2013 03 12_epigenetic_profiling
•Transferir como PPT, PDF•
1 gostou•1,391 visualizações
Epigenetic Profiling
Recomendados
Recomendados
Mais conteúdo relacionado
Mais procurados
Destaque
Destaque (20)
Semelhante a 2013 03 12_epigenetic_profiling
Semelhante a 2013 03 12_epigenetic_profiling (11)
Mais de Prof. Wim Van Criekinge
Mais de Prof. Wim Van Criekinge (20)
Último
Último (20)
2013 03 12_epigenetic_profiling
- 1. Slides available www.bioinformatics.be 12 Maart 2013
- 2. Lab for Bioinformatics and computational genomics 10 “genome hackers” mostly engineers (statistics) 42 scientists technicians, geneticists, clinicians >100 people hardware engineers, mathematicians, molecular biologists
- 3. Can bioinformatics bridge the gap ?
- 4. The genome is just the start …
- 5. 250 different cell types Epigenetic (meta)information = stem cells
- 6. Cellular programming Epigenetic (meta)information = stem cells
- 7. Defining Epigenetics Genome DNA Reversible changes in gene expression/function Without changes in DNA Chromatin sequence Epigenome Can be inherited from precursor cells Gene Expression Allows to integrate intrinsic with environmental signals Phenotype (including diet)
- 8. DNA Methylation Differentiates Totipotent Embryonic Stem Cells from Unipotent Adult Stem Cells Alex Meissner, Henry Stewart Talks
- 9. Reprogramming the DNA methylome Paula Vertino, Henry Stewart Talks
- 15. Epigenetic Changes are Important in Causing Cancer GENETIC EPIGENETIC Example: Example: Replication errors Chromatin modification errors X X Altered Altered DNA sequence chromatin structure Oncogenesis Altered Altered levels of DNA/mRNA/proteins mRNA/proteins Tumor
- 16. Example of Methylation vs Mutation: Colon & Breast Cancer Dx CDx Methylated Mutated Source: Schuebel et al 2007 76-100 51-75 21-50 1-20
- 17. MGMT Biology O6 Methyl-Guanine Methyl Transferase Essential DNA Repair Enzyme Removes alkyl groups from damaged guanine bases Healthy individual: - MGMT is an essential DNA repair enzyme Loss of MGMT activity makes individuals susceptible to DNA damage and prone to tumor development Glioblastoma patient on alkylator chemotherapy: - Patients with MGMT promoter methylation show have longer PFS and OS with the use of alkylating agents as chemotherapy
- 18. MGMT Promoter Methylation Predicts Benefit form DNA-Alkylating Chemotherapy Post-hoc subgroup analysis of Temozolomide Clinical trial with primary glioblastoma patients show benefit for patients with MGMT promoter methylation Median Overall Survival 21.7 months plus temozolomide 12.7 months radiotherapy radiotherapy Adapted from Hegi et al. NEJM 2005 352(10):1036-8. Non-Methylated Methylated Study with 207 patients MGMT Gene MGMT Gene
- 19. Profiling the Epigenome # markers Discovery Verification Validation # samples
- 20. Genome-wide methylation by methylation sensitive restriction enzymes
- 22. Profiling the Epigenome By next gen sequencing # markers Discovery Verification Validation # samples
- 23. MBD_Seq Condensed Chromatin DNA Sheared Immobilized Methyl Binding Domain DNA Sheared
- 24. MBD_Seq Immobilized Methyl binding domain MgCl2 Next Gen Sequencing GA Illumina: 100 million reads
- 25. Kit Comparison 0.25 ● ● 0.20 ● Fraction of reads 0.15 ● 0.10 ● 0.05 ● ● ● ● ● ● 0.00 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0 10 20 30 40 50 Number of CG's 25
- 26. MBD_Seq MGMT = dual core
- 27. Profiling the epigenome …. by next generation sequencing # markers 1-2 million MBD_Seq methylation cores Discovery # samples
- 28. Bock et al, Nature, 2012 Bock et al. Nature 2012 28
- 29. 29
- 30. Data integration Correlation tracks expression expression Corr =-1 Corr = 1 methylation methylation 30
- 31. Correlation track in GBM @ MGMT +1 -1 31
- 32. Next_next miRNA, (l)ncRNA, CIS/TRANS splicing, SV, fusion loci , bidirectional promoters ? RNA_seq: sequence RNA molecules Next Gen Platform Total RNA_seq: all RNA molecules (normalisation procedure) Directional Total RNA_seq: before amplification use different 5’ and 3’ adaptors Integrated Directional Total RNA_seq: Combine with other datasets eg. enrichment sequencing data, visualise and query in genome browser 32
- 34. Profiling the Epigenome …. by next generation sequencing # markers MBD_Seq Discovery 454_BT_Seq Verification Validation # samples
- 35. Where is the mC ? GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
- 37. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25% 50% 25% GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
- 38. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25% 50% 25% GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT Dense methylated needed for transcriptional silencing Are there alleles with all three positions methylated ?
- 39. Deep Sequencing unmethylated alleles methylated alleles less methylation more methylation GCATCGTGACTTACGACTGATCGATGGATGCTAGCAT
- 41. Conclusion Combination of different sequencing techniques is emerging as best practice Bioinformatics is challenging Methods for normalisation under construction Reference databases are generated Data visualization and integration is key 41
- 42. Slides available www.bioinformatics.be 4th December 2012 Johns Hopkins Bloomberg School of Public Health
- 43. biobix wvcrieki biobix.be bioinformatics.be 43
Notas do Editor
- Here, we define epigenetics and depict the relationship between the genome and the epigenome The genome is hereditary information encoded in the DNA and the epigenome is the way cells express the encoded information 1 The epigenome is a ‘bridge’ between genotype and phenotype (epigenetics governs genotype and phenotype) Epigenetic information is included in the genome of a cell but is not encoded by the DNA 1,2 Epigenetic information may be inherited from precursor cells 1 Epigenetic changes affect chromosome structure to alter gene expression 1,2 References Goldberg AD et al. Cell 2007;128:635–8. Bernstein BE et al. Cell 2007;128:669–81.
- There is growing evidence that epigenetic modifications are also crucial to the onset and progression of cancer 1 On the right of the slide, we see that changes in gene expression due to chromatin modifications (e.g. histone acetylation, DNA methylation) lead to altered levels of mRNA and proteins Altered levels of proteins involved in cell growth and death can lead to deregulated cell proliferation and survival, resulting in cancer 2 Examples: Silencing of p15 tumor suppressor gene expression 3 Aberrant expression of IGF2 4 Silencing of ER- α gene expression 3 References Bolden JE et al. Nat Rev Drug Discov 2006;5:769–84. Miranda E et al. Br J Cancer 2006;95:1101–7. Esteller M. N Engl J Med 2008;358:1148 – 59. Feinberg AP. Nature 2007;447:433–40.