SlideShare uma empresa Scribd logo
SEQUENCIAMENTO DE
NOVA GERAÇÃO
Dr. Joseph Albert Medeiros Evaristo
Departamento de Genética-LIPB
CIG 2013
Sequenciamento de DNA
• É o processo de determinação da ordem precisa de nucleotídeos na
molécula de DNA.
• Inclui qualquer método ou tecnologia que é usada para determinar a ordem
das quatro bases nitrogenadas: Adenina, Guanina, Citosina e Timina
• Com o advento de métodos rápido de sequenciamento de DNA, grandes
descobertas e pesquisas médicas e biológicas tem sido aceleradas na última
década.
Evolução da revolução do DNA
Gerações de Seqüenciadores
3ª Geração
(single molecule)
Single Molecule Real Time –
SMRT
(Pacific Bioscience)
HeliScope (Helicos Bioscience)
454 (Roche)
2ª Geração
(amplificação clonal)
SOLiD (Life Technologies)
HiSeq2000, HiSeq2500, MiSeq
Illumina
Ion Torrent- PGM, Proton
(Life Technologies)
GridION-Oxford Nanopore
4ª Geração
(Post-Light)
1ª Geração
(clonagem)
Sanger
•Método de Sanger de sequenciamento
 Premio Nobel 1980
Sequenciamento Sanger
Obtenção das bibliotecas genômicas
Purificação do DNA
genômico
(qualidade e quantidade)
Fragmentação mecânica
do DNA genômico
(tamanhos variados)
Construção das Bibliotecas
de DNA genômico
(clonagem em plasmídios
bacterianos ou fagos)
• Vantagens
• Reads longos (~900bps)
• Desvantagens
• Baixo rendimento
• Alto custo
• DNA molde + dNTPs e ddNTPs + DNApolimerase + Primer
• Amplificação-PCR
• Eletroforese em Gel de acrilamida
• Os fragmentos migram distâncias proporcionais ao seu tamanho.
Leroy Hood
1ª Geração de sequenciadores automáticos
Automação do Sequenciamento
ABI PRISM 370 (1987)
Sanger Sequencing
•Eletroforese Capilar (1990)
•Eletroforese em gel
Sequenciamento de nova geração- Curso de Inverno de Genética 2013-UFPR by Joseph Evaristo
Completed genome projects (october/08)
Eukaryotes: 23 complete; 242 assembly, 224 in progress
Viruses: 2,129 complete
Bacteria: 714 complete
Archaea: 52 complete
Organellar: 1,709 complete
Metagenomics projects: 195
NATURE Vol 464 1 April 2010
NATURE Vol 464 1 April 2010
N AT U R E | VO L 4 7 0 | 1 0 F E B R U A RY 2 0 1 1
NEXT-GENERATION SEQUENCING (DEEP SEQUENCING)
PLATFORMS
1. Genome Analyzer IIx (GAIIx), HiSeq2000, HiSeq2500,
MiSeq – Illumina
2. Genome Sequencer FLX System (454) – Roche
3. SOLiD 5500xl System – Applied Biosystem
4. HeliScope™ Single Molecule Sequencer - Helicos
5. PacBio RS - Pacific Bioscience
6. Personal Genome Machine, Ion Proton - Ion Torrent
7. GridION, MinION – Oxford Nanopore
FIRST
GENERATION
TECHNOLOGY
(Sanger)
SECOND
GENERATION
TECHNOLOGY
(Clonal
Amplification)
Abordagens de seqüenciamento
Nature Biotechnol. 26,1135(2008)
Next Gen X Sanger
Sequenciamento de nova geração- Curso de Inverno de Genética 2013-UFPR by Joseph Evaristo
2001: Human Genome Project
2.7G$, 11 years
2001: Celera
100M$, 3 years
2007: 454
1M$, 3 months
2008: ABI SOLiD
60K$, 2 weeks
2009: Illumina,
Helicos
40-50K$ 2010: 5K$,
a few days?
2012: 1000$,
<24 hrs?
2ª Geração de seqüenciamento
• Genome Analyser - Seqüenciamento por término reversível
(Illumina-Solexa)
• 454 - Pirosequenciamento (Roche)
• SOLiD - Seqüenciamento por ligação de sondas (Applied
Biosystems - Life)
HiSeq 2000
Illumina
Produz acima de 600Gb por corrida em 13 dias.
Custo de resequenciar um genoma humano:
UNC-CH Genome Analysis Facilit - (30x cobertura)
aproximadamente $6,000
HiSeq 2500
Produz acima de 100Gb por corrida em 27h.
MiSeq
- Sistema de pequena capacidade
- PE 2x250cycles in 27hours.
• Lançada comercialmente em 2006
Seqüenciamento por término reversível :
Genome Analyzer
• Etapas:
1) Ligação de adaptadores
2) PCR em ponte (formação de clusters)
3) Seqüenciamento
1. Preparar DNA genômico
2. Ligar o DNA a superfície
3. Amplificação por ponte
4. Fragmentos se tornam
dupla fita
5. Desnaturar as moléculas
dupla fita
6. Amplificação completa
Fragmentação randômica do DNA e ligação
de adaptadores nas duas pontas de cada
fragmento.
Amplificação
1. Preparar DNA genômico
2. Ligar o DNA a superfície
3. Amplificação por ponte
4. Fragmentos se tornam
dupla fita
5. Desnaturar as moléculas
dupla fita
6. Amplificação completa
Ligação randômica dos fragmentos fita
simples à superfície dos canais da flow cell.
1. Preparar DNA genômico
2. Ligar o DNA a superfície
3. Amplificação por ponte
4. Fragmentos se tornam
dupla fita
5. Desnaturar as moléculas
dupla fita
6. Amplificação completa
Adição de nucleotídeos não marcados e
enzima para iniciar a amplificação por
ponte em fase sólida.
1. Preparar DNA genômico
2. Ligar o DNA a superfície
3. Amplificação por ponte
4. Fragmentos se tornam
dupla fita
5. Desnaturar as moléculas
dupla fita
6. Amplificação completa
A enzima incorpora nucleotídeos para
construir pontes de fita dupla na
superfície sólida.
1. Preparar DNA genômico
2. Ligar o DNA a superfície
3. Amplificação por ponte
4. Fragmentos se tornam
dupla fita
5. Desnaturar as moléculas
dupla fita
6. Amplificação completa
Desnaturação deixa os DNA moldes fita
simples ancorados ao substrato sólido.
1. Preparar DNA genômico
2. Ligar o DNA a superfície
3. Amplificação por ponte
4. Fragmentos se tornam
dupla fita
5. Desnaturar as moléculas
dupla fita
6. Amplificação completa
São gerados milhões de clusters de DNA
fita simples em cada canal da flow cell.
7. Determina a primeira base
8. Imagem da primeira base
9. Determina segunda base
10. Imagem do Segundo ciclo
químico
11. Sequenciamento sobre
multiplos ciclos químicos
12. Alinhamento dos dados
O primeiro ciclo de sequenciamento começa
com adição de quarto nucleotídeos marcados
reversivelmente, primers e DNA polimerase.
Sequenciamento
7. Determina a primeira base
8. Imagem da primeira base
9. Determina segunda base
10. Imagem do Segundo ciclo
químico
11. Sequenciamento sobre
multiplos ciclos químicos
12. Alinhamento dos dados
Após a excitação com laser, a fluoresceência
emitida de cada cluster é capturada por uma
câmera e a primeira base é identificada
7. Determina a primeira base
8. Imagem da primeira base
9. Determina segunda base
10. Imagem do Segundo ciclo
químico
11. Sequenciamento sobre
multiplos ciclos químicos
12. Alinhamento dos dados
O próximo ciclo repete a incorporação
de quatro nucleotídeos marcados,
primers e DNA polimerase
7. Determina a primeira base
8. Imagem da primeira base
9. Determina segunda base
10. Imagem do Segundo ciclo
químico
11. Sequenciamento sobre
multiplos ciclos químicos
12. Alinhamento dos dados
Após a excitação com o laser a imagem é
capturada como anteriormente e a
identidade da segunda base é gravada.
Seqüenciamento
Seqüenciamento por término reversível :
Genome Analyzer
Seqüenciamento
Seqüenciamento por término reversível :
Genome Analyzer
A
T
C
G
Seqüenciamento
Seqüenciamento por término reversível :
Genome Analyzer
A
T
C
G
Seqüenciamento
Seqüenciamento por término reversível :
Genome Analyzer
A
Seqüenciamento
Seqüenciamento por término reversível :
Genome Analyzer
A
T
C
G
A
Seqüenciamento
Seqüenciamento por término reversível :
Genome Analyzer
T
C
G
A
Seqüenciamento
Seqüenciamento por término reversível :
Genome Analyzer
A
T
Seqüenciamento
Seqüenciamento por término reversível :
Genome Analyzer
A
Seqüenciamento
Seqüenciamento por término reversível :
Genome Analyzer
2 ciclo
1 ciclo
3 ciclo 4 ciclo 5 ciclo 6 ciclo
7. Determina a primeira base
8. Imagem da primeira base
9. Determina segunda base
10. Imagem do Segundo ciclo
químico
11. Sequenciamento sobre
multiplos ciclos químicos
12. Alinhamento dos dados
Alinhamento dos dados, comparar com uma
referência e identificar diferenças na sequência
Illumina
• Comercializada em 2004
Pirosequenciamento – 454/Roche
• Etapas:
- Ligação de adaptadores
- PCR em emulsão
- Seqüenciamento
Pirosequenciamento – 454/Roche
Pirosequenciamento – 454/Roche
Sequenciamento de nova geração- Curso de Inverno de Genética 2013-UFPR by Joseph Evaristo
Sequenciamento de nova geração- Curso de Inverno de Genética 2013-UFPR by Joseph Evaristo
Sequenciamento de nova geração- Curso de Inverno de Genética 2013-UFPR by Joseph Evaristo
*dNTP – só um deles
Pirosequenciamento – 454/Roche
Resultado
Pirosequenciamento– 454/Roche
GS FLX+ System
Sequencing Kit New! GS FLX Titanium XL+ GS FLX Titanium XLR70
Read Length Up to 1,000 bp Up to 600 bp
Mode Read Length 700 bp 450 bp
Throughput Profile
- 85% of total bases from reads
>500 bp
- 45% of total bases from reads
>700 bp
- 85% of total bases from reads
> 300 bp
- 20% of total bases from reads
> 500 bp
Typical Throughput 700 Mb 450 Mb
Reads per Run ~1,000,000 shotgun
~1,000,000 shotgun,
~700,000 amplicon
Consensus Accuracy* 99.997% 99.995%
Run Time 23 hours 10 hours
Sample Input gDNA or cDNA
gDNA, cDNA, or amplicons (PCR
products)
• Data de comercialização = 2007
• Etapas:
1) Ligação de adaptadores
2) PCR em emulsão
3) Seqüenciamento
Seqüenciamento por ligação de sondas
(SOLiD)
• SOLiD = Sequencing by Oligo Ligation and Detection
3) Seqüenciamento
Seqüenciamento por ligação de sondas
(SOLiD)
Sequenciamento de nova geração- Curso de Inverno de Genética 2013-UFPR by Joseph Evaristo
Seqüenciamento por ligação de sondas
(SOLiD)
3) Seqüenciamento
Seqüenciamento por ligação de sondas
(SOLiD)
3) Seqüenciamento
Seqüenciamento por ligação de sondas
(SOLiD)
1) Anelamento do primer e ligação da sonda
Seqüenciamento por ligação de sondas
(SOLiD)
2) Captura da imagem da cor emitida
Seqüenciamento por ligação de sondas
(SOLiD)
3) Clivagem da sonda
Seqüenciamento por ligação de sondas
(SOLiD)
4) As etapas de 1 a 3 se repetem
1) Anelamento da sonda
2)Captura de imagem
3) Clivagem
Seqüenciamento por ligação de sondas
(SOLiD)
6) Fitas de DNA retornam ao estágio inicial de simples fita e ocorre
anelamento do primer n - 1
Seqüenciamento por ligação de sondas
(SOLiD)
7) As etapas 1 – 4 são repetidas com novo primer
1) Anelamento da sonda
2)Captura de imagem
3) Clivagem
4) Repetir 1-3 n ciclos
Seqüenciamento por ligação de sondas
(SOLiD)
Seqüenciamento por ligação de sondas
(SOLiD)
1o Ciclo
2o Ciclo (n-1)
3o Ciclo (n-2)
4o Ciclo (n-3)
5o Ciclo (n-4)
A A
A T
T G
G G
G C
C G
G C
C T
T A
A G
G G
G C
A T G G C G C T A G G C
2a Base
1
a
Base
Seqüenciamento por ligação de sondas (SOLiD)
Diferenças entre as metodologias
Plataforma Tamanho da
leitura (bases)
Tempo de
corrida
(dias)
Gb por
corrida
MegaBace
(96 capilares)
100-1000 0,1 96kb
454
(Roche)
400 0,35 0,45
SOLiD4
(Applied Biosystems)
35 ou 50 6-16 100
Genome Analyser II
(Illumina / Solexa)
HiSeq2000
75 ou 100 4-9 35
200
Quantos pares de bases é capaz de seqüenciar?
3ª Geração de seqüenciamento
• O que mudou?
- Não possui etapa de amplificação (Single molecule)
- Maior sensibilidade na leitura
• Pacific Bioscience
3ª Geração de seqüenciamento
Single Molecule Real Time (SMRT)- Pacific Bioscience
Sample
Preparation
LS – long sequencing reads
• Large insert sizes (2kb-10kb)
• Generates one pass on each molecule sequenced
• Small insert sizes 500bp
• Generates multiple passes on each molecule sequenced
Standard
Circular Consensus
CCS – high quality sequencing reads
PacBio RS – two sequencing modes
4ª Geração de seqüenciamento
Personal Genome Machine – Ion Torrent
(life technologies)
Three types of semiconductor chips:
314 – 20Mb
316 - 200Mb
318 – 1Gb
Read length depends on base composition
200-250bp (200cycles)
System is enabled for Paired End
2x100cycles
The fastest sequencing system on the
market.
Recommendation:
Resequencing applications which require
fast turnaround of samples
- Amplicons (PCR products)
- Small and medium size genomes
- Custom DNA capture applications
How it works:
H+ ion is released during
base incorporation.
Individual polymerases
attached to beads are
positioned in tiny wells that
rest on a tiny pH meter.
PGM/Ion Torrent Data 316 chip
Thr.
Total Number of Bases [Mbp] 77.65
‣ Number of Q17 Bases [Mbp] 36.11
‣ Number of Q20 Bases [Mbp] 27.33
Total Number of Reads 368,860
Mean Length [bp] 211
Longest Read [bp] 380
Ion Proton System
- Human genome in one day
- Cost of reagents $1000 per run
- Error rate around 1.2%
- Human Genome, RNAseq, ChIPseq
Ion Proton Chip I – 10Gb
(Whole Exome capture
experiments)
Ion Proton Chip II – 100Gb
Whole human Genome
resequencing
Ion Torrent (Life Technologies)
• Jonathan M. Rothberg/454
Ion Torrent (Life Technologies)
Ion Torrent (Life Technologies)
Ion Torrent (Life Technologies)
Ion Torrent-(Life Technologies)
Sequenciamento de nova geração- Curso de Inverno de Genética 2013-UFPR by Joseph Evaristo
Sequenciamento de nova geração- Curso de Inverno de Genética 2013-UFPR by Joseph Evaristo
Objetivos para sequenciamento genômico
Exemplo
Sequenciamento
de novo
Sequenciamento
genômico
Sequenciamento de >1000 genomas
de influenza
DNA de org. extinto Neanderthal
Metagenomica Intestino humano
Resequencia-
mento
Genomas completos Indivíduos humanos
Regiões genômicas Detecção de rearranjos ou regiões
associados à doenças
Mutações somáticas Em câncer
Transcriptoma mRNA Definir regulação da transcrição
Serial Analysis of Gene
Expression (SAGE)
RNAs não codificadores Identificar e quantificar microRNAs
Epigenética Padrão de Methilação Avaliar padrão de metilação em
câncer
Sequenciamento de nova geração- Curso de Inverno de Genética 2013-UFPR by Joseph Evaristo
Sequenciamento de nova geração- Curso de Inverno de Genética 2013-UFPR by Joseph Evaristo
Sequenciamento de nova geração- Curso de Inverno de Genética 2013-UFPR by Joseph Evaristo
ASSESSING QUALITY: PHRED SCORES
Q = -10log10 P
P=error probability of
a given base call.
Tools for generating alignments!
 There are MANY software packages available for aligning data from
next generation sequencing experiments.!
 Three of the most popular are:!
 – BWA: http://bio-bwa.sourceforge.net!
 – Bowtie: http://bowtie-bio.sourceforge.net!
 – CLC Genome Workbench- Private
ALIGNMENT FORMATS!
 SAM (Sequence Alignment/Map) format has become the de facto
standard for storing alignment data.
 BAM is a binary version of SAM allowing more efficient storage.
SEQUENCE FILE FORMATS
 There are a lot of file sequence formats.
 They include different information about the sequence. The most
common file formats in the NGS world are:
 sff,
 fastq and
 fasta.
 Every program have different requirement, so every program asks for
different file formats
FASTQ FORMAT!
@HWUSI-EAS582_157:6:1:1:1501/1
NCACAGACACACACGAACACACAAAGACATGCCCATATGAAGAT
+
%.7786867:778556858746575058873/347777476035
@HWUSI-EAS582_157:6:1:1:1606/1
NCTGGCACCTTGATTTTGGACTTCCCAGCCTCCAGAACTGTGAG
+
%1948988888798988366898888648998788898888588
@HWUSI-EAS582_157:6:1:1:453/1
NCTGCTTGCACCCCTGAAGTCACTGATCACATTTCAGGGTCACC
+
%/868998988888867668888986644788988413488885
@HWUSI-EAS582_157:6:1:1:1844/1
NGATTGACATTGGCAAAGAGGACAACTGATTGCAAACTTCACAC
+
%-7;:::::;86499;75574586::635:62687666887879
@HWUSI-EAS582_157:6:1:1:1707/1
NAGGCTCAGGCGCACGGCCTACATCGTCGCTGTCGGCCAAGGGG
+
“Read” (sequence)!
Quality scores (phred-33)!
FASTA
 The fasta format is the most simple one.
 Each sequence starts with a “>” followed by the sequence name, an
space and, optionally, the description
 >seq_1 description
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAA
CTCACAGTTT >seq_2
ATCGTAGTCTAGTCTATGCTAGTGCGATGCTAGTGCTAGTCGTATGCAT
GGCTATGTGTG
OBRIGADO!

Mais conteúdo relacionado

Mais procurados

Introducao metabolismo
Introducao metabolismoIntroducao metabolismo
Introducao metabolismo
Acqua Blue Fitnnes
 
Ciclo Celular
Ciclo CelularCiclo Celular
Ciclo Celular
Mariana Cordeiro
 
Aula 11 fungos
Aula   11 fungosAula   11 fungos
Aula 11 fungos
Gildo Crispim
 
Anemias hereditarias
Anemias hereditariasAnemias hereditarias
Anemias hereditarias
Euripedes Barbosa
 
Roteiro de aula prática de Biologia Celular
Roteiro de aula prática de Biologia CelularRoteiro de aula prática de Biologia Celular
Roteiro de aula prática de Biologia Celular
Nathália Vasconcelos
 
Citoplasma e organelas citoplasmáticas 29-09 (1) [salvo automaticamente]
Citoplasma e organelas citoplasmáticas  29-09 (1) [salvo automaticamente]Citoplasma e organelas citoplasmáticas  29-09 (1) [salvo automaticamente]
Citoplasma e organelas citoplasmáticas 29-09 (1) [salvo automaticamente]
Ney Brito
 
Membrana plasmática #1
Membrana plasmática #1Membrana plasmática #1
Membrana plasmática #1
icsanches
 
Plasmídeos- Genética Bacteriana
Plasmídeos- Genética BacterianaPlasmídeos- Genética Bacteriana
Plasmídeos- Genética Bacteriana
Hemilly Rayanne
 
Aminoácidos-peptídeos-e-proteínas.pptx
Aminoácidos-peptídeos-e-proteínas.pptxAminoácidos-peptídeos-e-proteínas.pptx
Aminoácidos-peptídeos-e-proteínas.pptx
ssuser1bac32
 
Aula Biologia: Citologia II (organelas citoplasmáticas)
Aula Biologia: Citologia II (organelas citoplasmáticas)Aula Biologia: Citologia II (organelas citoplasmáticas)
Aula Biologia: Citologia II (organelas citoplasmáticas)
Ronaldo Santana
 
Código genético
Código genéticoCódigo genético
Código genético
MARCIAMP
 
Aula estrutura e_replicacao_do_dna_christian
Aula estrutura e_replicacao_do_dna_christianAula estrutura e_replicacao_do_dna_christian
Aula estrutura e_replicacao_do_dna_christian
Andressa Souza
 
Introdução de tecnicas de diagnostico molecular
Introdução de tecnicas de diagnostico molecular Introdução de tecnicas de diagnostico molecular
Introdução de tecnicas de diagnostico molecular
Safia Naser
 
Patogenicidade Bacteriana
Patogenicidade BacterianaPatogenicidade Bacteriana
Patogenicidade Bacteriana
Kelton Silva Sena
 
Leucemias
Leucemias Leucemias
Fermentação e Respiração
Fermentação e RespiraçãoFermentação e Respiração
Fermentação e Respiração
emanuel
 
Ácidos Nucleicos Exercícios
Ácidos Nucleicos ExercíciosÁcidos Nucleicos Exercícios
Ácidos Nucleicos Exercícios
Caio Augusto
 
Metabolismo celular - FOTOSSÍNTESE
Metabolismo celular - FOTOSSÍNTESEMetabolismo celular - FOTOSSÍNTESE
Metabolismo celular - FOTOSSÍNTESE
Silvana Sanches
 
Membrana Plasmática
Membrana PlasmáticaMembrana Plasmática
Membrana Plasmática
Joemille Leal
 
Transcrição e tradução
Transcrição e traduçãoTranscrição e tradução

Mais procurados (20)

Introducao metabolismo
Introducao metabolismoIntroducao metabolismo
Introducao metabolismo
 
Ciclo Celular
Ciclo CelularCiclo Celular
Ciclo Celular
 
Aula 11 fungos
Aula   11 fungosAula   11 fungos
Aula 11 fungos
 
Anemias hereditarias
Anemias hereditariasAnemias hereditarias
Anemias hereditarias
 
Roteiro de aula prática de Biologia Celular
Roteiro de aula prática de Biologia CelularRoteiro de aula prática de Biologia Celular
Roteiro de aula prática de Biologia Celular
 
Citoplasma e organelas citoplasmáticas 29-09 (1) [salvo automaticamente]
Citoplasma e organelas citoplasmáticas  29-09 (1) [salvo automaticamente]Citoplasma e organelas citoplasmáticas  29-09 (1) [salvo automaticamente]
Citoplasma e organelas citoplasmáticas 29-09 (1) [salvo automaticamente]
 
Membrana plasmática #1
Membrana plasmática #1Membrana plasmática #1
Membrana plasmática #1
 
Plasmídeos- Genética Bacteriana
Plasmídeos- Genética BacterianaPlasmídeos- Genética Bacteriana
Plasmídeos- Genética Bacteriana
 
Aminoácidos-peptídeos-e-proteínas.pptx
Aminoácidos-peptídeos-e-proteínas.pptxAminoácidos-peptídeos-e-proteínas.pptx
Aminoácidos-peptídeos-e-proteínas.pptx
 
Aula Biologia: Citologia II (organelas citoplasmáticas)
Aula Biologia: Citologia II (organelas citoplasmáticas)Aula Biologia: Citologia II (organelas citoplasmáticas)
Aula Biologia: Citologia II (organelas citoplasmáticas)
 
Código genético
Código genéticoCódigo genético
Código genético
 
Aula estrutura e_replicacao_do_dna_christian
Aula estrutura e_replicacao_do_dna_christianAula estrutura e_replicacao_do_dna_christian
Aula estrutura e_replicacao_do_dna_christian
 
Introdução de tecnicas de diagnostico molecular
Introdução de tecnicas de diagnostico molecular Introdução de tecnicas de diagnostico molecular
Introdução de tecnicas de diagnostico molecular
 
Patogenicidade Bacteriana
Patogenicidade BacterianaPatogenicidade Bacteriana
Patogenicidade Bacteriana
 
Leucemias
Leucemias Leucemias
Leucemias
 
Fermentação e Respiração
Fermentação e RespiraçãoFermentação e Respiração
Fermentação e Respiração
 
Ácidos Nucleicos Exercícios
Ácidos Nucleicos ExercíciosÁcidos Nucleicos Exercícios
Ácidos Nucleicos Exercícios
 
Metabolismo celular - FOTOSSÍNTESE
Metabolismo celular - FOTOSSÍNTESEMetabolismo celular - FOTOSSÍNTESE
Metabolismo celular - FOTOSSÍNTESE
 
Membrana Plasmática
Membrana PlasmáticaMembrana Plasmática
Membrana Plasmática
 
Transcrição e tradução
Transcrição e traduçãoTranscrição e tradução
Transcrição e tradução
 

Semelhante a Sequenciamento de nova geração- Curso de Inverno de Genética 2013-UFPR by Joseph Evaristo

Projeto Genoma Humano
Projeto Genoma Humano Projeto Genoma Humano
Projeto Genoma Humano
Carol Olimpio
 
Minicurso Técnicas de Sequenciamento e suas Aplicações
Minicurso Técnicas de Sequenciamento e suas AplicaçõesMinicurso Técnicas de Sequenciamento e suas Aplicações
Minicurso Técnicas de Sequenciamento e suas Aplicações
Ana Paula Mendes Silva
 
Dna
DnaDna
Pcr
PcrPcr
3S_PCR_ resumo
3S_PCR_ resumo3S_PCR_ resumo
3S_PCR_ resumo
Ionara Urrutia Moura
 
Plano vi juliana
Plano vi julianaPlano vi juliana
Plano vi juliana
familiaestagio
 
D na invest-criminal-pcr-electroforese(dnafinferprint)
D na invest-criminal-pcr-electroforese(dnafinferprint)D na invest-criminal-pcr-electroforese(dnafinferprint)
D na invest-criminal-pcr-electroforese(dnafinferprint)
Madalena_Bio12
 
Plano vi luciana
Plano vi  lucianaPlano vi  luciana
Plano vi luciana
familiaestagio
 
Dna invest criminal-pcr-electroforese(dn-afingerprint)
Dna invest criminal-pcr-electroforese(dn-afingerprint)Dna invest criminal-pcr-electroforese(dn-afingerprint)
Dna invest criminal-pcr-electroforese(dn-afingerprint)
Madalena_Bio12
 
Principios basicos-de-biologia-molecular
Principios basicos-de-biologia-molecularPrincipios basicos-de-biologia-molecular
Principios basicos-de-biologia-molecular
Facebook
 
Realtime
RealtimeRealtime
Realtime
LABIMUNO UFBA
 
Aula introducaoatecnicasdediagnosticomolecular3-120325153120-phpapp02
Aula introducaoatecnicasdediagnosticomolecular3-120325153120-phpapp02Aula introducaoatecnicasdediagnosticomolecular3-120325153120-phpapp02
Aula introducaoatecnicasdediagnosticomolecular3-120325153120-phpapp02
Leriaagro
 
Microarray
MicroarrayMicroarray
Microarray
LABIMUNO UFBA
 
Minicurso 2 - "Metodologias Inovadoras para ensaios diagnósticos"
Minicurso 2 - "Metodologias Inovadoras para ensaios diagnósticos"Minicurso 2 - "Metodologias Inovadoras para ensaios diagnósticos"
Minicurso 2 - "Metodologias Inovadoras para ensaios diagnósticos"
JOFARUFPR
 
Biomol mt bom
Biomol mt bomBiomol mt bom
Biomol mt bom
Jac Costa
 
Conceitos Básicos de Técnicas em Biologia Molecular - Embrapa
Conceitos Básicos de Técnicas em Biologia Molecular - EmbrapaConceitos Básicos de Técnicas em Biologia Molecular - Embrapa
Conceitos Básicos de Técnicas em Biologia Molecular - Embrapa
Gregorio Leal da Silva
 
Aula 7 mi..(1)
Aula 7 mi..(1)Aula 7 mi..(1)
Aula 7 mi..(1)
Ana Carolina Gomes
 
áCidos nucleicos dna e rna
áCidos nucleicos  dna e rnaáCidos nucleicos  dna e rna
áCidos nucleicos dna e rna
SONALI NASCIMENTO
 
ERBASE 2019 - Renato Puga
ERBASE 2019 - Renato PugaERBASE 2019 - Renato Puga
ERBASE 2019 - Renato Puga
Renato Puga
 
Aula 12 - Tecnologia do DNA recombinante
Aula 12 - Tecnologia do DNA recombinanteAula 12 - Tecnologia do DNA recombinante
Aula 12 - Tecnologia do DNA recombinante
Fernando Mori Miyazawa
 

Semelhante a Sequenciamento de nova geração- Curso de Inverno de Genética 2013-UFPR by Joseph Evaristo (20)

Projeto Genoma Humano
Projeto Genoma Humano Projeto Genoma Humano
Projeto Genoma Humano
 
Minicurso Técnicas de Sequenciamento e suas Aplicações
Minicurso Técnicas de Sequenciamento e suas AplicaçõesMinicurso Técnicas de Sequenciamento e suas Aplicações
Minicurso Técnicas de Sequenciamento e suas Aplicações
 
Dna
DnaDna
Dna
 
Pcr
PcrPcr
Pcr
 
3S_PCR_ resumo
3S_PCR_ resumo3S_PCR_ resumo
3S_PCR_ resumo
 
Plano vi juliana
Plano vi julianaPlano vi juliana
Plano vi juliana
 
D na invest-criminal-pcr-electroforese(dnafinferprint)
D na invest-criminal-pcr-electroforese(dnafinferprint)D na invest-criminal-pcr-electroforese(dnafinferprint)
D na invest-criminal-pcr-electroforese(dnafinferprint)
 
Plano vi luciana
Plano vi  lucianaPlano vi  luciana
Plano vi luciana
 
Dna invest criminal-pcr-electroforese(dn-afingerprint)
Dna invest criminal-pcr-electroforese(dn-afingerprint)Dna invest criminal-pcr-electroforese(dn-afingerprint)
Dna invest criminal-pcr-electroforese(dn-afingerprint)
 
Principios basicos-de-biologia-molecular
Principios basicos-de-biologia-molecularPrincipios basicos-de-biologia-molecular
Principios basicos-de-biologia-molecular
 
Realtime
RealtimeRealtime
Realtime
 
Aula introducaoatecnicasdediagnosticomolecular3-120325153120-phpapp02
Aula introducaoatecnicasdediagnosticomolecular3-120325153120-phpapp02Aula introducaoatecnicasdediagnosticomolecular3-120325153120-phpapp02
Aula introducaoatecnicasdediagnosticomolecular3-120325153120-phpapp02
 
Microarray
MicroarrayMicroarray
Microarray
 
Minicurso 2 - "Metodologias Inovadoras para ensaios diagnósticos"
Minicurso 2 - "Metodologias Inovadoras para ensaios diagnósticos"Minicurso 2 - "Metodologias Inovadoras para ensaios diagnósticos"
Minicurso 2 - "Metodologias Inovadoras para ensaios diagnósticos"
 
Biomol mt bom
Biomol mt bomBiomol mt bom
Biomol mt bom
 
Conceitos Básicos de Técnicas em Biologia Molecular - Embrapa
Conceitos Básicos de Técnicas em Biologia Molecular - EmbrapaConceitos Básicos de Técnicas em Biologia Molecular - Embrapa
Conceitos Básicos de Técnicas em Biologia Molecular - Embrapa
 
Aula 7 mi..(1)
Aula 7 mi..(1)Aula 7 mi..(1)
Aula 7 mi..(1)
 
áCidos nucleicos dna e rna
áCidos nucleicos  dna e rnaáCidos nucleicos  dna e rna
áCidos nucleicos dna e rna
 
ERBASE 2019 - Renato Puga
ERBASE 2019 - Renato PugaERBASE 2019 - Renato Puga
ERBASE 2019 - Renato Puga
 
Aula 12 - Tecnologia do DNA recombinante
Aula 12 - Tecnologia do DNA recombinanteAula 12 - Tecnologia do DNA recombinante
Aula 12 - Tecnologia do DNA recombinante
 

Sequenciamento de nova geração- Curso de Inverno de Genética 2013-UFPR by Joseph Evaristo

  • 1. SEQUENCIAMENTO DE NOVA GERAÇÃO Dr. Joseph Albert Medeiros Evaristo Departamento de Genética-LIPB CIG 2013
  • 2. Sequenciamento de DNA • É o processo de determinação da ordem precisa de nucleotídeos na molécula de DNA. • Inclui qualquer método ou tecnologia que é usada para determinar a ordem das quatro bases nitrogenadas: Adenina, Guanina, Citosina e Timina • Com o advento de métodos rápido de sequenciamento de DNA, grandes descobertas e pesquisas médicas e biológicas tem sido aceleradas na última década.
  • 4. Gerações de Seqüenciadores 3ª Geração (single molecule) Single Molecule Real Time – SMRT (Pacific Bioscience) HeliScope (Helicos Bioscience) 454 (Roche) 2ª Geração (amplificação clonal) SOLiD (Life Technologies) HiSeq2000, HiSeq2500, MiSeq Illumina Ion Torrent- PGM, Proton (Life Technologies) GridION-Oxford Nanopore 4ª Geração (Post-Light) 1ª Geração (clonagem) Sanger
  • 5. •Método de Sanger de sequenciamento  Premio Nobel 1980
  • 7. Obtenção das bibliotecas genômicas Purificação do DNA genômico (qualidade e quantidade) Fragmentação mecânica do DNA genômico (tamanhos variados) Construção das Bibliotecas de DNA genômico (clonagem em plasmídios bacterianos ou fagos)
  • 8. • Vantagens • Reads longos (~900bps) • Desvantagens • Baixo rendimento • Alto custo • DNA molde + dNTPs e ddNTPs + DNApolimerase + Primer • Amplificação-PCR • Eletroforese em Gel de acrilamida • Os fragmentos migram distâncias proporcionais ao seu tamanho.
  • 9. Leroy Hood 1ª Geração de sequenciadores automáticos Automação do Sequenciamento ABI PRISM 370 (1987)
  • 10. Sanger Sequencing •Eletroforese Capilar (1990) •Eletroforese em gel
  • 12. Completed genome projects (october/08) Eukaryotes: 23 complete; 242 assembly, 224 in progress Viruses: 2,129 complete Bacteria: 714 complete Archaea: 52 complete Organellar: 1,709 complete Metagenomics projects: 195 NATURE Vol 464 1 April 2010
  • 13. NATURE Vol 464 1 April 2010
  • 14. N AT U R E | VO L 4 7 0 | 1 0 F E B R U A RY 2 0 1 1
  • 15. NEXT-GENERATION SEQUENCING (DEEP SEQUENCING) PLATFORMS 1. Genome Analyzer IIx (GAIIx), HiSeq2000, HiSeq2500, MiSeq – Illumina 2. Genome Sequencer FLX System (454) – Roche 3. SOLiD 5500xl System – Applied Biosystem 4. HeliScope™ Single Molecule Sequencer - Helicos 5. PacBio RS - Pacific Bioscience 6. Personal Genome Machine, Ion Proton - Ion Torrent 7. GridION, MinION – Oxford Nanopore
  • 17. Next Gen X Sanger
  • 19. 2001: Human Genome Project 2.7G$, 11 years 2001: Celera 100M$, 3 years 2007: 454 1M$, 3 months 2008: ABI SOLiD 60K$, 2 weeks 2009: Illumina, Helicos 40-50K$ 2010: 5K$, a few days? 2012: 1000$, <24 hrs?
  • 20. 2ª Geração de seqüenciamento • Genome Analyser - Seqüenciamento por término reversível (Illumina-Solexa) • 454 - Pirosequenciamento (Roche) • SOLiD - Seqüenciamento por ligação de sondas (Applied Biosystems - Life)
  • 21. HiSeq 2000 Illumina Produz acima de 600Gb por corrida em 13 dias. Custo de resequenciar um genoma humano: UNC-CH Genome Analysis Facilit - (30x cobertura) aproximadamente $6,000 HiSeq 2500 Produz acima de 100Gb por corrida em 27h. MiSeq - Sistema de pequena capacidade - PE 2x250cycles in 27hours.
  • 22. • Lançada comercialmente em 2006 Seqüenciamento por término reversível : Genome Analyzer • Etapas: 1) Ligação de adaptadores 2) PCR em ponte (formação de clusters) 3) Seqüenciamento
  • 23. 1. Preparar DNA genômico 2. Ligar o DNA a superfície 3. Amplificação por ponte 4. Fragmentos se tornam dupla fita 5. Desnaturar as moléculas dupla fita 6. Amplificação completa Fragmentação randômica do DNA e ligação de adaptadores nas duas pontas de cada fragmento. Amplificação
  • 24. 1. Preparar DNA genômico 2. Ligar o DNA a superfície 3. Amplificação por ponte 4. Fragmentos se tornam dupla fita 5. Desnaturar as moléculas dupla fita 6. Amplificação completa Ligação randômica dos fragmentos fita simples à superfície dos canais da flow cell.
  • 25. 1. Preparar DNA genômico 2. Ligar o DNA a superfície 3. Amplificação por ponte 4. Fragmentos se tornam dupla fita 5. Desnaturar as moléculas dupla fita 6. Amplificação completa Adição de nucleotídeos não marcados e enzima para iniciar a amplificação por ponte em fase sólida.
  • 26. 1. Preparar DNA genômico 2. Ligar o DNA a superfície 3. Amplificação por ponte 4. Fragmentos se tornam dupla fita 5. Desnaturar as moléculas dupla fita 6. Amplificação completa A enzima incorpora nucleotídeos para construir pontes de fita dupla na superfície sólida.
  • 27. 1. Preparar DNA genômico 2. Ligar o DNA a superfície 3. Amplificação por ponte 4. Fragmentos se tornam dupla fita 5. Desnaturar as moléculas dupla fita 6. Amplificação completa Desnaturação deixa os DNA moldes fita simples ancorados ao substrato sólido.
  • 28. 1. Preparar DNA genômico 2. Ligar o DNA a superfície 3. Amplificação por ponte 4. Fragmentos se tornam dupla fita 5. Desnaturar as moléculas dupla fita 6. Amplificação completa São gerados milhões de clusters de DNA fita simples em cada canal da flow cell.
  • 29. 7. Determina a primeira base 8. Imagem da primeira base 9. Determina segunda base 10. Imagem do Segundo ciclo químico 11. Sequenciamento sobre multiplos ciclos químicos 12. Alinhamento dos dados O primeiro ciclo de sequenciamento começa com adição de quarto nucleotídeos marcados reversivelmente, primers e DNA polimerase. Sequenciamento
  • 30. 7. Determina a primeira base 8. Imagem da primeira base 9. Determina segunda base 10. Imagem do Segundo ciclo químico 11. Sequenciamento sobre multiplos ciclos químicos 12. Alinhamento dos dados Após a excitação com laser, a fluoresceência emitida de cada cluster é capturada por uma câmera e a primeira base é identificada
  • 31. 7. Determina a primeira base 8. Imagem da primeira base 9. Determina segunda base 10. Imagem do Segundo ciclo químico 11. Sequenciamento sobre multiplos ciclos químicos 12. Alinhamento dos dados O próximo ciclo repete a incorporação de quatro nucleotídeos marcados, primers e DNA polimerase
  • 32. 7. Determina a primeira base 8. Imagem da primeira base 9. Determina segunda base 10. Imagem do Segundo ciclo químico 11. Sequenciamento sobre multiplos ciclos químicos 12. Alinhamento dos dados Após a excitação com o laser a imagem é capturada como anteriormente e a identidade da segunda base é gravada.
  • 33. Seqüenciamento Seqüenciamento por término reversível : Genome Analyzer
  • 34. Seqüenciamento Seqüenciamento por término reversível : Genome Analyzer
  • 37. A Seqüenciamento Seqüenciamento por término reversível : Genome Analyzer
  • 39. T C G A Seqüenciamento Seqüenciamento por término reversível : Genome Analyzer A
  • 40. T Seqüenciamento Seqüenciamento por término reversível : Genome Analyzer A
  • 41. Seqüenciamento Seqüenciamento por término reversível : Genome Analyzer 2 ciclo 1 ciclo 3 ciclo 4 ciclo 5 ciclo 6 ciclo
  • 42. 7. Determina a primeira base 8. Imagem da primeira base 9. Determina segunda base 10. Imagem do Segundo ciclo químico 11. Sequenciamento sobre multiplos ciclos químicos 12. Alinhamento dos dados Alinhamento dos dados, comparar com uma referência e identificar diferenças na sequência
  • 44. • Comercializada em 2004 Pirosequenciamento – 454/Roche • Etapas: - Ligação de adaptadores - PCR em emulsão - Seqüenciamento
  • 50. *dNTP – só um deles Pirosequenciamento – 454/Roche
  • 52. GS FLX+ System Sequencing Kit New! GS FLX Titanium XL+ GS FLX Titanium XLR70 Read Length Up to 1,000 bp Up to 600 bp Mode Read Length 700 bp 450 bp Throughput Profile - 85% of total bases from reads >500 bp - 45% of total bases from reads >700 bp - 85% of total bases from reads > 300 bp - 20% of total bases from reads > 500 bp Typical Throughput 700 Mb 450 Mb Reads per Run ~1,000,000 shotgun ~1,000,000 shotgun, ~700,000 amplicon Consensus Accuracy* 99.997% 99.995% Run Time 23 hours 10 hours Sample Input gDNA or cDNA gDNA, cDNA, or amplicons (PCR products)
  • 53. • Data de comercialização = 2007 • Etapas: 1) Ligação de adaptadores 2) PCR em emulsão 3) Seqüenciamento Seqüenciamento por ligação de sondas (SOLiD) • SOLiD = Sequencing by Oligo Ligation and Detection
  • 54. 3) Seqüenciamento Seqüenciamento por ligação de sondas (SOLiD)
  • 56. Seqüenciamento por ligação de sondas (SOLiD) 3) Seqüenciamento
  • 57. Seqüenciamento por ligação de sondas (SOLiD) 3) Seqüenciamento
  • 58. Seqüenciamento por ligação de sondas (SOLiD)
  • 59. 1) Anelamento do primer e ligação da sonda Seqüenciamento por ligação de sondas (SOLiD)
  • 60. 2) Captura da imagem da cor emitida Seqüenciamento por ligação de sondas (SOLiD)
  • 61. 3) Clivagem da sonda Seqüenciamento por ligação de sondas (SOLiD)
  • 62. 4) As etapas de 1 a 3 se repetem 1) Anelamento da sonda 2)Captura de imagem 3) Clivagem Seqüenciamento por ligação de sondas (SOLiD)
  • 63. 6) Fitas de DNA retornam ao estágio inicial de simples fita e ocorre anelamento do primer n - 1 Seqüenciamento por ligação de sondas (SOLiD)
  • 64. 7) As etapas 1 – 4 são repetidas com novo primer 1) Anelamento da sonda 2)Captura de imagem 3) Clivagem 4) Repetir 1-3 n ciclos Seqüenciamento por ligação de sondas (SOLiD)
  • 65. Seqüenciamento por ligação de sondas (SOLiD)
  • 66. 1o Ciclo 2o Ciclo (n-1) 3o Ciclo (n-2) 4o Ciclo (n-3) 5o Ciclo (n-4) A A A T T G G G G C C G G C C T T A A G G G G C A T G G C G C T A G G C 2a Base 1 a Base Seqüenciamento por ligação de sondas (SOLiD)
  • 67. Diferenças entre as metodologias
  • 68. Plataforma Tamanho da leitura (bases) Tempo de corrida (dias) Gb por corrida MegaBace (96 capilares) 100-1000 0,1 96kb 454 (Roche) 400 0,35 0,45 SOLiD4 (Applied Biosystems) 35 ou 50 6-16 100 Genome Analyser II (Illumina / Solexa) HiSeq2000 75 ou 100 4-9 35 200 Quantos pares de bases é capaz de seqüenciar?
  • 69. 3ª Geração de seqüenciamento • O que mudou? - Não possui etapa de amplificação (Single molecule) - Maior sensibilidade na leitura • Pacific Bioscience
  • 70. 3ª Geração de seqüenciamento Single Molecule Real Time (SMRT)- Pacific Bioscience
  • 71. Sample Preparation LS – long sequencing reads • Large insert sizes (2kb-10kb) • Generates one pass on each molecule sequenced • Small insert sizes 500bp • Generates multiple passes on each molecule sequenced Standard Circular Consensus CCS – high quality sequencing reads PacBio RS – two sequencing modes
  • 72. 4ª Geração de seqüenciamento
  • 73. Personal Genome Machine – Ion Torrent (life technologies) Three types of semiconductor chips: 314 – 20Mb 316 - 200Mb 318 – 1Gb Read length depends on base composition 200-250bp (200cycles) System is enabled for Paired End 2x100cycles The fastest sequencing system on the market. Recommendation: Resequencing applications which require fast turnaround of samples - Amplicons (PCR products) - Small and medium size genomes - Custom DNA capture applications How it works: H+ ion is released during base incorporation. Individual polymerases attached to beads are positioned in tiny wells that rest on a tiny pH meter.
  • 74. PGM/Ion Torrent Data 316 chip Thr. Total Number of Bases [Mbp] 77.65 ‣ Number of Q17 Bases [Mbp] 36.11 ‣ Number of Q20 Bases [Mbp] 27.33 Total Number of Reads 368,860 Mean Length [bp] 211 Longest Read [bp] 380
  • 75. Ion Proton System - Human genome in one day - Cost of reagents $1000 per run - Error rate around 1.2% - Human Genome, RNAseq, ChIPseq Ion Proton Chip I – 10Gb (Whole Exome capture experiments) Ion Proton Chip II – 100Gb Whole human Genome resequencing
  • 76. Ion Torrent (Life Technologies) • Jonathan M. Rothberg/454
  • 77. Ion Torrent (Life Technologies)
  • 78. Ion Torrent (Life Technologies)
  • 79. Ion Torrent (Life Technologies)
  • 83. Objetivos para sequenciamento genômico Exemplo Sequenciamento de novo Sequenciamento genômico Sequenciamento de >1000 genomas de influenza DNA de org. extinto Neanderthal Metagenomica Intestino humano Resequencia- mento Genomas completos Indivíduos humanos Regiões genômicas Detecção de rearranjos ou regiões associados à doenças Mutações somáticas Em câncer Transcriptoma mRNA Definir regulação da transcrição Serial Analysis of Gene Expression (SAGE) RNAs não codificadores Identificar e quantificar microRNAs Epigenética Padrão de Methilação Avaliar padrão de metilação em câncer
  • 87. ASSESSING QUALITY: PHRED SCORES Q = -10log10 P P=error probability of a given base call.
  • 88. Tools for generating alignments!  There are MANY software packages available for aligning data from next generation sequencing experiments.!  Three of the most popular are:!  – BWA: http://bio-bwa.sourceforge.net!  – Bowtie: http://bowtie-bio.sourceforge.net!  – CLC Genome Workbench- Private
  • 89. ALIGNMENT FORMATS!  SAM (Sequence Alignment/Map) format has become the de facto standard for storing alignment data.  BAM is a binary version of SAM allowing more efficient storage.
  • 90. SEQUENCE FILE FORMATS  There are a lot of file sequence formats.  They include different information about the sequence. The most common file formats in the NGS world are:  sff,  fastq and  fasta.  Every program have different requirement, so every program asks for different file formats
  • 92. FASTA  The fasta format is the most simple one.  Each sequence starts with a “>” followed by the sequence name, an space and, optionally, the description  >seq_1 description GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAA CTCACAGTTT >seq_2 ATCGTAGTCTAGTCTATGCTAGTGCGATGCTAGTGCTAGTCGTATGCAT GGCTATGTGTG

Notas do Editor

  1. note the homopolymer problems