FACULDADE DE MEDICINA DO ABC
PROJETO DE MESTRADO
Avaliação dos efeitos do exercício
resistido dinâmico em ratos sobre a va...
RESUMO
Diante das recente descobertas científicas na área da neurociência, novas possibilidades e hipóteses são, agora,
pa...
INTRODUÇÃO
	 A importância do oxigênio como fonte de diversos processos que permitem a manutenção da vida
é notória. Dentr...
A superóxido dismutase (SOD) é uma enzima do sistema de defesa antioxidante que catalisa a dismutação
de duas moléculas de...
A formação das ROS e a possível
ação destrutiva oxidativa podem se dar
quando há a inibição do sistema enzimático
antioxid...
O Núcleo doTracto Solitário (NTS) constitui o sítio primário no sistema nervoso central para o qual
se projetam as aferênc...
Embora em animais normotensos a lesão do NTS comissural não promova alterações na pressão arterial
basal, foi demonstrado ...
O exercício físico regular, desde que adequado, pode influenciar a hipertensão arterial. Embora o
iníciodoexercíciofísicoe...
Embora o exercício resistido tenha sido aceito como uma forma
de desenvolver força, de favorecer a realização de contraçõe...
Durante o exercício, a frequência cardíaca (FC) aumenta linearmente à medida em que a intensidade do
exercício se eleva. O...
Considerando-se as evidências de que o exercício resistido dinâmico
produz pequena redução da pressão arterial e não alter...
1 -ANIMAIS
	 Serão utilizados ratosWistar (300-350 g) fornecidos pelo Biotério da Faculdade de Medicina do
ABC, alocados e...
3 - EXPRESSÃO GÊNICA DE MARCADORES
DO ESTRESSE OXIDATIVO, PROCESSO
INFLAMATÓRIO E DE RECEPTORES DE
ANGIOTENSINA II
	 Após ...
3.1.	 ExtraçãodeRNAtotaldostecidosnervosos
(NTS intermediário e comissural e RVL)
	 O RNA total será posteriormente extraí...
inibidor de RNAase (40U) e a enzima transcriptase reversa (Superscript III – Invitrogen), em volume final
de 20L. As reaç...
A reação terá duas fases: a primeira a 50°C por 2 min para ativação da enzima; a segunda, a 95°C por
10 minutos para desna...
momento dos experimentos. Será realizada a administração 0,2 mL de Pentabiótico Veterinário (2000
U/mL) (Fort Dodge, Campi...
5 - MEDIDA DA PRESSÃO DE CAUDA E
FREQUÊNCIA CARDÍACA EM RATOS NÃO
ANESTESIADOS
	 A pressão de cauda dos animais será deter...
da pressão de cauda e FC. No último dia do período de 6 semanas de exercício, após a secagem dos animais, estes serão
prof...
7 -ANÁLISE ESTATÍSTICA
	 Osdadosobtidosserãoanalisadospeloteste-tStudentnão-pareado.Asdiferençasserãoconsideradas
signific...
Evans, M. D., Dizdaroglu, M., & Cooke, M. S. (2004). Oxidative DNA damage and disease: induction,
repair and significance....
Pollock ML,EvansWJ.Resistance training for health and disease.Med Sci Sports Exerc.1999;31:10 –11.
Pollock ML, Franlin BA,...
29
Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadore...
Projeto de Mestrado - Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência c...
Projeto de Mestrado - Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência c...
Projeto de Mestrado - Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência c...
Projeto de Mestrado - Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência c...
Projeto de Mestrado - Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência c...
Projeto de Mestrado - Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência c...
Próximos SlideShares
Carregando em…5
×

Projeto de Mestrado - Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares

536 visualizações

Publicada em

(Ainda sem as correções finais)

Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares.

Publicada em: Saúde
0 comentários
0 gostaram
Estatísticas
Notas
  • Seja o primeiro a comentar

  • Seja a primeira pessoa a gostar disto

Sem downloads
Visualizações
Visualizações totais
536
No SlideShare
0
A partir de incorporações
0
Número de incorporações
1
Ações
Compartilhamentos
0
Downloads
9
Comentários
0
Gostaram
0
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Projeto de Mestrado - Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares

  1. 1. FACULDADE DE MEDICINA DO ABC PROJETO DE MESTRADO Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares Candidato: Henrique Outeda Orientadora: Profa. Dra. Monica Akemi Sato Santo André Março/2014
  2. 2. RESUMO Diante das recente descobertas científicas na área da neurociência, novas possibilidades e hipóteses são, agora, passivas de confirmação. As espécies reativas de oxigênio (ROS) se originam da instabilidade de seus elétrons desemparelhados, o que gera alto potencial de reatividade com moléculas biológicas. Apesar da existência de agentes e mecanismos antioxidantes, quando a formação de ROS excede a capacidade antioxidante celular, pode haver a geração de uma condição conhecida como estresse oxidativo. Os principais alvos das ROS incluem DNA, lipídeos, proteínas e açúcares, sendo que a ordem de preferência de ataque depende de muitos fatores, como o local onde a espécie reativa é gerada, a habilidade relativa de uma biomolécula ser oxidada e a disponibilidade de íons metálicos associados a essa biomolécula (Evans et al., 2004). O Núcleo doTracto Solitário (NTS) constitui o sítio primário no sistema nervoso central para o qual se projetam as aferências somato-viscerais (barorreceptores, quimiorreceptores e receptores cardiopulmonares). Os núcleos do trato solitário são constituídos por grupos heterogêneos de neurônios, que estão dispostos dorsalmente no bulbo. Diferentes estudos têm investigado a possível importância das ROS (Reactive Oxygen Species) na gênese da hipertensão arterial e a sua relação com substâncias sabidamente implicadas na manutenção da homeostase cardiovascular, como a angiotensina II, peptídeo fundamental no balanço fisiológico de diversos sistemas como o cardiovascular e o renal. Evidências descritas nos últimos anos sugerem que o exercício físico pode promover mudanças no funcionamento de áreas bulbares envolvidas na regulação cardiovascular.Embora nem todas as alterações induzidas pelo exercício nocircuitobulbarsejamatualmentecompreendidas,evidênciasindicamqueaferentessomáticos(proprioceptores) projetam-se para o NTS. Considerando-se as evidências de que o exercício resistido dinâmico produz pequena redução da pressão arterial e não altera a frequência cardíaca de repouso, porém, sabendo-se que a intensidade do exercício pode incrementar de forma linear a elevação da FC durante o exercício, torna-se interessante investigar se esta modalidade de exercício induz a inflamação e estresse oxidativo em áreas bulbares como o NTS e RVL, que estão envolvidas com a regulação autonômica cardiovascular. Adicionalmente, torna-se relevante avaliar se o exercício resisitido dinâmico modifica os componentes autonômicos (simpático e parassimpático) por meio da análise da variabilidade da frequência cardíaca. O trabalho visa esclarecer mais algumas das várias alterações induzidas pelo exercício físico, e que poderiam representar uma alternativa aos tratamentos farmacológicos da hipertensão arterial, ou ainda, uma terapia complementar ao tratamento farmacológico. Os objetivo do trabalho consiste em analisar a expressão gênica da inflamação, de marcadores do estresse oxidativo, e de receptores AT-1 em neurônios do NTS intermediário, NTS comissural e RVL, além de avaliar os componentes autonômicos por meio da variabilidade da frequência cardíaca em ratos submetidos ao exercício resistido dinâmico e sedentários. Os modelos experimentais utilizados serão ratosWistar (300-350 g). Os ratos serão inicialmente adaptados aos tanques de natação.Após o período de adaptação, as sessões de exercício resistido dinâmico consistirão em saltos em piscina com carga de 50% do peso corpóreo em dias alternados, 3 vezes por semana (4 séries de 10 saltos com intervalo de 1 min) por 6 semanas. A expressão gênica dos marcadores do estresse oxidativo, processo inflamatório e de receptores de angiotensina II será avaliada por RT-PCR. Para a análise daVFC, será utilizado o Software CardioSeries. 5 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  3. 3. INTRODUÇÃO A importância do oxigênio como fonte de diversos processos que permitem a manutenção da vida é notória. Dentro do organismo, o oxigênio sofre participa de uma série de reações químicas, entretanto, nem sempre os resíduos destes processos são “reciclados” pelo nosso organismo de forma correta. O oxigênio molecular (O2) possui dois elétrons desemparelhados, com spins iguais localizados em dois orbitais, o que torna o O2 bastante estável, pois restringe sua redução ou a moléculas que possuam dois elétrons de spins antiparalelos ou a uma redução univalente, com um elétron de cada vez. Este fenômeno é conhecido como restrição de spin. Esta restrição limita a reatividade do oxigênio, permitindo que em uma atmosfera de 21% de O2, como a daTerra, ocorram moléculas constituídas de cadeias carbônicas altamente reduzidas (Halliwell, Gutteridge, 1989). Nos organismos aeróbios, o O2 é utilizado nas mitocôndrias como aceptor final de elétrons na cadeia respiratória, sendo reduzido a H2O no complexo IV ou citocromo a3. As quatro etapas de redução do oxigênio ocorrem no interior do complexo IV mitocondrial, liberando H2O como único produto final da reação.Todavia, estudos anteriores mostraram que cerca de 5% do oxigênio consumido é reduzido ao radical ânion superóxido (O2-.), uma forma muito comum de formação de radicais livres nos meios biológicos. O exercício físico aumenta em torno de 25 vezes o volume de oxigênio total consumido (VO2) e 100 vezes nas fibras musculares ativas (Astränd, Rodahl, 1986; Sjödin et al., 1990), permitindo que o O2- possa ser formado de várias maneiras (Beckman et al., 1990; Sjödin et al., 1990; Jenkins, Goldfarb, 1993; Reid, 1996;Tiidus, 1998): Cadeia deTransporte de Elétrons – Uma das principais fontes de O2-. é o vazamento de elétrons que ocorre na cadeia respiratória mitocondrial. Cerca de 5% do oxigênio consumido pelas mitocôndras geram O2-., principalmente nos complexos I (NADPH-ubiquinona oxidoredutase) e complexo III (citocromo c redutase). Enzima Xantina Oxidase – As reações catalisadas pela xantina oxidase mostram-se uma fonte importante de O2-, especialmente durante situações de isquemia/reperfusão, quando ocorre grande produção de hipoxantina. Em situações normais a hipoxantina é degradada a ácido úrico pela ação da forma desidrogenase da enzima, que utiliza NADP+ como aceptor de elétrons. Porém, em baixas concentrações de O2 e altas concentrações intracelulares de Ca2+, a enzima é transformada na sua forma oxidase, que utiliza O2 como aceptor de elétrons, produzindo também O2-. no final do processo (Sjödin et al., 1990). Neutrófilos e Resposta Inflamatória (NADPH oxidase) – Neutrófilos polimorfonucleares possuem a função de promover a inflamação pós-exercício, importante para a remoção de proteínas danificadas e restos celulares e reparo do tecido danificado. Assim, quando recrutados para o foco da infecção, liberam primordialmente lisoenzimas e O2-.. A produção de O2-. pelos neutrófilos ocorre através da redução univalente do O2 na presença de NADPH, numa reação catalisada pela enzima NADPH oxidase, num processo conhecido como burst respiratório. Músculo Esquelético - O músculo esquelético produz óxido nítrico (NO) a partir do aminoácido arginina, pela reação da enzima óxido nítrico sintetase.O óxido nítrico pode reagir com O2-.,formando peroxinitrito,um intermediário instável, de alta reatividade (Reid, 1998). Evidências experimentais mostram que o NO pode influenciar no balanço oxidante/antioxidante intramuscular (Reid, 1998; Reid, 2002). 7 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  4. 4. A superóxido dismutase (SOD) é uma enzima do sistema de defesa antioxidante que catalisa a dismutação de duas moléculas de O2•-, formando H2O2, uma espécie não radicalar, considerada como um agente oxidante fraco. Entretanto, o H2O2 tem a propriedade de atravessar facilmente as membranas celulares e a união com um elétron proveniente de metais de transição,Fe2+ ou Cu+ dá origem ao radical hidroxila (•OH), uma das espécies radicalares existentes mais reativas (Ryan,Aust, 1992; Jenkins, Goldfarb, 1993). O H2O2 é removido pela ação das duas outras enzimas antioxidantes: a glutationa peroxidase (GPX), encontrada principalmente na mitocôndria e citosol, e a catalase (CAT), presente nos peroxissomas. A CAT é encontrada,sobretudo,nos hepatócitos e eritrócitos,estando presente em grandes concentrações nos peroxissomas e em baixas concentrações nas mitocôndrias (Halliwell, Gutteridge, 1989). Sua atividade também é maior nos músculos com capacidade oxidativa mais elevada (Powers et al., 1994). Outra enzima responsável pela detoxificação do H2O2, a glutationa peroxidase (GPX), tem menos especificidade para o substrato, reduzindo também hidroperóxidos a álcool.A glutationa (GSH) é um tripeptídeo formado pelos aminoácidos glicina, cisteína e ácido glutâmico. Quando GSH é oxidada pela reação da GPX, há a interligação de duas moléculas do tripeptídeo por uma ponte dissulfeto, com formação de glutationa oxidada (GSSG). Queda nos níveis de GSH pode prejudicar as defesas celulares contra a ação tóxica dos radicais livres.As células íntegras mantêm uma razão GSH/GSSG alta. Para isso, a GSSG formada é reduzida novamente a GSH, às custas de NADPH, pela ação da enzima glutationa redutase (GR). Apesar de a maior parte do oxigênio combinar-se com hidrogênio formando água, cerca de 4% a 5% de oxigênio formarão radicais O2•- com os elétrons que escapam da cadeia respiratória (Jenkins, Goldfarb, 1993). Esta situação de vazamento de elétrons tem maior ocorrência quando há um aumento desproporcional no consumo mitocondrial de oxigênio, circunstância que também confere uma elevação na produção de radicais livres. Portanto, existe uma relação diretamente proporcional entre aumento da taxa respiratória mitocondrial e indução na produção de espécies reativas de oxigênio, principalmente em casos que envolvem treinamento de resistência aeróbia utilizando-se métodos intervalados intensivos (Criswell et al., 1993).A sobrevivência celular frente ao ataque dos radicais livres dependerá de um equilíbrio entre os processos de produção e de eliminação das espécies reativas. As espécies reativas de oxigênio (ROS - “reactive oxygen species”) portanto, se originam da instabilidade de seus elétrons desemparelhados, o que gera alto potencial de reatividade com moléculas biológicas. Apesar da existência de agentes e mecanismos antioxidantes, quando a formação de ROS excede a capacidade antioxidante celular, pode haver a geração de uma condição conhecida como estresse oxidativo, cujos resultados podem ser bastante danosos às células (Berra et al., 2006). OsprincipaisalvosdasROSincluemDNA,lipídeos,proteínaseaçúcares,sendoqueaordemdepreferência de ataque depende de muitos fatores, como o local onde a espécie reativa é gerada, a habilidade relativa de uma biomolécula ser oxidada e a disponibilidade de íons metálicos associados a essa biomolécula (Evans et al., 2004). Conhecidamente existem 3 vias que resultam em ROS em nosso organismo: as fontes exógenas incluem luz ultravioleta (UV) – UVA e UVB, irradiação ionizante e agentes químicos. Por outro lado, as ROS formadas intracelularmente podem ser originadas como consequência do próprio metabolismo celular.As ROS são também produzidas durante processos patológicos, como, por exemplo, o que ocorre numa resposta inflamatória celular (Berra et al., 2006). Quimicamente, as ROS são moléculas instáveis no microambiente celular e eletrofílicas, sendo representadas, principalmente, pelos radicais superóxido (O2-), hidroxila (HO-), e pelo próprio peróxido de hidrogênio (H2O2) (Weinberg, 1990, Cardoso et al., 2006a e 2006b).  8 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  5. 5. A formação das ROS e a possível ação destrutiva oxidativa podem se dar quando há a inibição do sistema enzimático antioxidante, uma vez que a SOD é inibida por H2O2 e por certos metais transitórios, o que propicia a formação de radicais hidroxila (OH•), para os quais o organismo não possui um sistema defensivo disponível (Antunes Neto, 1998). Estudos anteriores têm mostrado que a inflamação tem sido ligada tanto experimentalmentequantoclinicamenteàsdoenças cardiovasculares (Pearson e cols.,2003).O ponto chave da inflamação parece ser a geração de ROS,devido a células do sistema imune (células dendríticas, macrófagos ou linfócitos) e interleucinas e outras citocinas inflamatórias, como o fator de necrose tumoral (TNF-α). (Gilmont e cols, 1996, Galkina e Ley, 2009). As citocinas inflamatórias ativam a produção vascular de ROS, especificamente superóxidos, por meio da ativação da NAPH oxidase.Esta possui diferentes subunidades, porém, todas levam à formação de superóxidos, embora não de forma equivalente (Abo e cols,1991, Arora e cols., 2010). No sistema cardiovascular, as ROS exercem funções fisiologicamente na regulação endotelial, tônus vascular e função cardíaca, bem como fisiopatologicamente, participam da inflamação, hipertrofia,proliferação,apoptose,migração,fibrose e angiogênese, processos estes importantes para a disfunção endotelial e remodelamento cardiovascular na hipertensão e outras doenças cardiovasculares (Förstermann, 2008 eTouyz, 2005). Diferentes estudos têm investigado a possível importância das ROS na gênese da hipertensão arterial (Dhalla et al., 2000, Avshalumov e Rice, 2002) e a sua relação com substâncias sabidamente implicadas na manutenção da homeostase cardiovascular, como a angiotensina II, peptídeo fundamental no balanço fisiológico de diversos sistemas como o cardiovascular e o renal. Estudos têm mostrado que o estresse oxidativo, produzido principalmente pela ativação de receptores AT-1 e NADPH oxidase em regiões bulbares envolvidas no controle autonômico, estaria envolvido no aumento da atividade nervosa simpática na hipertensão (Kishi e Hirooka, 2012). 9 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  6. 6. O Núcleo doTracto Solitário (NTS) constitui o sítio primário no sistema nervoso central para o qual se projetam as aferências somato-viscerais (barorreceptores, quimiorreceptores e receptores cardiopulmonares) (Ciriello et al., 1994). A partir do NTS, partem eferências em direção à região caudoventrolateral do bulbo (CVL) (Yu e Gordon, 1996). Neurônios do CVL, por sua vez, projetam-se para a região rostroventrolateral do bulbo (RVL), responsável por inibir os neurônios pré-motores simpáticos (Willete et al., 1983a, b e 1984a,b, Jeske et al., 1993). Os núcleos do trato solitário são constituídos por grupos heterogêneos de neurônios, que estão dispostos dorsalmente no bulbo. O NTS, em sua porção rostral, é formado por colunas bilaterais que se unem na altura do óbex para formar uma única estrutura na linha média. Segundo Paxinos eWatson (1986), o NTS se estende de aproximadamente 3,5 mm rostral até 0,7 mm caudal ao calamus scriptorius. O NTS pode ser dividido em três porções de acordo com a proximidade da área postrema em: NTS rostral, NTS intermediário e NTS comissural (caudal) (Valenti et al., 2007) (figura 1). O NTS intermediário recebe predominantemente as aferências provenientes dos barorreceptores (Ciriello et al., 1994, Dampney, 1994), enquanto o NTS comissural constitui o principal sítio no sistema nervoso central para o qual se projetam as aferências dos quimiorreceptores carotídeos (Finley e Katz, 1992; Chitravanshi et al., 1993; Ciriello et al., 1994; Chitravanshi e Sapru, 1995). Em ratos normotensos, a lesão eletrolítica do NTS comissural não produz alterações na pressão arterial basal,mas abole o componente pressor e bradicárdico do quimiorreflexo induzido pelo cianeto de potássio,além de reduzir a resposta de taquicardia reflexa promovida pelo nitroprussiato de sódio (Colombari et al., 1996, Sato et al., 1999 e 2000). Essa mesma lesão do NTS comissural em ratos espontaneamente hipertensos, todavia, provoca queda da pressão arterial para níveis semelhantes a de animais normotensos, reduzindo apenas o componente pressórico do quimiorreflexo promovido pelo cianeto de potássio e atenuando também as respostas barorreflexas dependentes de ativação simpática (Sato et al., 2001). Figura 1: Esquema inferior-representação de um corte transversal do bulbo do rato, mostrando a localização dos núcleos do tracto solitário (NTS) em relação a outros núcleos, como a área postrema (AP), núcleo grácil (Gr), núcleo cuneato (Cu), núcleo dorsal motor do vago (10), núcleo hipoglosso (12) e em relação ao canal central (cc). Esquema superior: subdivisões do NTS em relação à proximidade com a área postrema. Abreviações dos subnúcleos do NTS: r-rostral, m-medial, com-comissural, vl-ventrolateral. Extraído e adaptado de Ter Horst e Streefland (1994).  10 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  7. 7. Embora em animais normotensos a lesão do NTS comissural não promova alterações na pressão arterial basal, foi demonstrado que em ratos normotensos submetidos à desnervação aórtica há o aparecimento de hi- pertensão, porém se os animais são submetidos à desnervação aórtica e subsequente lesão do NTS comissural observou-se que os animais permanecem normotensos (Sato et al., 1999). Desse modo, a integridade do NTS comissural parece ser essencial para a manutenção da pressão arterial elevada nos ratos espontaneamente hipertensos ou em situações como a de desnervação aórtica. (Valenti et al., 2007) Koshiya e Guyenet (1996) mostraram, através de evidências eletrofisiológicas, a existência de neurônios quimios- sensíveis da porção comissural do NTS ativados antidromicamente pelo RVL, sugerindo que os neurônios do NTS comis- sural arborizam-se para o RVL.Tais observações indicam que não apenas os neurônios do NTS intermediário, mas também que os neurônios do NTS comissural possam enviar projeções diretas para o RVL. (Valenti et al., 2007) Há evidências consideráveis de que a atividade do nervo simpático é gerada por um grupo de neurônios no RVL, e que alterações centrais e reflexo cardiovascular diminuídos, em atividade nervosa simpática e pressão arterial (PA) res- pectivamente, são retransmitidas através destes neurônios (Kajekar et al., 2002, Guyenet et al. 1989). 11 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  8. 8. O exercício físico regular, desde que adequado, pode influenciar a hipertensão arterial. Embora o iníciodoexercíciofísicoenvolvaumaumentodaatividadenervosasimpáticaeinibiçãodoparassimpático (McCloskey e Mitchell,1972;Kaufman et al.1983),sabe-se que tanto em humanos hipertensos como em modelos de animais experimentais, o exercício físico aeróbio reduz os valores basais tanto da pressão arterial sistólica quanto da diastólica (Krieger e cols., 2001). Apesar de o exercício físico requerer um aumento da atividade nervosa simpática, observa-se que a realização do exercício físico não produz hipertensão arterial cronicamente, mas sim, diminuição da pressão em animais e humanos. Diversos estudos vêm sendo realizados com o intuito de esclarecer melhor quais vias levam a esta redução na PA. Sabe-se, por exemplo, que a dinâmica do treinamento físico aumenta a sensibilidade dos barorreceptores em ratos normotensos e em ratos espontaneamente hipertensos (SHR) (Brum et al., 2000). Evidências descritas nos últimos anos sugerem que o exercício físico pode promover mudanças no funcionamento de áreas bulbares envolvidas na regulação cardiovascular. Estudos de Mueller e Hasser (2006) demonstraram que o treinamento físico de ratos durante 8 semanas em esteira é capaz de induzir alterações no controle neural da circulação. Nestes animais, as respostas simpatoexcitatórias induzidas pela inibição do NTS intermediário foram abolidas,enquanto a transmissão glutamatérgica dependente da ativação de receptores ionotrópicos permaneceu inalterada.Embora nem todas as alterações induzidas pelo exercício no circuito bulbar sejam atualmente compreendidas, evidências indicam que aferentes somáticos (proprioceptores) projetam-se para o NTS em regiões que se estendem caudalmente ao óbex, o que inclui o NTScom.Além disso, tem-se demonstrado que estas aferências liberam substância P no NTS, que por sua vez, deprime a atividade barorreflexa por meio de circuitos GABAérgicos no NTS (Potts, 2006). Assim, diversos trabalhos na literatura vem tentando esclarecer mais algumas das várias alterações induzidas pelo exercício físico e que poderiam representar uma alternativa aos tratamentos farmacológicos da hipertensão arterial ou ainda uma terapia complementar ao tratamento farmacológico. Existem diferentes modalidades de exercício físico aeróbio e resistido. O exercício contra resistência, ou resistido, consiste num trabalho muscular local, que utiliza sobrecargas, como peso de máquinas, barras, anilhas, realizado com cargas moderadas e frequentes repetições, apresentando pausas entre as execuções,e,portanto,caracterizado como esforço descontínuo (Bermudes et al., 2004). O exercício resistido pode ser classificado em dinâmico (isotônico) e estático (isométrico).  12 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  9. 9. Embora o exercício resistido tenha sido aceito como uma forma de desenvolver força, de favorecer a realização de contrações repetidas por períodos prolongados (endurance) e de desenvolver hipertrofia muscular, sua importância para a saúde e em doenças crônicas somente foi reconhecida no na década de 90 (Pollock e Vincent, 1996, Pollock e Evans, 1999, US Department of Health and Human Services, 1996). Antes disso, o exercício resistido não era parte das diretrizes para exercício e reabilitação da American Heart Association e American College of Sports Medicine (ACSM). Em 1990, a ACMS reconheceu o exercício resistido como parte de um abrangente programa de fitness para adultos saudáveis de todas as idades (American College of Sports Medicine, 1990).Apesar de o exercício resistido melhorar a função cardíaca em indivíduos saudáveis (Pollock e cols,1996,Pollock e E vans, 1999), o exercício resistido tanto dinâmico quanto estático ou a combinação de ambos tradicionalmente não venha sendo recomendada para pacientes com doença coronariana, evidências sugerem que o exercício resistido com 8 a 12 repetições por série sejam menos prejudiciais do que se supunha, especialmente em pacientes com boa aptidão aeróbia e função sistólica do ventrículo esquerdo próxima do normal (Pollock e cols., 2000). Evidências indicam que o exercício resistido dinâmico reduz em média 3% da pressão arterial sistólica (PAS) e 4% da pressão arterial diastólica (PAD) sem alteração do peso corporal e da frequência cardíaca (FC) de repouso(Bermudes et al., 2004). Apesar do questionamento existente sobre o uso do modelo de natação em ratos como possível causador de estresse, estudos recentes mostram que ratos submetidos à natação de baixa intensidade por 4 semanas tiveram uma diminuição das respostas de ansiedade induzidas por contenção física e avaliadas com o protocolo de labirinto em cruz elevado, sugerindo que o exercício de natação pode ser uma ferramenta para o tratamento do estresse em ratos (Lapmanee e cols., 2012). 13 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  10. 10. Durante o exercício, a frequência cardíaca (FC) aumenta linearmente à medida em que a intensidade do exercício se eleva. O coração, apesar de ter a atividade intrínseca e, portanto, ser capaz de regular o seu ritmo, promover a condução dos estímulos intracardíacos e ter contractilidade, tem também suas funções amplamente moduladas pelo sistema nervoso autônomo simpático e parassimpático. Assim, o coração deve participar, e participa, sob a tutela do sistema nervoso autônomo, ativamente do processo homeostático orgânico, sendo o sistema nervoso autônomo o responsável pela regulação do ritmo e da função do bombeamento cardíaco, adequando essas funções às necessidades metabólicas e teciduais,às quais estão expostos os seres humanos nas suas atividades da vida diária (Roque., 2009). O estudo da modulação autonômica tem sido feito há algum tempo por meio da avaliação da variabilidade da frequência cardíaca (VFC) e é reconhecido como um versátil e promissor marcador desta variação. De forma geral, aVFC descreve as oscilações dos intervalos entre batimentos cardíacos consecutivos (intervalos R-R), que estão relacionadas às influências do sistema nervoso autônomo (SNA) sobre o nó sinusal, sendo uma medida que pode ser utilizada para identificar fenômenos relacionados ao SNA em indivíduos saudáveis, atletas e portadores de doenças (Aubert e cols., 2003;Task Force of the European Society of Cardiology and the North American Society of Pacing and Electrophysiology; Pumprla e cols., 2002).  14 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  11. 11. Considerando-se as evidências de que o exercício resistido dinâmico produz pequena redução da pressão arterial e não altera a frequência cardíaca de repouso, porém, sabendo-se que a intensidade do exercício pode incrementar de forma linear a elevação da FC durante o exercício, torna-se interessante investigar se esta modalidade de exercício induz inflamação e estresse oxidativo em áreas bulbares como o NTS e RVL, que estão envolvidas com a regulação autonômica cardiovascular. Adicionalmente, torna-se relevante avaliar se o exercício resisitido dinâmico modifica os componentes autonômicos (simpático e parassimpático) por meio da análise da variabilidade da frequência cardíaca. 15 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  12. 12. 1 -ANIMAIS Serão utilizados ratosWistar (300-350 g) fornecidos pelo Biotério da Faculdade de Medicina do ABC, alocados em caixas individuais com água e ração ad libitum.A umidade do biotério será mantida em ~70% e a temperatura ambiental em ~22º C. O ciclo claro-escuro do biotério também será controlado e estabelecido como sendo de 12 horas cada. 2 - EXERCÍCIO RESISTIDO DINÂMICO Os ratos serão inicialmente adaptados aos tanques de natação com exposições graduais à água durante 5 dias. Os tanques de natação serão individualizados. As dimensões dos tanques de PVC serão estabelecidas em 30 cm de diâmetro X 60 cm de profundidade. A água será aquecida (30-34o C) e colocada até a altura de 50 cm do tanque, totalizando uma área de superfície de natação de 4710 cm2. As sessões de exercício serão realizadas sempre no mesmo horário (10 às 12 horas). Os animais do grupo sedentário (controle) serão retirados do biotério, trazidos ao laboratório no mesmo período dos animais a serem submetidos ao exercício e mantidos nos tanques vazios durante o mesmo período dos animais do grupo natação. Durante o período de adaptação, os animais serão colocados nos tanques com carga de 10%, 20%, 30%, 40% e 50% ao longo das 5 primeiras sessões de exercício em dias alternados. Após o período de adaptação, as sessões de exercício resistido dinâmico consistirão em saltos em piscina com carga de 50% do peso corpóreo em dias alternados, 3 vezes por semana (4 séries de 10 saltos com intervalo de 1 min) por 6 semanas.  18 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  13. 13. 3 - EXPRESSÃO GÊNICA DE MARCADORES DO ESTRESSE OXIDATIVO, PROCESSO INFLAMATÓRIO E DE RECEPTORES DE ANGIOTENSINA II Após o período de 6 semanas, os animais submetidos ao exercício resistido dinâmico e sedentários serão eutanasiados com isoflurano 2% em O2 100% e submetidos á perfusão intracardíaca com 60 mL de soro fisiológico (NaCl 0,9%).Após a realização de uma craniotomia, o tronco encefálico será removido e imediatamente congelado em nitrogênio líquido para posterior armazenamento em freezer a -80º C. No dia do início do processamento para expressão gênica e proteica de marcadores do estresse oxidativo, processo inflamatório e de receptores de angiotensina II, os troncos encefálicos serão descongelados e será feita um punch (retirada) do NTS intermediário, NTS comissural e RVL. O tecido nervoso do NTS intermediário, NTS comissural e RVL serão retirados com o auxílio de microscópio cirúrgico a partir de secções transversais do tronco encefálico em campo com medidas estereotáxicas (segundo Paxinos e Watson,1986). O NTS intermediários está localizado a 0,5 mm rostral, ± 0,5 mm lateral e 0,5 ventral ao calamus scriptorius. O NTS comissural está localizado 0,5 mm caudal, 0,0 mm lateral e 0,3 mm ventral ao calamus scriptorius. O RVL está localizado a 2,6 mm rostral, ± 1,8 mm lateral e 2,3 mm ventral em relação ao calamus scriptorius. Somente serão considerados os animais com confirmação histológica de remoção do NTS intermediário, NTS comissural e da área RVL, cujas secções transversais do bulbo serão realizadas em micrótomo de congelamento e posteriormente, coradas com vermelho neutro para posterior visualização em microscopia óptica de campo claro. 19 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  14. 14. 3.1. ExtraçãodeRNAtotaldostecidosnervosos (NTS intermediário e comissural e RVL) O RNA total será posteriormente extraído das amostras do NTS intermediários, comissural e RVL utilizando-se o método do TRizol® (Invitrogen LifeTechnologies). O método do TRizol® consiste adicionar às amostras do tecido 0,5 mL de reagente Trizol® num microtubo de 2,0 mL e vortexado. A lise das células será feita por pipetagem repetitiva. Após ser incubado a temperatura ambiente por 5 min para permitir a completa dissociação dos complexos de nucleoproteínas, a solução será centrifugada (11.400 rpm, 15 min a 4C).A fase aquosa será cuidadosamente transferida para um microtubo novo para realizar lavagem com clorofórmio (200 µL) sob agitação intensa por 15 segundos e posterior incubação a temperatura ambiente por 5 minutos, seguido de nova centrifugação (11.400 rpm, 15 min a 4C).A mistura irá se separar em 3 fases:inferior orgânica (avermelhada contendo fenol), interfase e a superior aquosa e mais clara.A fase aquosa será transferida novamente para um microtubo limpo e o RNA total será precipitado com isopropanol (0,5 mL de isopropanol por mL de TRIzol® usado). Após a adição do isopropanol, seguir-se-á com centrifugação (11.400 rpm, 10 min a 4C). O pellet será então lavado com 1 mL de etanol 75%,e seco a 37C por 10 min. O RNA total será então ressuspenso em 30 µL de água livre de RNAse. A concentração do RNA será estimada pela densidade óptica (DO) da solução, através de espectrofotometria (NanoDrop 2000c –Thermo Scientific, USA). Para análise da pureza do RNA, calcula-se a razão entre a leitura da amostra na absorbância a 260 nm e a 280 nm, que é o comprimento de onda definido para leitura de proteínas e afins. Essa razão deverá ser maior que 1,8.As amostras de RNA serão então aliquotadas (5 *g) para posterior utilização (Chomczynski e Sacchi, 1987). 3.2. Reação de transcrição reversa Uma amostra de 5 g de cada RNA será submetida à reação de transcrição reversa com uma mistura de primers randômicos. Para isto, será adicionado em cada amostra tampão da enzima (50 mM de Tris-HCl pH 8,3, 75 mM de KCl, 3 mM de MgCl2), DTT (10 mM), mistura de dNTPs (0,5 mM cada), oligo dT (0,5g/L),  20 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  15. 15. inibidor de RNAase (40U) e a enzima transcriptase reversa (Superscript III – Invitrogen), em volume final de 20L. As reações serão incubadas por 70 min à 42oC, seguida de aquecimento à 70oC por 15 min para desnaturação da enzima. A seguir se realizarão os ensaios de PCR. 3.3. PolimeraseChainReaction em tempo real (RT-PCR) A expressão gênica dos marcadores do estresse oxidativo, processo inflamatório e de receptores de angiotensina II será avaliada por RT-PCR. O procedimento que será usado para estimar a quantidade relativa dos níveis de RNA mensageiro dos genes a serem estudados (marcadores do estresse oxidativo, processo inflamatório e de receptores AT-1), comparando todas as amostras com a expressão do gene constitutivo, a ciclofilina, em triplicata, e será baseado na detecção em tempo real do produto de PCR utilizando o kit Platinium SYBER Green PCR master mix medindo-se a fluorescência emitida com o programa ABI Prism 5700 detector (Applied Biosystems). A partir dos cDNAs obtidos serão realizadas as curvas de ciclos de amplificação para cada primer. As condições de amplificação (Concentrações do produto da transcriptase reversa e primers) serão padronizadas para cada gene. Ao final das reações, os dados serão analisados no Excel- Microsoft Office, e as amostras a serem estudadas serão normalizadas pelos seus controles correspondentes. Os primers a serem utilizados seguem abaixo: Interleucina-6 (IL-6): Sense: AGAGACTTCCAGCCAGTTGC Antisense: AGTCTCCTCTCCGGACTTGT TNF-: Sense: ACAGCAACTCCAGAACACCC Antisense: GGAGGGAGATGTGTTGCCTC Cicloxigenase-2 (COX-2): Sense: GATGACGAGCGACTGTTCCA Antisense: TGGTAACCGCTCAGGTGTTG Superóxido dismutase: Sense: TTCCTGCGGCGGCTTCTGTC Antisense:GCACACGGCCTTCATCGCCA NADPH oxidase: Sense: TGCTCCTAAGAGGCTCCAGACC Antisense: TCAGCCCCAACCAAGAAACCAGA Glutationa sintetase: Sense: AAGGGGACCAGGCTGTCGCT Antisense: TCCGCCCTCTCTTTGGGGCT Catalase: Sense: CCAGACACTCACCGCCACCG Antisense: GGGCCATCGCGCTGGTAGTT Óxido nítrico sintetase 1 (NOS-1): Sense: AGAGGCGACAGAAACTCTGC Antisense: GCTGAACCCCAAACGTGTTC Receptor AT-1: Sense: AGTCCTGTTCCACCCGATCA Antisense: TCCAGACAAAATGCCAGCCA 21 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  16. 16. A reação terá duas fases: a primeira a 50°C por 2 min para ativação da enzima; a segunda, a 95°C por 10 minutos para desnaturação. Em seguida, 50 ciclos de 3 fases: primeiramente a 95°C, por 20 s (desnaturação), a segunda a 58 °C, por 30 s (anelamento) e a terceira a 72 °C, por 30 s (extensão). Será avaliado o ponto inicial do ciclo (CT) do RT-PCR em duplicata para cada amostra. Cada CT relaciona-se com o número do ciclo do PCR e representa a intensidade da fluorescência emitida pelo produto do RT-PCR amplificado do gene alvo, sendo inversamente proporcional ao conteúdo de RNA-m da amostra. O cálculo da variação de CT (ΔCT) será feito subtraindo-se o valor do CT do gene de interesse (para IL-6, TNF-, COX-2, superóxido dismutase, NADPH oxidase, glutationa sintetase, catalase, NOS-1 e receptor AT-1) do valor do CT do gene usado como referência (ciclofilina). As variações entre as amostras serão normaliza- das pela média da variação do valor de CT (ΔCT) dos animais controle. Esse valor obtido (ΔΔCT) será usado para calcular a expressão relativa do gene para IL-6, TNF-, COX-2, superóxido dismutase, NADPH oxidase, glutationa sintetase, catalase, NOS-1 e receptor AT-1 através da expressão 2-DDCT, representada em unidades arbitrárias (Livak & Schmittgen, 2001). 4 - CANULAÇÃO DA ARTÉRIA E VEIA FEMORAL PARA REGISTRO DA PRESSÃO ARTERIAL (PA), FREQUÊNCIA CARDÍACA (FC) E DETERMINAÇÃO DA MODULAÇÃO AUTONÔMICA CARDIOVASCULAR Para a confecção das cânulas serão utilizados tubos de polietileno PE-50 (Becton Dickinson and Company, 7 Loveton Circle Sparks, MD) soldados a tubos de polietileno PE-10 (Becton Dickinson and Company, 7 Loveton Circle Sparks, MD) com angulação de 90° próxima à emenda (posição anatômica para cateterização). Os tubos PE-10 serão esticados (15-25%) sob vapor para reduzir seu diâmetro externo, permitindo melhor fluxo sanguíneo colateral para a pata cateterizada. Antes do implante, o interior das cânulas será lavado e preenchido com solução salina 0,9% (esterilizado e despirogenizado) sendo as extremidades PE-50 de cada cânula obstruída com pino de aço inoxidável. Sob anestesia (quetamina 50 mg/Kg, i.p.; Dopalen,Vetbrands, Jacareí, SP e xilazina 2% 10 mg/Kg, i.m.; Sedafarm, Farmabase Saúde animal, Jaguariúna, SP), os animais serão submetidos a uma incisão na face ventral do membro pélvico direito e a artéria femoral será dissecada e exposta. A porção PE-10 das cânulas arterial e venosa será inserida na luz dos vasos femorais e a porção PE-50 será conduzida subcutaneamente utilizando-se um trocanter até o dorso do animal, a fim de exteriorizar e fixar as cânulas no espaço interescapular, para permitir registros da PA em animais não anestesiados em livre movimentação, bem como infusão intravenosa de drogas. Em cada cânula será injetado 0,1 mL de solução salina 0,9% contendo heparina (5.000 UI, Cristália, Itapira, SP) numa proporção de 10:1, a fim de evitar a formação de coágulos dentro das mesmas. A incisão na pata direita de cada animal será, em seguida, suturada e os animais acondicionados em gaiolas individuais sob condições de temperatura, luminosidade e níveis de ruído controlados até o  22 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  17. 17. momento dos experimentos. Será realizada a administração 0,2 mL de Pentabiótico Veterinário (2000 U/mL) (Fort Dodge, Campinas, SP, Brasil) como medida profilática e os animais serão analgesiados utilizando-se buprenorfina (0,3 m/kg, s.c.) (Fort Dodge, Campinas, SP, Brasil) imediatamente após o término da cirurgia. As cateterizações de artéria e veia femorais nos grupos experimentais serão feitas em grupos diferentes, devido à necessidade de medida destes parâmetros em momentos diferentes do protocolo de exercício: um grupo será avaliado após a terceira semana de exercício, um segundo grupo será avaliado após a sexta semana de exercício e um terceiro grupo será avaliado após a terceira semana de recuperação como citado no item 3 que explica como será o protocolo de exercício. Os registros de PA e FC serão realizados por 60 min durante o período de repouso e estes dados serão submetidos à análise do controle autonômico cardiovascular (software Cardio Series), utilizando-se a ferramenta de análise tempo-frequência da variabilidade da FC e da PA sistólica (PAS).As variabilidades da PAS e do intervalo de pulso (variabilidade da FC) no domínio do tempo e da frequência serão avaliadas utilizando-se aTransformata Rápida de Fourier (análise espectral). Os componentes oscilatórios serão quantificados em duas faixas de frequência de interesse: frequências altas (HF) entre 0,6 e 4 Hz e frequências baixas (LF) entre 0,2 e 0,6 Hz. Segmentos que apresentem oscilações em muito baixa frequência (< 0,1 Hz) que contribuam para mais de 70% de toda a variabilidade serão considerados segmentos não estacionários e serão descartados do estudo. As potências de LF e HF serão consideradas como marcadores simpático e parassimpático, respectivamente, e da razão LF/HF será considerada como marcador do balanço simpato- vagal. Ao final dos experimentos, os animais serão eutanasiados com sobredose de tiopental sódico (170 mg/kg i.v.). 23 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  18. 18. 5 - MEDIDA DA PRESSÃO DE CAUDA E FREQUÊNCIA CARDÍACA EM RATOS NÃO ANESTESIADOS A pressão de cauda dos animais será determinada no início dos experimentos e ao final das 6 semanas de exercício para confirmar se os animais utilizados eram realmente normotensos e também avaliar os efeitos do exercício após o período de 6 semanas.A pressão de cauda será medida,aquecendo-se a cauda do animal e colocando-se um oclusor na cauda do rato. O oclusor será insuflado até que não haja fluxo sanguíneo na cauda e em seguida, liberado para que os primeiros pulsos do fluxo arterial pudessem ser detectados. O oclusor será conectado a um transdutor e o sinal será amplificado (BioAmplifier, AD Instruments),digitalizado e registrado num sistema de aquisição de dados (MacLab Power Lab System 4SP, AD Instruments).A frequência cardíaca basal nos ratos não anestesiados será calculada a partir dos pulsos de pressão de cauda no sistema de aquisição de dados (MacLab Power Lab System 4SP,AD Instruments). 6 - PROTOCOLOS EXPERIMENTAIS 6.1. Efeito do exercício resistido dinâmico sobreaexpressãogênicademarcadoresdoestresse oxidativo, processo inflamatório e receptores de angiotensina II em neurônios bulbares Este protocolo experimental visa avaliar se a expressão gênica de marcadores do estresse oxidativo, processo inflamatório e receptores de angiotensina II no NTS intermediário,comissural e RVL dos ratos Wistar poderia ser modificada pelo exercício resistido dinâmico. Os ratos serão aleatoriamente divididos em 2 grupos: exercício resistido e sedentários. Os animais do grupo exercício serão adaptados aos tanques de natação, conforme descrito anteriormente, para depois prosseguirem com sessões diárias de exercício resistido dinâmico, de saltos em piscina com carga de 50% do peso corpóreo em dias alternados, 3 vezes por semana (4 séries de 10 saltos com intervalo de 1 min) por 6 semanas, em tanques individuais com água aquecida. O grupo de animais sedentários também será levado ao laboratório em que foi realizado o exercício e colocados nos tanques vazios durante o mesmo período dos animais do grupo exercício. Ao final de cada sessão de exercício, os ratos serão submetidos à secagem manual com toalha e mantidos com luz para aquecimento nas caixas plásticas de acomodação dos animais para finalização da secagem dos pêlos dos animais. Na última semana de exercício, 3 dias antes do final do período de exercício, os ratos serão submetidos novamente à medida  24 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  19. 19. da pressão de cauda e FC. No último dia do período de 6 semanas de exercício, após a secagem dos animais, estes serão profundamente anestesiados com isoflurano 3% em O2 100% e submetidos à abertura da caixa torácica para perfusão intracardíaca com 50 mL de soro fisiológico. Em seguida, será feita a retirada do tronco encefálico dos animais para imediato congelamento em nitrogênio líquido. Após congelamento,os encéfalos serão armazenados em freezer a -80º C até o dia do processamento do RT-PCR em tempo real. No dia do processamento, os encéfalos foram descongelados e foi feito um punch (retirada) do NTS comissural e RVL. Estas áreas foram colocadas em microtubos (eppendorf) para a adição dos reagentes que darão início à extração do RNA total. Em seguida, será feita a reação de transcrição reversa e, por último, será processada a reação da polimerase em cadeia em tempo real para expressão gênica de marcadores do estresse oxidativo, processo inflamatório e receptoresAT-1, no NTS intermediário, comissural e RVL dos ratos dos grupos sedentário e exercício. 6.2. Análise da Variabilidade da Frequência Cardíaca em ratos submetidos ao exercício resistido dinâmico e sedentários Este protocolo experimental visa investigar se o exercício resistido dinâmico promove alterações nos componentes autonômicos simpático e parassimpático Para a análise daVFC, será utilizado o Software CardioSeries (desenvolvido pelo Dr. Daniel Penteado Martins Dias). Para análise do Domínio da Frequência, serão verificados os componentes de Baixa frequência (Low Frequency, LF), ou ondas de Mayer (0,2 a 0,75 Hz em ratos), que reflete a modulação simpática, e Alta frequência (High Frequency, HF), ou ondas de Hering (0,75 a 4,0 Hz em ratos), que correspondem a modulação vagal e sofrem influência da modulação respiratória, ou seja, refletem a influência da respiração na Frequência cardíaca (FC). Para análise no domínio do tempo, serão verificadas as flutuações da frequência cardíaca ao longo do tempo de monitorização. 6.3.Análise do Barorreflexo em ratos submetidos ao exercício resistido dinâmico Este protocolo pretende investigar se os animais submetidos à modalidade de exercício resistido dinâmico com 50% de carga corporal é capaz de induzir alterações no barorreflexo após 6 semanas de exercício. Nos ratos previamente submetidos à canulação da artéria e veia femoral do protocolo 6.2.,será realizada a administração de duas drogas intravenosamente para induzir resposta barorreflexa. Será administrado fenilefrina, um agonista receptores α1-adrenérgicos, nas doses de 1,5 e 3 µg/kg i.v. para induzir o aparecimento de resposta pressora e bradicardia reflexa. O nitroprussiato de sódio, um doador de óxido nítrico, será administrado nas doses de 15 e 30 µg/kg i.v. para induzir o aparecimento de hipotensão e taquicardia reflexa. 25 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  20. 20. 7 -ANÁLISE ESTATÍSTICA Osdadosobtidosserãoanalisadospeloteste-tStudentnão-pareado.Asdiferençasserãoconsideradas significantes para p<0,05. 8 - REFERÊNCIAS BIBLIOGRÁFICAS AboA, Pick E, HallA,Totty N,Teahan CG, SegalAW.Activation of the NADPH oxidase involves the small GTP-binding protein p21rac1. Nature. 1991;353:668–670. American College of Sports Medicine position stand: the recommended quantity and quality of exercise for developing and maintaining cardiorespiratory and muscular fitness in healthy adults. Med Sci Sports Exerc. 1990;22:265–274. Arora S,Vaishya R, Dabla PK, Singh B. NAD(P)H oxidases in coronary artery disease. Adv Clin Chem. 2010;50:65–86. AubertAE, Seps B, Beckers F (2003). Heart rate variability in athletes. Sports Med.; 33(12):889-919. Bermudes, A. M. L. D. M., Vassallo, D. V., Vasquez, E. C., & Lima, E. G. (2004). Ambulatory blood pressure monitoring in normotensive individuals undergoing two single exercise sessions: resistive exercise training and aerobic exercise training.Arquivos brasileiros de cardiologia, 82(1), 57-64. Berra, C. M., Menck, C. F., & Di Mascio, P. (2006). Oxidative stress, genome lesions and signaling pathways in cell cycle control. Química Nova,29(6), 1340-1344. Brum, P. C., Da Silva, G. J. J., Moreira, E. D., Ida, F., Negrão, C. E., & Krieger, E. M. (2000). Exercise training increases baroreceptor gain sensitivity in normal and hypertensive rats. Hypertension, 36(6), 1018-1022. Cardoso, LM, Colombari, DSA, Menani, JV, Chianca-Jr, DA, Colombari, E. Cardiovascular responses produced by central injection of hydrogen peroxide in conscious rats. Brain Research Bulletin 71: 37-44 , 2006a. Cardoso, LM, Colombari, DSA, Menani, JV, De Paula, PM, Chianca-Jr, DA, Colombari, E. Espécies Reativas de Oxigênio no Controle Neurovegetativo da Pressão Arterial. Medicina 39 (X Simpósio Brasileiro de Fisiologia Cardiovascular), 77-8, 2006b. Contarteze, R.V. L., Manchado, F. D. B., Gobatto, C.A., & De Mello, M.A. R. (2008). Stress biomarkers in rats submitted to swimming and treadmill running exercises.Comparative Biochemistry and Physiology PartA: Molecular & Integrative Physiology, 151(3), 415-422.  26 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  21. 21. Evans, M. D., Dizdaroglu, M., & Cooke, M. S. (2004). Oxidative DNA damage and disease: induction, repair and significance. Mutation Research/Reviews in Mutation Research, 567(1), 1-61. Förstermann U. Oxidative stress in vascular disease: causes, defense mechanisms and potential therapies. Nat Clin Pract Cardiovasc Med 2008;5: 338-49. Galkina E, Ley K. Immune and inflammatory mechanisms of atherosclerosis (*) Annu Rev Immunol. 2009;27:165–197. Gilders RM, Voner C, Dudley GA. Endurance training and blood pressure in normotensive and hypertensive adults. Med Sci Sports Exer 1989; 21: 629-36. Gilmont RR, DardanoA, Engle JS,Adamson BS,Welsh MJ, LiT, Remick DG, Smith DJ Jr, Rees RS.TNF- alpha potentiates oxidant and reperfusion-induced endothelial cell injury. J Surg Res. 1996;61:175–182. Goldblatt H, Lynch J, Hanzal RF, Summerville WW. Studies on experimental hypertension: I. The production of persistent elevation of systolic blood pressure by means of renal ischemia. J Exp Med. 1934;59: 347–379. Guyenet PG, Haselton JR, and Sun MK. Sympathoexcitatory neurons of the rostroventrolateral medulla and the origin of the sympathetic vasomotor tone. Prog Brain Res 81: 105–116, 1989. Kahn JR, Skeggs LT Jr, Shumway NP,Wisenbaugh PE.The assay of hypertensin from the arterial blood of normotensive and hypertensive human beings. J Exp Med. 1952;95:523–529. Kajekar, R., Chen, C.Y., Mutoh,T., & Bonham,A. C. (2002). GABAA receptor activation at medullary sympathetic neurons contributes to postexercise hypotension.American Journal of Physiology-Heart and Circulatory Physiology, 282(5), H1615-H1624. Lapmanee S; Charoenphandhu N; Krishnamra N; Charoenphandhu J (2012). Anxiolytic-like actions of reboxetine, venlafaxine and endurance swimming in stressed male rats. Behavioural Brain Research, 23, 120–28. Lima EG, Herkenhoff F,Vasquez EC. Monitorização ambulatorial da pressão arterial em indivíduos com resposta exagerada dos níveis pressóricos em esforço. Influência do condicionamento físico. Arq Bras Cardiol 1998;70: 1-7. Munoz MJ, Braun-Menendez E, Fasciolo JD, Leloir LF. Hypertensin: the substance causing renal hypertension. Nature. 1939;144:980. Page IH, Helmer OM.A crystalline pressor substance (angiotonin) resulting from the reaction between renin and renin-activator. J Exp Med. 1940;71:29–42. PearsonTA, Mensah GA,Alexander RW,Anderson JL, Cannon RO 3rd, Criqui M, FadlYY, Fortmann SP, HongY, Myers GL, et al. Markers of inflammation and cardiovascular disease: application to clinical and public health practice:A statement for healthcare professionals from the Centers for Disease Control and Prevention and theAmerican HeartAssociation. Circulation. 2003;107:499–511. 27 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  22. 22. Pollock ML,EvansWJ.Resistance training for health and disease.Med Sci Sports Exerc.1999;31:10 –11. Pollock ML, Franlin BA, Balady GJ, Chaitman BL, Fleg JL, Fletcher B, Limacher M, Piña IL, Stein RA, Williams M, Bazzare T. Resistance Exercise in Individuals With and Without Cardiovascular Disease: Benefits. Circulation 101:828-833, 2000.; Pollock ML,Vincent KR. Resistance training for health.The President’s Council on Physical Fitness and Sports Research Digest. December 1996; Series 2, No. 8. Pumprla J, Howorka K, Groves D, Chester M, Nolan J (2002). Functional assessment of heart rate variability: physiological basis and practical applications. Int J Cardiol.; 84(1):1-14. Roque, J. M.A. (2009).Variabilidade da frequência cardíaca. Skeggs LT Jr, Lentz KE, Kahn JR, Shumway NP,Woods KR.The amino acid sequence of hypertension. II. J Exp Med. 1956;104:193–197. Skeggs LT Jr,MarshWH,Kahn JR, Shumway NP.Amino acid composition and electrophoretic properties of hypertensin I. J Exp Med. 1955;102:435– 440. Task Force of the European Society of Cardiology and the North American Society of Pacing and Electrophysiology (1996). Heart rate variability: standards of measurement, physiological interpretation and clinical use. Circulation; 93(5):1043-65. Touyz RM. Reactive oxygen species as mediators of calcium signaling by angiotensin II: implications in vascular physiology and pathophysiology.Antioxid Redox Signal 2005;7:1302-14. US Department of Health and Human Services. Physical Activity and Health: A Report of the Surgeon General.Atlanta,Ga:USDeptofHealthandHumanServices,CentersforDiseaseControlandPrevention, National Center for Chronic Disease Prevention and Health Promotion; 1996.) Valenti,V.E.,Sato,M.A.,Ferreira,C.,&Abreu,L.C.(2007).Regulação neural do sistema cardiovascular: centros bulbares. Rev Neuroci, 15(4), 275-9. Weinberg, ED. Cellular iron metabolism in health and disease. Drug Metab Rev. 22: 531-579, 1990.  28 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares
  23. 23. 29 Avaliação dos efeitos do exercício resistido dinâmico em ratos sobre a variabilidade da frequência cardíaca e marcadores pró-inflamatórios e do estresse oxidativo em neurônios bulbares

×