SlideShare uma empresa Scribd logo
1 de 1
You want to express the cDNA below in some eukaryotic cells. Which of the plasmids below
would you use? Why? Explain also your cloning strategies. >BIT473 CDNA in pUCi9
GGAATTCGAGCTCGGTACCCTTGTAGTGATGGTAGCTAATGCGTCCCGGGCACCACC
AGTCGGCGCCAGAGCTGACT
TAAGAAGCANGAGCTTCANANCTCTACTAGGTCCTGTGTACCTCCCGGTGGCGTGCT
TCCAGGACMGACGGCAITG
GCCACGTCCGATAATtTACTAACACCTAAGAGGTATTCCAATACCCATICCGCCAACC
TGATCTACTTCCACCCCAA
CCCATGGTTTAAGCGGACCTCTACTTTAAGCGCTCATTTGTATGCGCCGCATGAGGA
CGAATICCCCCCTGTGTITA
AGGCTTATAGGGATGCCAGGGTCGACCAAGCTAAAAAATCTCTGGGGAACTCGAAT
TTIGTCGCGTAACGTTGTGG
AGTGCATCAACGATAAGAAACAACCCCCACTCTCCGTGGAAGGCCTACCTTGCATC
ATCTFGCCATCTGCCCCGTAC
GATTATGTCTTGTGGAGGCCGCCTGGCGAGCGGGATTGCTITTACCAAATGTTAAGTT
ATGGCGTTCGCGATACGA
CGAAACAGTCAAATTGTGGCCCTAACTGCTGTTCCGGTGAGGCCAARCGACCTCTAA
CTPATCTAGCCCGACTGAC
GACCAGATACGCCCTCTAGACACGTTITGTAACGGACCARCGACGACMGIGITAMCC
GCGGACAGCGCTTGCTAC
AGTTTTTGTTTACTTGCAACCTAAAGAATCGTAACTTAGTAGCTAGGSTCGGGGATC
CTCTAGAGTCGACCTGCAGGCA TGCAAGCTTGG

Mais conteúdo relacionado

Semelhante a You want to express the cDNA below in some eukaryotic cells- Which of.docx

Recombinant dna technology
Recombinant dna technologyRecombinant dna technology
Recombinant dna technologyDr. Armaan Singh
 
Site directed mutagenesis of β2-microglobulin PowerPoint Presentation
Site directed mutagenesis of β2-microglobulin PowerPoint PresentationSite directed mutagenesis of β2-microglobulin PowerPoint Presentation
Site directed mutagenesis of β2-microglobulin PowerPoint PresentationTyler Liang
 
introduction to metagenomics
introduction to metagenomicsintroduction to metagenomics
introduction to metagenomicsThomas Haverkamp
 
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...Vall d'Hebron Institute of Research (VHIR)
 
Amplicon sequencing slides - Trina McMahon - MEWE 2013
Amplicon sequencing slides - Trina McMahon - MEWE 2013Amplicon sequencing slides - Trina McMahon - MEWE 2013
Amplicon sequencing slides - Trina McMahon - MEWE 2013mcmahonUW
 
Mighty flower transcription and translation
Mighty flower transcription and translationMighty flower transcription and translation
Mighty flower transcription and translationpunxsyscience
 
Advenced molecular techniques in molecular medical genetics laboratory
Advenced molecular techniques in molecular medical genetics laboratoryAdvenced molecular techniques in molecular medical genetics laboratory
Advenced molecular techniques in molecular medical genetics laboratoryPeyman Ghoraishizadeh
 

Semelhante a You want to express the cDNA below in some eukaryotic cells- Which of.docx (15)

Recombinant dna technology
Recombinant dna technologyRecombinant dna technology
Recombinant dna technology
 
Site directed mutagenesis of β2-microglobulin PowerPoint Presentation
Site directed mutagenesis of β2-microglobulin PowerPoint PresentationSite directed mutagenesis of β2-microglobulin PowerPoint Presentation
Site directed mutagenesis of β2-microglobulin PowerPoint Presentation
 
cloning
cloningcloning
cloning
 
cloning
cloningcloning
cloning
 
Cloning
CloningCloning
Cloning
 
Cloning
CloningCloning
Cloning
 
C:\fakepath\cloning
C:\fakepath\cloningC:\fakepath\cloning
C:\fakepath\cloning
 
introduction to metagenomics
introduction to metagenomicsintroduction to metagenomics
introduction to metagenomics
 
Rna protein
Rna proteinRna protein
Rna protein
 
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
Ivan Erill: "Beyond the Regulon: reconstructing the SOS response of the human...
 
Molecular markers
Molecular markersMolecular markers
Molecular markers
 
Amplicon sequencing slides - Trina McMahon - MEWE 2013
Amplicon sequencing slides - Trina McMahon - MEWE 2013Amplicon sequencing slides - Trina McMahon - MEWE 2013
Amplicon sequencing slides - Trina McMahon - MEWE 2013
 
Mighty flower transcription and translation
Mighty flower transcription and translationMighty flower transcription and translation
Mighty flower transcription and translation
 
Advenced molecular techniques in molecular medical genetics laboratory
Advenced molecular techniques in molecular medical genetics laboratoryAdvenced molecular techniques in molecular medical genetics laboratory
Advenced molecular techniques in molecular medical genetics laboratory
 
Rna.mvanleer
Rna.mvanleerRna.mvanleer
Rna.mvanleer
 

Mais de karlynwih

Zone Diameter Interpretation Examine the zone diameter data in the tab.docx
Zone Diameter Interpretation Examine the zone diameter data in the tab.docxZone Diameter Interpretation Examine the zone diameter data in the tab.docx
Zone Diameter Interpretation Examine the zone diameter data in the tab.docxkarlynwih
 
Your unknown bacteria maybe one of the following 13 bacteria- Proteus.docx
Your unknown bacteria maybe one of the following 13 bacteria- Proteus.docxYour unknown bacteria maybe one of the following 13 bacteria- Proteus.docx
Your unknown bacteria maybe one of the following 13 bacteria- Proteus.docxkarlynwih
 
Your friend got a notification on their iPhone letting them know they.docx
Your friend got a notification on their iPhone letting them know they.docxYour friend got a notification on their iPhone letting them know they.docx
Your friend got a notification on their iPhone letting them know they.docxkarlynwih
 
Your reflection must be at least 400 words Examine habitat for humanit.docx
Your reflection must be at least 400 words Examine habitat for humanit.docxYour reflection must be at least 400 words Examine habitat for humanit.docx
Your reflection must be at least 400 words Examine habitat for humanit.docxkarlynwih
 
You will learn about the Chain of Infection and apply your learning to.docx
You will learn about the Chain of Infection and apply your learning to.docxYou will learn about the Chain of Infection and apply your learning to.docx
You will learn about the Chain of Infection and apply your learning to.docxkarlynwih
 
Write definitions for the following terms- hydrograph- hyetograph- abs.docx
Write definitions for the following terms- hydrograph- hyetograph- abs.docxWrite definitions for the following terms- hydrograph- hyetograph- abs.docx
Write definitions for the following terms- hydrograph- hyetograph- abs.docxkarlynwih
 
Write code in C++ Write a program to perform a topological sort on a g.docx
Write code in C++ Write a program to perform a topological sort on a g.docxWrite code in C++ Write a program to perform a topological sort on a g.docx
Write code in C++ Write a program to perform a topological sort on a g.docxkarlynwih
 
Write C++ program that when given a value N(read from cin)- produces a.docx
Write C++ program that when given a value N(read from cin)- produces a.docxWrite C++ program that when given a value N(read from cin)- produces a.docx
Write C++ program that when given a value N(read from cin)- produces a.docxkarlynwih
 
Write an SML function groupdupes that takes a list of integers as its.docx
Write an SML function groupdupes that takes a list of integers as its.docxWrite an SML function groupdupes that takes a list of integers as its.docx
Write an SML function groupdupes that takes a list of integers as its.docxkarlynwih
 
You and another tech are discussing the relative merits of SCSI interf.docx
You and another tech are discussing the relative merits of SCSI interf.docxYou and another tech are discussing the relative merits of SCSI interf.docx
You and another tech are discussing the relative merits of SCSI interf.docxkarlynwih
 
Write an application class (ArrayListApplication) that contains a main.docx
Write an application class (ArrayListApplication) that contains a main.docxWrite an application class (ArrayListApplication) that contains a main.docx
Write an application class (ArrayListApplication) that contains a main.docxkarlynwih
 
Write an algorithm for a program that shows the use of all six math fu.docx
Write an algorithm for a program that shows the use of all six math fu.docxWrite an algorithm for a program that shows the use of all six math fu.docx
Write an algorithm for a program that shows the use of all six math fu.docxkarlynwih
 
write a topic about RFID in SCM and what you have learned about adopti.docx
write a topic about RFID in SCM and what you have learned about adopti.docxwrite a topic about RFID in SCM and what you have learned about adopti.docx
write a topic about RFID in SCM and what you have learned about adopti.docxkarlynwih
 
Write up a simple c-program to find the median of any array-Solution#i.docx
Write up a simple c-program to find the median of any array-Solution#i.docxWrite up a simple c-program to find the median of any array-Solution#i.docx
Write up a simple c-program to find the median of any array-Solution#i.docxkarlynwih
 
Write an assembly language program in the Pep-8 simulator that corresp.docx
Write an assembly language program in the Pep-8 simulator that corresp.docxWrite an assembly language program in the Pep-8 simulator that corresp.docx
Write an assembly language program in the Pep-8 simulator that corresp.docxkarlynwih
 
Write the for structure in JAVA coding to read and display all element.docx
Write the for structure in JAVA coding to read and display all element.docxWrite the for structure in JAVA coding to read and display all element.docx
Write the for structure in JAVA coding to read and display all element.docxkarlynwih
 
Write the formal description of the following state machine (M) What.docx
Write the formal description of the following state machine (M)  What.docxWrite the formal description of the following state machine (M)  What.docx
Write the formal description of the following state machine (M) What.docxkarlynwih
 
Write the C++ code for a function getInput which will read in an unkno.docx
Write the C++ code for a function getInput which will read in an unkno.docxWrite the C++ code for a function getInput which will read in an unkno.docx
Write the C++ code for a function getInput which will read in an unkno.docxkarlynwih
 
Write the balanced reaction where thiosulfate and protons are the only.docx
Write the balanced reaction where thiosulfate and protons are the only.docxWrite the balanced reaction where thiosulfate and protons are the only.docx
Write the balanced reaction where thiosulfate and protons are the only.docxkarlynwih
 
Write functions odd and even- which takes a list of symbols L- and pro.docx
Write functions odd and even- which takes a list of symbols L- and pro.docxWrite functions odd and even- which takes a list of symbols L- and pro.docx
Write functions odd and even- which takes a list of symbols L- and pro.docxkarlynwih
 

Mais de karlynwih (20)

Zone Diameter Interpretation Examine the zone diameter data in the tab.docx
Zone Diameter Interpretation Examine the zone diameter data in the tab.docxZone Diameter Interpretation Examine the zone diameter data in the tab.docx
Zone Diameter Interpretation Examine the zone diameter data in the tab.docx
 
Your unknown bacteria maybe one of the following 13 bacteria- Proteus.docx
Your unknown bacteria maybe one of the following 13 bacteria- Proteus.docxYour unknown bacteria maybe one of the following 13 bacteria- Proteus.docx
Your unknown bacteria maybe one of the following 13 bacteria- Proteus.docx
 
Your friend got a notification on their iPhone letting them know they.docx
Your friend got a notification on their iPhone letting them know they.docxYour friend got a notification on their iPhone letting them know they.docx
Your friend got a notification on their iPhone letting them know they.docx
 
Your reflection must be at least 400 words Examine habitat for humanit.docx
Your reflection must be at least 400 words Examine habitat for humanit.docxYour reflection must be at least 400 words Examine habitat for humanit.docx
Your reflection must be at least 400 words Examine habitat for humanit.docx
 
You will learn about the Chain of Infection and apply your learning to.docx
You will learn about the Chain of Infection and apply your learning to.docxYou will learn about the Chain of Infection and apply your learning to.docx
You will learn about the Chain of Infection and apply your learning to.docx
 
Write definitions for the following terms- hydrograph- hyetograph- abs.docx
Write definitions for the following terms- hydrograph- hyetograph- abs.docxWrite definitions for the following terms- hydrograph- hyetograph- abs.docx
Write definitions for the following terms- hydrograph- hyetograph- abs.docx
 
Write code in C++ Write a program to perform a topological sort on a g.docx
Write code in C++ Write a program to perform a topological sort on a g.docxWrite code in C++ Write a program to perform a topological sort on a g.docx
Write code in C++ Write a program to perform a topological sort on a g.docx
 
Write C++ program that when given a value N(read from cin)- produces a.docx
Write C++ program that when given a value N(read from cin)- produces a.docxWrite C++ program that when given a value N(read from cin)- produces a.docx
Write C++ program that when given a value N(read from cin)- produces a.docx
 
Write an SML function groupdupes that takes a list of integers as its.docx
Write an SML function groupdupes that takes a list of integers as its.docxWrite an SML function groupdupes that takes a list of integers as its.docx
Write an SML function groupdupes that takes a list of integers as its.docx
 
You and another tech are discussing the relative merits of SCSI interf.docx
You and another tech are discussing the relative merits of SCSI interf.docxYou and another tech are discussing the relative merits of SCSI interf.docx
You and another tech are discussing the relative merits of SCSI interf.docx
 
Write an application class (ArrayListApplication) that contains a main.docx
Write an application class (ArrayListApplication) that contains a main.docxWrite an application class (ArrayListApplication) that contains a main.docx
Write an application class (ArrayListApplication) that contains a main.docx
 
Write an algorithm for a program that shows the use of all six math fu.docx
Write an algorithm for a program that shows the use of all six math fu.docxWrite an algorithm for a program that shows the use of all six math fu.docx
Write an algorithm for a program that shows the use of all six math fu.docx
 
write a topic about RFID in SCM and what you have learned about adopti.docx
write a topic about RFID in SCM and what you have learned about adopti.docxwrite a topic about RFID in SCM and what you have learned about adopti.docx
write a topic about RFID in SCM and what you have learned about adopti.docx
 
Write up a simple c-program to find the median of any array-Solution#i.docx
Write up a simple c-program to find the median of any array-Solution#i.docxWrite up a simple c-program to find the median of any array-Solution#i.docx
Write up a simple c-program to find the median of any array-Solution#i.docx
 
Write an assembly language program in the Pep-8 simulator that corresp.docx
Write an assembly language program in the Pep-8 simulator that corresp.docxWrite an assembly language program in the Pep-8 simulator that corresp.docx
Write an assembly language program in the Pep-8 simulator that corresp.docx
 
Write the for structure in JAVA coding to read and display all element.docx
Write the for structure in JAVA coding to read and display all element.docxWrite the for structure in JAVA coding to read and display all element.docx
Write the for structure in JAVA coding to read and display all element.docx
 
Write the formal description of the following state machine (M) What.docx
Write the formal description of the following state machine (M)  What.docxWrite the formal description of the following state machine (M)  What.docx
Write the formal description of the following state machine (M) What.docx
 
Write the C++ code for a function getInput which will read in an unkno.docx
Write the C++ code for a function getInput which will read in an unkno.docxWrite the C++ code for a function getInput which will read in an unkno.docx
Write the C++ code for a function getInput which will read in an unkno.docx
 
Write the balanced reaction where thiosulfate and protons are the only.docx
Write the balanced reaction where thiosulfate and protons are the only.docxWrite the balanced reaction where thiosulfate and protons are the only.docx
Write the balanced reaction where thiosulfate and protons are the only.docx
 
Write functions odd and even- which takes a list of symbols L- and pro.docx
Write functions odd and even- which takes a list of symbols L- and pro.docxWrite functions odd and even- which takes a list of symbols L- and pro.docx
Write functions odd and even- which takes a list of symbols L- and pro.docx
 

Último

Software Engineering Methodologies (overview)
Software Engineering Methodologies (overview)Software Engineering Methodologies (overview)
Software Engineering Methodologies (overview)eniolaolutunde
 
Interactive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communicationInteractive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communicationnomboosow
 
Student login on Anyboli platform.helpin
Student login on Anyboli platform.helpinStudent login on Anyboli platform.helpin
Student login on Anyboli platform.helpinRaunakKeshri1
 
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...Sapna Thakur
 
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...PsychoTech Services
 
Measures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeMeasures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeThiyagu K
 
Measures of Dispersion and Variability: Range, QD, AD and SD
Measures of Dispersion and Variability: Range, QD, AD and SDMeasures of Dispersion and Variability: Range, QD, AD and SD
Measures of Dispersion and Variability: Range, QD, AD and SDThiyagu K
 
Sanyam Choudhary Chemistry practical.pdf
Sanyam Choudhary Chemistry practical.pdfSanyam Choudhary Chemistry practical.pdf
Sanyam Choudhary Chemistry practical.pdfsanyamsingh5019
 
Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3JemimahLaneBuaron
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsTechSoup
 
Call Girls in Dwarka Mor Delhi Contact Us 9654467111
Call Girls in Dwarka Mor Delhi Contact Us 9654467111Call Girls in Dwarka Mor Delhi Contact Us 9654467111
Call Girls in Dwarka Mor Delhi Contact Us 9654467111Sapana Sha
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfAdmir Softic
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...EduSkills OECD
 
Class 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdfClass 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdfAyushMahapatra5
 
Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Disha Kariya
 
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxSOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxiammrhaywood
 
Web & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdfWeb & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdfJayanti Pande
 

Último (20)

INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptxINDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
 
Software Engineering Methodologies (overview)
Software Engineering Methodologies (overview)Software Engineering Methodologies (overview)
Software Engineering Methodologies (overview)
 
Interactive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communicationInteractive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communication
 
Student login on Anyboli platform.helpin
Student login on Anyboli platform.helpinStudent login on Anyboli platform.helpin
Student login on Anyboli platform.helpin
 
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
 
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
 
Measures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeMeasures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and Mode
 
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
 
Measures of Dispersion and Variability: Range, QD, AD and SD
Measures of Dispersion and Variability: Range, QD, AD and SDMeasures of Dispersion and Variability: Range, QD, AD and SD
Measures of Dispersion and Variability: Range, QD, AD and SD
 
Sanyam Choudhary Chemistry practical.pdf
Sanyam Choudhary Chemistry practical.pdfSanyam Choudhary Chemistry practical.pdf
Sanyam Choudhary Chemistry practical.pdf
 
Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3Q4-W6-Restating Informational Text Grade 3
Q4-W6-Restating Informational Text Grade 3
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The Basics
 
Call Girls in Dwarka Mor Delhi Contact Us 9654467111
Call Girls in Dwarka Mor Delhi Contact Us 9654467111Call Girls in Dwarka Mor Delhi Contact Us 9654467111
Call Girls in Dwarka Mor Delhi Contact Us 9654467111
 
Código Creativo y Arte de Software | Unidad 1
Código Creativo y Arte de Software | Unidad 1Código Creativo y Arte de Software | Unidad 1
Código Creativo y Arte de Software | Unidad 1
 
Key note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdfKey note speaker Neum_Admir Softic_ENG.pdf
Key note speaker Neum_Admir Softic_ENG.pdf
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
 
Class 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdfClass 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdf
 
Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..
 
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxSOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
 
Web & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdfWeb & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdf
 

You want to express the cDNA below in some eukaryotic cells- Which of.docx

  • 1. You want to express the cDNA below in some eukaryotic cells. Which of the plasmids below would you use? Why? Explain also your cloning strategies. >BIT473 CDNA in pUCi9 GGAATTCGAGCTCGGTACCCTTGTAGTGATGGTAGCTAATGCGTCCCGGGCACCACC AGTCGGCGCCAGAGCTGACT TAAGAAGCANGAGCTTCANANCTCTACTAGGTCCTGTGTACCTCCCGGTGGCGTGCT TCCAGGACMGACGGCAITG GCCACGTCCGATAATtTACTAACACCTAAGAGGTATTCCAATACCCATICCGCCAACC TGATCTACTTCCACCCCAA CCCATGGTTTAAGCGGACCTCTACTTTAAGCGCTCATTTGTATGCGCCGCATGAGGA CGAATICCCCCCTGTGTITA AGGCTTATAGGGATGCCAGGGTCGACCAAGCTAAAAAATCTCTGGGGAACTCGAAT TTIGTCGCGTAACGTTGTGG AGTGCATCAACGATAAGAAACAACCCCCACTCTCCGTGGAAGGCCTACCTTGCATC ATCTFGCCATCTGCCCCGTAC GATTATGTCTTGTGGAGGCCGCCTGGCGAGCGGGATTGCTITTACCAAATGTTAAGTT ATGGCGTTCGCGATACGA CGAAACAGTCAAATTGTGGCCCTAACTGCTGTTCCGGTGAGGCCAARCGACCTCTAA CTPATCTAGCCCGACTGAC GACCAGATACGCCCTCTAGACACGTTITGTAACGGACCARCGACGACMGIGITAMCC GCGGACAGCGCTTGCTAC AGTTTTTGTTTACTTGCAACCTAAAGAATCGTAACTTAGTAGCTAGGSTCGGGGATC CTCTAGAGTCGACCTGCAGGCA TGCAAGCTTGG