Tableau - Apresentações.pptx
 
Guia referencial de Apoio - Planejamento Escolar 2024.pdf
Guia referencial de Apoio - Planejamento Escolar 2024.pdfGuia referencial de Apoio - Planejamento Escolar 2024.pdf
Guia referencial de Apoio - Planejamento Escolar 2024.pdf
 
Apostila em LIBRAS - Curso Básico ENAP 2019.pdf
Apostila em LIBRAS - Curso Básico ENAP 2019.pdfApostila em LIBRAS - Curso Básico ENAP 2019.pdf
Apostila em LIBRAS - Curso Básico ENAP 2019.pdf
 
Acróstico - Bullying é crime!
Acróstico - Bullying é crime!Acróstico - Bullying é crime!
Acróstico - Bullying é crime!
 
Folha de Atividades (Virei Super-Herói! Projeto de Edição de Fotos) com Grade...
Folha de Atividades (Virei Super-Herói! Projeto de Edição de Fotos) com Grade...Folha de Atividades (Virei Super-Herói! Projeto de Edição de Fotos) com Grade...
Folha de Atividades (Virei Super-Herói! Projeto de Edição de Fotos) com Grade...
 
Licao de adultos Topico 1 CPAD edit.pptx
Licao de adultos Topico 1 CPAD edit.pptxLicao de adultos Topico 1 CPAD edit.pptx
Licao de adultos Topico 1 CPAD edit.pptx
 
Guerra de reconquista da Península ibérica
Guerra de reconquista da Península ibéricaGuerra de reconquista da Península ibérica
Guerra de reconquista da Península ibérica
 
Slides Lição 2, Betel, A Igreja e a relevância, para a adoração verdadeira no...
Slides Lição 2, Betel, A Igreja e a relevância, para a adoração verdadeira no...Slides Lição 2, Betel, A Igreja e a relevância, para a adoração verdadeira no...
Slides Lição 2, Betel, A Igreja e a relevância, para a adoração verdadeira no...
 
Slides Lição 2, CPAD, O Livro de Rute, 3Tr24.pptx
Slides Lição 2, CPAD, O Livro de Rute, 3Tr24.pptxSlides Lição 2, CPAD, O Livro de Rute, 3Tr24.pptx
Slides Lição 2, CPAD, O Livro de Rute, 3Tr24.pptx
 
oficia de construção de recursos para aluno DI.pdf
oficia de construção de recursos para aluno DI.pdfoficia de construção de recursos para aluno DI.pdf
oficia de construção de recursos para aluno DI.pdf
 
As Ideias Têm Consequências - Richard M. Weaver
As Ideias Têm Consequências - Richard M. WeaverAs Ideias Têm Consequências - Richard M. Weaver
As Ideias Têm Consequências - Richard M. Weaver
 
FOTOS_AS CIÊNCIAS EM AÇÃO .
FOTOS_AS CIÊNCIAS EM AÇÃO                .FOTOS_AS CIÊNCIAS EM AÇÃO                .
FOTOS_AS CIÊNCIAS EM AÇÃO .
 

Cap 13

Notas do Editor

  1. Strong evidence for a single origin in evolutionary theory.