SlideShare uma empresa Scribd logo
1 de 12
Caracterização molecular de
amostras de Echinococcus
granulosus em Portugal
Beato, Sílvia, Parreira, Ricardo, & Grácio, Maria Amélia
(IHMT, Lisboa)
III JORNADAS CIENTÍFICAS DO IHMT
Nota Introdutória
 Quisto Hidático Patologia Molecular
Echinococcus granulosus
o Helminta (vermes achatados)
o Família Taenidae
o Disseminação Mundial
o Portugal considerado hiperendémico
o Variabilidade genética (genótipos - G1 a G10)
http://www.bayervet.com.pt
Genótipo Estirpe
G1 Ovelha comum
G2 Ovelha da Tasmânia
G3 Búfalos
G4 Cavalo
G5 Bovina
G6 Camelo
G7 Porco
G8 Cervídeos
G9 ? Humanos
G10 Cervídeos
? Leão
Nota Introdutória
Genótipo Estirpe
G1 Ovelha comum
G2 Ovelha da Tasmânia
G3 Búfalos
G4 Cavalo
G5 Bovina
G6 Camelo
G7 Porco
G8 Cervídeos
G9 ? Humanos
G10 Cervídeos
? Leão www.edelkatzen.de/m-wurm.htm
(Thompson, R, 2008, Exp Parasit)
Nota Introdutória
1. Epidemiologia e caracterização das estirpes genéticas de
E. granulosus existentes em Portugal;
2. Análise filogenética de fragmentos dos genes
mitocondriais e nucleares:
- Genes Mitocondriais (COI, 12S,16S,ATP6 e NDI);
- Genes Nucleares (em curso)
TRABALHO REALIZADO
METODOLOGIAS
 Material Biológico:
204 amostras biológicas (ovino, caprino,
bovino e humano) – recolha 2009 e 2011
78 amostras férteis (pulmão, fígado e
pâncreas)
estudo molecular
 Extracção do DNA:
 Desenho de “primers”:
ATP6F: 5’ – AAACTGTRGGGTTCATGTCYC – 3’
ATP6R: 5’ – CACAACATAAAHGGAAAYAAACCAAAC – 3’
12SrF: 5’ – GGTTTATTTGCCTTTTGCATCATGC – 3’
12SrR: 5’ – CCTAAGTCAACATCGAGGTGGCAAAC – 3’
16SrF: 5’ – AGCCAGGTCGGTTCTTATCTATTG – 3’
16SrR: 5’ – CGAGGGTGACGGGCGGTGTGTAC – 3’
CytBF: 5’ – AGATTGTGGTTYTGTTGARTRCTA – 3’
CytBR: 5’ – ATACACCGAAGAATAGCATAAAAYGC – 3’
(Base nos genomas mitocondriais depositados no NCBI)
Amplificação do DNA:
- Citocromo c oxidase sub-unidade 1
- Primers: JB 3 (F): 5’ – TTTTTTGGGCATCCTGAGGTTTAT – 3’
JB 4.5 (R): 5’ – TAAAGAAAGAACATAATGAAAATG – 3’
Sequenciação
(Bowles & McManus , 1992, Molec. Biochem. Parasitol, 54, 165-174)
2. Análise Filogenética
• Amplificação de fragmentos do gene COI
(Bowles and McManus, 1992).
• Amplificação de fragmentos dos genes 12S, 16S
e ATP6
2. Análise Filogenética
(Thompson, R.C., 2008, Exp Parasitol.)
2. Análise Filogenética
Fragmentos dos genes mitocondriais (COI, 12S, 16S e ATP6)
concatenados (~2700 pb)
AGRADECIMENTOS

Mais conteúdo relacionado

Destaque

How Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental HealthHow Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental Health
ThinkNow
 
Social Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsSocial Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie Insights
Kurio // The Social Media Age(ncy)
 

Destaque (20)

2024 State of Marketing Report – by Hubspot
2024 State of Marketing Report – by Hubspot2024 State of Marketing Report – by Hubspot
2024 State of Marketing Report – by Hubspot
 
Everything You Need To Know About ChatGPT
Everything You Need To Know About ChatGPTEverything You Need To Know About ChatGPT
Everything You Need To Know About ChatGPT
 
Product Design Trends in 2024 | Teenage Engineerings
Product Design Trends in 2024 | Teenage EngineeringsProduct Design Trends in 2024 | Teenage Engineerings
Product Design Trends in 2024 | Teenage Engineerings
 
How Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental HealthHow Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental Health
 
AI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdfAI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdf
 
Skeleton Culture Code
Skeleton Culture CodeSkeleton Culture Code
Skeleton Culture Code
 
PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024
 
Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)
 
How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024
 
Social Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsSocial Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie Insights
 
Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024
 
5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary
 
ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd
 
Getting into the tech field. what next
Getting into the tech field. what next Getting into the tech field. what next
Getting into the tech field. what next
 
Google's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search IntentGoogle's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search Intent
 
How to have difficult conversations
How to have difficult conversations How to have difficult conversations
How to have difficult conversations
 
Introduction to Data Science
Introduction to Data ScienceIntroduction to Data Science
Introduction to Data Science
 
Time Management & Productivity - Best Practices
Time Management & Productivity -  Best PracticesTime Management & Productivity -  Best Practices
Time Management & Productivity - Best Practices
 
The six step guide to practical project management
The six step guide to practical project managementThe six step guide to practical project management
The six step guide to practical project management
 
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
 

IIIjornadasIHMT_SB.pptx

  • 1. Caracterização molecular de amostras de Echinococcus granulosus em Portugal Beato, Sílvia, Parreira, Ricardo, & Grácio, Maria Amélia (IHMT, Lisboa) III JORNADAS CIENTÍFICAS DO IHMT
  • 2. Nota Introdutória  Quisto Hidático Patologia Molecular Echinococcus granulosus o Helminta (vermes achatados) o Família Taenidae o Disseminação Mundial o Portugal considerado hiperendémico o Variabilidade genética (genótipos - G1 a G10) http://www.bayervet.com.pt
  • 3. Genótipo Estirpe G1 Ovelha comum G2 Ovelha da Tasmânia G3 Búfalos G4 Cavalo G5 Bovina G6 Camelo G7 Porco G8 Cervídeos G9 ? Humanos G10 Cervídeos ? Leão Nota Introdutória
  • 4. Genótipo Estirpe G1 Ovelha comum G2 Ovelha da Tasmânia G3 Búfalos G4 Cavalo G5 Bovina G6 Camelo G7 Porco G8 Cervídeos G9 ? Humanos G10 Cervídeos ? Leão www.edelkatzen.de/m-wurm.htm (Thompson, R, 2008, Exp Parasit) Nota Introdutória
  • 5. 1. Epidemiologia e caracterização das estirpes genéticas de E. granulosus existentes em Portugal; 2. Análise filogenética de fragmentos dos genes mitocondriais e nucleares: - Genes Mitocondriais (COI, 12S,16S,ATP6 e NDI); - Genes Nucleares (em curso) TRABALHO REALIZADO
  • 6. METODOLOGIAS  Material Biológico: 204 amostras biológicas (ovino, caprino, bovino e humano) – recolha 2009 e 2011 78 amostras férteis (pulmão, fígado e pâncreas) estudo molecular  Extracção do DNA:
  • 7.  Desenho de “primers”: ATP6F: 5’ – AAACTGTRGGGTTCATGTCYC – 3’ ATP6R: 5’ – CACAACATAAAHGGAAAYAAACCAAAC – 3’ 12SrF: 5’ – GGTTTATTTGCCTTTTGCATCATGC – 3’ 12SrR: 5’ – CCTAAGTCAACATCGAGGTGGCAAAC – 3’ 16SrF: 5’ – AGCCAGGTCGGTTCTTATCTATTG – 3’ 16SrR: 5’ – CGAGGGTGACGGGCGGTGTGTAC – 3’ CytBF: 5’ – AGATTGTGGTTYTGTTGARTRCTA – 3’ CytBR: 5’ – ATACACCGAAGAATAGCATAAAAYGC – 3’ (Base nos genomas mitocondriais depositados no NCBI) Amplificação do DNA: - Citocromo c oxidase sub-unidade 1 - Primers: JB 3 (F): 5’ – TTTTTTGGGCATCCTGAGGTTTAT – 3’ JB 4.5 (R): 5’ – TAAAGAAAGAACATAATGAAAATG – 3’ Sequenciação (Bowles & McManus , 1992, Molec. Biochem. Parasitol, 54, 165-174)
  • 8. 2. Análise Filogenética • Amplificação de fragmentos do gene COI (Bowles and McManus, 1992). • Amplificação de fragmentos dos genes 12S, 16S e ATP6
  • 9. 2. Análise Filogenética (Thompson, R.C., 2008, Exp Parasitol.)
  • 10. 2. Análise Filogenética Fragmentos dos genes mitocondriais (COI, 12S, 16S e ATP6) concatenados (~2700 pb)
  • 11.

Notas do Editor

  1. - Análise de COI, NDI, ATP6, ITS-1