Níveis de organização biológica            ExercícioOrdene as seguintes estruturas damais complexa para a mais simples    ...
Níveis de organização biológica  Organismo                             Ser HumanoSistema de órgãos                   Siste...
O ADN – símbolo de vida   O ADN, Ácido Desoxirribonucleico, é uma    molécula biológica universal presente em    todas as...
O ADN – símbolo de vida   O gene é um segmento de um cromossoma a    que corresponde um código distinto, uma    informaçã...
O ADN – símbolo de vida   O ADN é constituído por quatro tipos    de nucleótidos, unidade básica do    ADN: adenina (A) c...
O ADN – símbolo de vida      NG - Saberes Fundamentais
O ADN – símbolo de vida        O ADN tem a forma de uma escada de         corda enrolada helicoidalmente, ou seja,       ...
O ADN – símbolo de vida   Dentro da célula, o ADN pode ser    observado numa estrutura    chamada cromossoma, o    conjun...
O ADN – símbolo de vida   O cariótipo humano possui    46 cromossomas ou 23    pares. Metade dos    cromossomas presentes...
O ADN – símbolo de vida   Durante estes 50 anos, a dupla hélice do ADN    assumiu um papel cada vez mais importante na   ...
O ADN – símbolo de vida      NG - Saberes Fundamentais
Próximos SlideShares
Carregando em…5
×

Adn e hereditariedade

2.487 visualizações

Publicada em

0 comentários
0 gostaram
Estatísticas
Notas
  • Seja o primeiro a comentar

  • Seja a primeira pessoa a gostar disto

Sem downloads
Visualizações
Visualizações totais
2.487
No SlideShare
0
A partir de incorporações
0
Número de incorporações
455
Ações
Compartilhamentos
0
Downloads
25
Comentários
0
Gostaram
0
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Adn e hereditariedade

  1. 1. Níveis de organização biológica ExercícioOrdene as seguintes estruturas damais complexa para a mais simples Núcleo Órgãos ADN Organismo Tecidos Sistema de órgãos Células NG - Saberes Fundamentais
  2. 2. Níveis de organização biológica Organismo Ser HumanoSistema de órgãos Sistema Nervoso Órgãos Cérebro Tecidos Tecido nervoso Células Neurónio Núcleo Núcleo ADN ADN NG - Saberes Fundamentais
  3. 3. O ADN – símbolo de vida O ADN, Ácido Desoxirribonucleico, é uma molécula biológica universal presente em todas as células vivas. É no ADN que está contida toda a nossa informação genética, sob a forma de genes. O ADN é responsável pela transmissão das características hereditárias de cada espécie de ser vivo. NG - Saberes Fundamentais
  4. 4. O ADN – símbolo de vida O gene é um segmento de um cromossoma a que corresponde um código distinto, uma informação para produzir uma determinada proteína ou controlar uma característica, por exemplo, a cor dos olhos. O genoma é o conjunto de genes correspondente à informação genética de uma espécie. O genoma humano possui cerca de 25 000 genes. NG - Saberes Fundamentais
  5. 5. O ADN – símbolo de vida O ADN é constituído por quatro tipos de nucleótidos, unidade básica do ADN: adenina (A) com timina (T) e guanina (G) com citosina (C). Os nucleótidos são designados deste modo devido às bases azotadas que entram nas suas constituições. É possível ler a cadeia de ADN, obtendo-se uma sequência de letras, como por exemplo, ATGATTCTGTAGCCTGATCCC, a uma sequência completa de ADN dá- se o nome de genoma. NG - Saberes Fundamentais
  6. 6. O ADN – símbolo de vida NG - Saberes Fundamentais
  7. 7. O ADN – símbolo de vida  O ADN tem a forma de uma escada de corda enrolada helicoidalmente, ou seja, de uma hélice dupla  A estrutura, do ADN, foi proposta em 1953 por James Watson e Francis Crick.  A descoberta da estrutura do ADN abriu o caminho para se compreender como é que a informação genética é transmitida de progenitores para descendentes, ou de uma célula para outra, isto é, como funciona a hereditariedade. NG - Saberes FundamentaisDoc. 1
  8. 8. O ADN – símbolo de vida Dentro da célula, o ADN pode ser observado numa estrutura chamada cromossoma, o conjunto de cromossomas de uma célula forma o cariótipo. Antes da divisão celular os cromossomas são duplicados através de um processo chamado replicação. Eucariontes como animais, plantas e fungos têm o seu ADN dentro do núcleo enquanto que procariontes como as bactérias o têm disperso no citoplasma. NG - Saberes Fundamentais
  9. 9. O ADN – símbolo de vida O cariótipo humano possui 46 cromossomas ou 23 pares. Metade dos cromossomas presentes num indivíduo foram transmitidos pela mãe (através do óvulo) e a outra metade pelo pai biológico (através do espermatozóide). NG - Saberes Fundamentais
  10. 10. O ADN – símbolo de vida Durante estes 50 anos, a dupla hélice do ADN assumiu um papel cada vez mais importante na nossa sociedade. Os mecanismos da hereditariedade estão por trás dos avanços mais fantásticos e das polémicas mais aguerridas de hoje - dos organismos geneticamente modificados à clonagem. Além disso, o ADN tornou-se um ícone da cultura popular: é com certeza a molécula mais fotogénica de sempre. NG - Saberes Fundamentais
  11. 11. O ADN – símbolo de vida NG - Saberes Fundamentais

×