SlideShare uma empresa Scribd logo
1 de 2
REVISÃO CITOLOGIA
1. (UF-RN) A conseqüência mais importante da mitose é:
a) determinar a diferenciação celular.
b) a produção de gametas e esporos haplóides.
c) a produção de células iguais à célula mãe.
d) aumentar a variabilidade genética dos seres vivos.
e) aumentar a taxa de mutação.
2. (UFRO-RO) Os ítens abaixo se referem à mitose e todos
eles estão corretos, exceto:
a) É um processo de divisão celular importante para o
crescimento dos organismos.
b) Ocorre nas células somáticas de animais e vegetais.
c) Uma célula-mãe origina duas células-filhas com o
mesmo número de cromossomos.
d) A duplicação do DNA ocorre na fase da metáfase.
e) Na fase da telófase, forma-se uma nova membrana
nuclear em torno dos cromossomos e o citoplasma se
divide
3. (PUC-SP) A maioria das reaçðes químicas da célula,
incluindo a duplicação de DNA, a síntese de RNA e a
produção de proteínas celulares, ocorre, principalmente,
durante a:
a) prófase.
b) metáfase
c) anáfase
d) telófase.
e) intérfase.
4. A respeito das estruturas apontadas no esquema acima,
assinale a alternativa correta.
a) 5 indica uma organela que participa diretamente do
processo de divisão celular, embora esteja ausente em
células vegetais.
b) 1 indica uma organela pouco desenvolvida em células
glandulares.
c) Uma vez que a célula amadurece, o número de organelas
2 não se altera.
d) 4 é capaz de impedir a passagem de qualquer toxina
para o interior da célula.
e) Em 3 ocorre a transcrição, uma das etapas da síntese de
proteínas.
5. (UNICS/AL-2011) A figura dada representa uma célula
______________ e as estruturas indicadas pelas setas 1 e 2
são: __________ e ___________ .
A alternativa que completa, correta e respectivamente, a
frase é:
a) animal ... mitocôndria ... núcleo
b) vegetal ... cloroplasto ... vacúolo
c) vegetal ... mitocôndria ... vacúolo
d) animal ... cloroplasto ... núcleo
e) vegetal ... cloroplasto ... núcleo
6. (CESGRANRIO-
RJ) Dos constituintes celulares abaixo relacionados, qual e
stá presente somente nos eucariontes
e representa um dos critérios utilizados para distingui-
los dos procariontes?
A) DNA.
B) Envoltório nuclear.
C) Membrana celular.
D) RNA.
E) Ribossomo.
7. (UEM-PR) Os itens de I a VII, abaixo, referem-
se a componentes da célula.
I — Retículo endoplasmático
II — Membrana plasmática
III — Mitocôndrias
IV — Parede celular
V — Plastos
VI — Centríolos
VII — Aparelho de Golgi
Considerandose A a célula vegetal e B a célula animal, indi
que o que for correto.
01. I está presente em A e em B.
02. II está presente em A e ausente em B.
04. III está presente em A e ausente em B.
08. IV está presente em A e ausente em B.
16. V está presente em A e ausente em B.
32. VI está presente em A e ausente em B.
64. VII está presente em A e em B.
8. (MOJI-SP) A membrana plasmática, apesar de invisível
ao microscópio óptico, está presente:
a) em todas as células, seja ela procariótica ou eucariótica.
b) apenas nas células animais.
c) apenas nas células vegetais.
d) apenas nas células dos eucariontes.
e) apenas nas células dos procariontes.
9. (UFRS) Tanto em uma célula eucarionte quanto em uma
procarionte podemos encontrar:
a) membrana plasmática e retículo endoplasmático.
b) ribossomos e aparelho de Golgi.
c) mitocôndrias e nucléolo.
d) mitocôndrias e centríolos.
e) membrana plasmática e ribossomos.
10. (UFES-ES) O modelo abaixo representa a configuração
molecular da membrana celular, segundo Singer e
Nicholson.
Acerca do modelo proposto, assinale a alternativa
incorreta.
a) O algarismo 1 assinala a extremidade polar (hidrófila)
das moléculas lipídicas.
b) O algarismo 2 assinala a extremidade apolar (hidrófoba)
das moléculas lipídicas.
c) O algarismo 3 assinala uma molécula de proteína.
d) O algarismo 4 assinala uma molécula de proteína que
faz parte do glicocálix.
e) O algarismo 5 assinala uma proteína extrínseca à
estrutura da membrana.
11. (Mackenzie-SP) Considere as seguintes funções
atribuídas a uma organela celular:
I- Armazenamento de substâncias.
II- Secreção celular.
III- Formação de lisossomas.
Esta organela é:
a) plasto.
b) mitocôndria.
c) complexo golgiense.
d) retículo endoplasmático.
e) vacúolo.
12. (PUC-RJ) As células animais diferem das células
vegetais porque estas contêm várias estruturas e organelas
características. Na lista abaixo, marque a organela ou
estrutura comum às células animais e vegetais.
a) vacúolo d) membrana celular
b) parede celular e) centríolo
c) cloroplastos
13. (U. LONDRINA) Os grânulos que, ao microscópio
eletrônico, são vistos sobre o retículo endoplasmático são
os:
a) ribossomos. b) mitocôndrios.
c) citocromos. d) corpúsculos de Golgi.
e) vacúolos de pinocitose.
14. (Mogi-SP) A função do retículo endoplasmático rugoso
é a síntese de grande parte das proteínas celulares, porque
apresenta presos às suas membranas:
a) mitocôndrias d) ribossomos
b) centríolos e) pinossomos
c) lisossomos
14..Cite as principais diferenças entre RNA e DNAquanto
à estrutura de nucleotídeos?
15. Se uma fita de DNA tiver constituição
5’ATAAGCGTTAG 3’, como será a molécula
complementar de DNA?
16. Relacione as colunas 1 e 2, relativas às organelas e a
uma de suas funções na célula (1,0):
1
a) 1 com E e 2 com D
b) 3 com A e 4 com C
c) 2 com C e 1 com D
d) 4 com C e 3 com B
e) 4 com A e 2 com E
2
1. lisossomos
2. centríolos
3. ribossomos
4. mitocôndria
A. síntese de proteínas
B. síntese de ATP
C. divisão celular
D. digestão celular
E. síntese de gorduras
17. Complete as frases de 11 a 18 preenchendo cada
espaço com um dos termos a seguir (0,25 cada questão):
(a) complexo de Golgi (e) mitocôndria
(b) citoplasma (f) retículo endoplasmático liso
(c) citosol (g) retículo endoplasmático rugoso
(d) lisossomo (h) ribossomo
11. A região da célula situada entre a membrana nuclear e
a membrana plasmática é chamada ( ).
12. ( ) é um dos nomes que se dá ao líquido que
preenche o espaço entre o núcleo celular e a M.P.
13. ( ) é o conjunto de bolsas membranosas com
ribossomos aderidos à superfície, presente no
interior das células eucarióticas.
14. ( ) é uma organela citoplasmática delimitada por 2
membranas – a externa, lisa, e a interna, com
muitas pregas – no interior da qual ocorre a respiração
celular.
15. ( ) é uma pequena bolsa membranosa que contém
enzimas capazes de digerir macromoléculas.
16. Uma estrutura citoplasmática constituída por bolsas
membranosas com função de empacotar,
endereçar e exportar substâncias produzidas pela célula é a
(o) ( ).
17. ( ) é uma pequena estrutura granular constituída por
proteínas e RNA, cuja função é sintetizar
proteínas.
18. O conjunto formado por tubos membranosos
interligados, sem ribossomos aderidos, presente no
interior das células eucarióticas, é chamado ( ).
18. (U.E. Ponta Grossa-PR) Uma das funções do
complexo de Golgi é:
a) sintetizar esteróis d) eliminar secreções
b) duplicar o DNA e) absorver proteínas
c) sintetizar glicoproteínas
19. (PUC-SP) O retículo endoplasmático possibilita a:
a) respiração celular
b) troca de material entre célula e o meio
c) fermentação das bactérias
d) reprodução dos procariontes
e) síntese de proteínas
20 .(UECE) As enzimas contidas nos lisossomos são
sintetizadas pela célula a partir do(a):
a) complexo de Golgi d) mitocôndria
b) R.E.L. e) centríolo
c) R.E.R.
21. Escreva a sequência de bases da fita complementar do
DNA dupla fita que apresenta uma fita com a sequência:
(5') ATGCCGTATGCATTGCATTC (3')

Mais conteúdo relacionado

Mais procurados

Exercicios citologia blog
Exercicios citologia blogExercicios citologia blog
Exercicios citologia blog
Sheila Vieira
 
apostilla Bilogia Iesde
apostilla Bilogia Iesdeapostilla Bilogia Iesde
apostilla Bilogia Iesde
TiagOo Fonseca
 
Plano de aula adriana fernandes vii (prova)
Plano de aula adriana fernandes vii (prova)Plano de aula adriana fernandes vii (prova)
Plano de aula adriana fernandes vii (prova)
familiaestagio
 
Treinamento ácidos nucléicos
Treinamento ácidos nucléicosTreinamento ácidos nucléicos
Treinamento ácidos nucléicos
emanuel
 
Aula04 citoplasma ou-hialoplasmacbm05012022
Aula04 citoplasma ou-hialoplasmacbm05012022Aula04 citoplasma ou-hialoplasmacbm05012022
Aula04 citoplasma ou-hialoplasmacbm05012022
SandroMendes25
 
Aula01 organizao celular-da-vidacbm15122021
Aula01 organizao celular-da-vidacbm15122021Aula01 organizao celular-da-vidacbm15122021
Aula01 organizao celular-da-vidacbm15122021
SandroMendes25
 
Trabalho de biologia 1o ano eemar (citologia)
Trabalho de biologia 1o ano eemar (citologia)Trabalho de biologia 1o ano eemar (citologia)
Trabalho de biologia 1o ano eemar (citologia)
macicb
 
Exercícios sobre membrana e transportes osmose animal e vegetal
Exercícios sobre membrana e transportes  osmose animal e vegetal Exercícios sobre membrana e transportes  osmose animal e vegetal
Exercícios sobre membrana e transportes osmose animal e vegetal
Grupo UNIASSELVI
 
Treinamento citoplasma
Treinamento citoplasmaTreinamento citoplasma
Treinamento citoplasma
emanuel
 
Aula03 transportes de-substnciascbm21122021
Aula03 transportes de-substnciascbm21122021Aula03 transportes de-substnciascbm21122021
Aula03 transportes de-substnciascbm21122021
SandroMendes25
 
Treinamento de membrana plasmática
Treinamento de membrana plasmáticaTreinamento de membrana plasmática
Treinamento de membrana plasmática
emanuel
 
Plano de aula 8 prova - alana
Plano de aula 8   prova  - alanaPlano de aula 8   prova  - alana
Plano de aula 8 prova - alana
familiaestagio
 
Revestimentos celulares 3 a aula 6
Revestimentos celulares 3 a aula 6Revestimentos celulares 3 a aula 6
Revestimentos celulares 3 a aula 6
César Milani
 

Mais procurados (19)

Exercicios citologia blog
Exercicios citologia blogExercicios citologia blog
Exercicios citologia blog
 
Celulas ii
Celulas iiCelulas ii
Celulas ii
 
apostilla Bilogia Iesde
apostilla Bilogia Iesdeapostilla Bilogia Iesde
apostilla Bilogia Iesde
 
Atividade organelas
Atividade organelasAtividade organelas
Atividade organelas
 
Estudo dirigido i bcm prof_marconi
Estudo dirigido i bcm prof_marconiEstudo dirigido i bcm prof_marconi
Estudo dirigido i bcm prof_marconi
 
Plano de aula adriana fernandes vii (prova)
Plano de aula adriana fernandes vii (prova)Plano de aula adriana fernandes vii (prova)
Plano de aula adriana fernandes vii (prova)
 
Exercícios iniciais
Exercícios   iniciaisExercícios   iniciais
Exercícios iniciais
 
Seres vivos - células
Seres vivos - células Seres vivos - células
Seres vivos - células
 
Treinamento ácidos nucléicos
Treinamento ácidos nucléicosTreinamento ácidos nucléicos
Treinamento ácidos nucléicos
 
Aula04 citoplasma ou-hialoplasmacbm05012022
Aula04 citoplasma ou-hialoplasmacbm05012022Aula04 citoplasma ou-hialoplasmacbm05012022
Aula04 citoplasma ou-hialoplasmacbm05012022
 
Aula01 organizao celular-da-vidacbm15122021
Aula01 organizao celular-da-vidacbm15122021Aula01 organizao celular-da-vidacbm15122021
Aula01 organizao celular-da-vidacbm15122021
 
Trabalho de biologia 1o ano eemar (citologia)
Trabalho de biologia 1o ano eemar (citologia)Trabalho de biologia 1o ano eemar (citologia)
Trabalho de biologia 1o ano eemar (citologia)
 
Exercícios sobre membrana e transportes osmose animal e vegetal
Exercícios sobre membrana e transportes  osmose animal e vegetal Exercícios sobre membrana e transportes  osmose animal e vegetal
Exercícios sobre membrana e transportes osmose animal e vegetal
 
Treinamento citoplasma
Treinamento citoplasmaTreinamento citoplasma
Treinamento citoplasma
 
Aula03 transportes de-substnciascbm21122021
Aula03 transportes de-substnciascbm21122021Aula03 transportes de-substnciascbm21122021
Aula03 transportes de-substnciascbm21122021
 
Treinamento de membrana plasmática
Treinamento de membrana plasmáticaTreinamento de membrana plasmática
Treinamento de membrana plasmática
 
Componentes orgânicos: Ácidos nucleicos
Componentes orgânicos: Ácidos nucleicosComponentes orgânicos: Ácidos nucleicos
Componentes orgânicos: Ácidos nucleicos
 
Plano de aula 8 prova - alana
Plano de aula 8   prova  - alanaPlano de aula 8   prova  - alana
Plano de aula 8 prova - alana
 
Revestimentos celulares 3 a aula 6
Revestimentos celulares 3 a aula 6Revestimentos celulares 3 a aula 6
Revestimentos celulares 3 a aula 6
 

Semelhante a Revisão

Plano de aula adriana fernandes vii (prova)
Plano de aula adriana fernandes vii (prova)Plano de aula adriana fernandes vii (prova)
Plano de aula adriana fernandes vii (prova)
familiaestagio
 
Exercício de biologia
Exercício de biologiaExercício de biologia
Exercício de biologia
ADÃO Graciano
 
Organização celular
Organização celularOrganização celular
Organização celular
ajsmorais
 
Estudo dirigido de Biologia: citologia e divisão celular
Estudo dirigido de Biologia: citologia e divisão celularEstudo dirigido de Biologia: citologia e divisão celular
Estudo dirigido de Biologia: citologia e divisão celular
Ronaldo Santana
 
Citoplasma e organelas
Citoplasma e organelasCitoplasma e organelas
Citoplasma e organelas
profatatiana
 

Semelhante a Revisão (20)

Bio01 livro-propostos
Bio01 livro-propostosBio01 livro-propostos
Bio01 livro-propostos
 
T.D CITOLOGIA
T.D CITOLOGIAT.D CITOLOGIA
T.D CITOLOGIA
 
Aula Sobre Citologia
Aula Sobre CitologiaAula Sobre Citologia
Aula Sobre Citologia
 
ESTUDO DIRIGIDO (01/2016) Citologia e divisão celular
ESTUDO DIRIGIDO (01/2016) Citologia e divisão celularESTUDO DIRIGIDO (01/2016) Citologia e divisão celular
ESTUDO DIRIGIDO (01/2016) Citologia e divisão celular
 
Estudo dirigido i bcm prof_marconi
Estudo dirigido i bcm prof_marconiEstudo dirigido i bcm prof_marconi
Estudo dirigido i bcm prof_marconi
 
Exercícios sobre células
Exercícios sobre célulasExercícios sobre células
Exercícios sobre células
 
Plano de aula adriana fernandes vii (prova)
Plano de aula adriana fernandes vii (prova)Plano de aula adriana fernandes vii (prova)
Plano de aula adriana fernandes vii (prova)
 
Exercício de biologia
Exercício de biologiaExercício de biologia
Exercício de biologia
 
Organelas Citoplasmaticas.ppt
Organelas Citoplasmaticas.pptOrganelas Citoplasmaticas.ppt
Organelas Citoplasmaticas.ppt
 
Citologia: Organelas Citoplasmáticas.ppt
Citologia: Organelas Citoplasmáticas.pptCitologia: Organelas Citoplasmáticas.ppt
Citologia: Organelas Citoplasmáticas.ppt
 
Organização celular
Organização celularOrganização celular
Organização celular
 
Estudo dirigido de Biologia: citologia e divisão celular
Estudo dirigido de Biologia: citologia e divisão celularEstudo dirigido de Biologia: citologia e divisão celular
Estudo dirigido de Biologia: citologia e divisão celular
 
Plano v
Plano vPlano v
Plano v
 
Lista 1 ano_m_plasmatica
Lista 1 ano_m_plasmaticaLista 1 ano_m_plasmatica
Lista 1 ano_m_plasmatica
 
Plano iii
Plano iiiPlano iii
Plano iii
 
Plano vi
Plano viPlano vi
Plano vi
 
Exercícios de Célula
Exercícios de CélulaExercícios de Célula
Exercícios de Célula
 
8 ano
8 ano8 ano
8 ano
 
Apresentação BIOLOGIA - 3ªT LIC-TeSP_2324.pdf
Apresentação BIOLOGIA - 3ªT LIC-TeSP_2324.pdfApresentação BIOLOGIA - 3ªT LIC-TeSP_2324.pdf
Apresentação BIOLOGIA - 3ªT LIC-TeSP_2324.pdf
 
Citoplasma e organelas
Citoplasma e organelasCitoplasma e organelas
Citoplasma e organelas
 

Revisão

  • 1. REVISÃO CITOLOGIA 1. (UF-RN) A conseqüência mais importante da mitose é: a) determinar a diferenciação celular. b) a produção de gametas e esporos haplóides. c) a produção de células iguais à célula mãe. d) aumentar a variabilidade genética dos seres vivos. e) aumentar a taxa de mutação. 2. (UFRO-RO) Os ítens abaixo se referem à mitose e todos eles estão corretos, exceto: a) É um processo de divisão celular importante para o crescimento dos organismos. b) Ocorre nas células somáticas de animais e vegetais. c) Uma célula-mãe origina duas células-filhas com o mesmo número de cromossomos. d) A duplicação do DNA ocorre na fase da metáfase. e) Na fase da telófase, forma-se uma nova membrana nuclear em torno dos cromossomos e o citoplasma se divide 3. (PUC-SP) A maioria das reaçðes químicas da célula, incluindo a duplicação de DNA, a síntese de RNA e a produção de proteínas celulares, ocorre, principalmente, durante a: a) prófase. b) metáfase c) anáfase d) telófase. e) intérfase. 4. A respeito das estruturas apontadas no esquema acima, assinale a alternativa correta. a) 5 indica uma organela que participa diretamente do processo de divisão celular, embora esteja ausente em células vegetais. b) 1 indica uma organela pouco desenvolvida em células glandulares. c) Uma vez que a célula amadurece, o número de organelas 2 não se altera. d) 4 é capaz de impedir a passagem de qualquer toxina para o interior da célula. e) Em 3 ocorre a transcrição, uma das etapas da síntese de proteínas. 5. (UNICS/AL-2011) A figura dada representa uma célula ______________ e as estruturas indicadas pelas setas 1 e 2 são: __________ e ___________ . A alternativa que completa, correta e respectivamente, a frase é: a) animal ... mitocôndria ... núcleo b) vegetal ... cloroplasto ... vacúolo c) vegetal ... mitocôndria ... vacúolo d) animal ... cloroplasto ... núcleo e) vegetal ... cloroplasto ... núcleo 6. (CESGRANRIO- RJ) Dos constituintes celulares abaixo relacionados, qual e stá presente somente nos eucariontes e representa um dos critérios utilizados para distingui- los dos procariontes? A) DNA. B) Envoltório nuclear. C) Membrana celular. D) RNA. E) Ribossomo. 7. (UEM-PR) Os itens de I a VII, abaixo, referem- se a componentes da célula. I — Retículo endoplasmático II — Membrana plasmática III — Mitocôndrias IV — Parede celular V — Plastos VI — Centríolos VII — Aparelho de Golgi Considerandose A a célula vegetal e B a célula animal, indi que o que for correto. 01. I está presente em A e em B. 02. II está presente em A e ausente em B. 04. III está presente em A e ausente em B. 08. IV está presente em A e ausente em B. 16. V está presente em A e ausente em B. 32. VI está presente em A e ausente em B. 64. VII está presente em A e em B. 8. (MOJI-SP) A membrana plasmática, apesar de invisível ao microscópio óptico, está presente: a) em todas as células, seja ela procariótica ou eucariótica. b) apenas nas células animais. c) apenas nas células vegetais. d) apenas nas células dos eucariontes. e) apenas nas células dos procariontes. 9. (UFRS) Tanto em uma célula eucarionte quanto em uma procarionte podemos encontrar: a) membrana plasmática e retículo endoplasmático. b) ribossomos e aparelho de Golgi. c) mitocôndrias e nucléolo. d) mitocôndrias e centríolos.
  • 2. e) membrana plasmática e ribossomos. 10. (UFES-ES) O modelo abaixo representa a configuração molecular da membrana celular, segundo Singer e Nicholson. Acerca do modelo proposto, assinale a alternativa incorreta. a) O algarismo 1 assinala a extremidade polar (hidrófila) das moléculas lipídicas. b) O algarismo 2 assinala a extremidade apolar (hidrófoba) das moléculas lipídicas. c) O algarismo 3 assinala uma molécula de proteína. d) O algarismo 4 assinala uma molécula de proteína que faz parte do glicocálix. e) O algarismo 5 assinala uma proteína extrínseca à estrutura da membrana. 11. (Mackenzie-SP) Considere as seguintes funções atribuídas a uma organela celular: I- Armazenamento de substâncias. II- Secreção celular. III- Formação de lisossomas. Esta organela é: a) plasto. b) mitocôndria. c) complexo golgiense. d) retículo endoplasmático. e) vacúolo. 12. (PUC-RJ) As células animais diferem das células vegetais porque estas contêm várias estruturas e organelas características. Na lista abaixo, marque a organela ou estrutura comum às células animais e vegetais. a) vacúolo d) membrana celular b) parede celular e) centríolo c) cloroplastos 13. (U. LONDRINA) Os grânulos que, ao microscópio eletrônico, são vistos sobre o retículo endoplasmático são os: a) ribossomos. b) mitocôndrios. c) citocromos. d) corpúsculos de Golgi. e) vacúolos de pinocitose. 14. (Mogi-SP) A função do retículo endoplasmático rugoso é a síntese de grande parte das proteínas celulares, porque apresenta presos às suas membranas: a) mitocôndrias d) ribossomos b) centríolos e) pinossomos c) lisossomos 14..Cite as principais diferenças entre RNA e DNAquanto à estrutura de nucleotídeos? 15. Se uma fita de DNA tiver constituição 5’ATAAGCGTTAG 3’, como será a molécula complementar de DNA? 16. Relacione as colunas 1 e 2, relativas às organelas e a uma de suas funções na célula (1,0): 1 a) 1 com E e 2 com D b) 3 com A e 4 com C c) 2 com C e 1 com D d) 4 com C e 3 com B e) 4 com A e 2 com E 2 1. lisossomos 2. centríolos 3. ribossomos 4. mitocôndria A. síntese de proteínas B. síntese de ATP C. divisão celular D. digestão celular E. síntese de gorduras 17. Complete as frases de 11 a 18 preenchendo cada espaço com um dos termos a seguir (0,25 cada questão): (a) complexo de Golgi (e) mitocôndria (b) citoplasma (f) retículo endoplasmático liso (c) citosol (g) retículo endoplasmático rugoso (d) lisossomo (h) ribossomo 11. A região da célula situada entre a membrana nuclear e a membrana plasmática é chamada ( ). 12. ( ) é um dos nomes que se dá ao líquido que preenche o espaço entre o núcleo celular e a M.P. 13. ( ) é o conjunto de bolsas membranosas com ribossomos aderidos à superfície, presente no interior das células eucarióticas. 14. ( ) é uma organela citoplasmática delimitada por 2 membranas – a externa, lisa, e a interna, com muitas pregas – no interior da qual ocorre a respiração celular. 15. ( ) é uma pequena bolsa membranosa que contém enzimas capazes de digerir macromoléculas. 16. Uma estrutura citoplasmática constituída por bolsas membranosas com função de empacotar, endereçar e exportar substâncias produzidas pela célula é a (o) ( ). 17. ( ) é uma pequena estrutura granular constituída por proteínas e RNA, cuja função é sintetizar proteínas. 18. O conjunto formado por tubos membranosos interligados, sem ribossomos aderidos, presente no interior das células eucarióticas, é chamado ( ). 18. (U.E. Ponta Grossa-PR) Uma das funções do complexo de Golgi é: a) sintetizar esteróis d) eliminar secreções b) duplicar o DNA e) absorver proteínas c) sintetizar glicoproteínas 19. (PUC-SP) O retículo endoplasmático possibilita a: a) respiração celular b) troca de material entre célula e o meio c) fermentação das bactérias d) reprodução dos procariontes e) síntese de proteínas 20 .(UECE) As enzimas contidas nos lisossomos são sintetizadas pela célula a partir do(a): a) complexo de Golgi d) mitocôndria b) R.E.L. e) centríolo c) R.E.R. 21. Escreva a sequência de bases da fita complementar do DNA dupla fita que apresenta uma fita com a sequência: (5') ATGCCGTATGCATTGCATTC (3')