SlideShare uma empresa Scribd logo
1 de 29
Online bioscience course for grades 6-12 Fall 2009 bio 1.0
Class mechanics… ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],bio 1.0
Lecture 3:  Genes and proteins bio 1.0
Take Homes: ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],bio 1.0
What is a gene?: ,[object Object],[object Object],[object Object],[object Object],[object Object],bio 1.0
Take Home I Genes are DNA sequences that encode a heritable trait… What is a gene? bio 1.0
http://en.wikipedia.org/wiki/Genetic_code How the genetic code works I: bio 1.0
How the genetic code works II: Transcribed strand mRNA Peptide (“protein”) bio 1.0
How the genetic code works III bio 1.0
Reading frames bio 1.0
Using a computer program to define a gene from a sequence: http:// www.ncbi.nlm.nih.gov/gorf/gorf.html bio 1.0
Step-by-step video showing how to  use the ORF Finder with our DNA  sequence to find out if it encodes a  protein… http:// www.screencast.com/t/gzxXnMwLWNI bio 1.0
>EXPERIMENTAL DNA SEQUENCE I ATGGCTAGCAAAGGAGAAGAACTTTTCACTGGA GTTGTCCCAATTCTTGTTGAATTAGATGGTGAT GTTAATGGGCACAAATTTTCTGTCAGTGGAGAG GGTGAAGGTGATGCTACATACGGAAAGCTTACC CTTAAATTTATTTGCACTACTGGAAAACTACCT GTTCCATGGCCAACACTTGTCACTACTTTCTCT TATGGTGTTCAATGCTTTTCCCGTTATCCGGAT CATATGAAACGGCATGACTTTTTCAAGAGTGCC ATGCCCGAAGGTTATGTACAGGAACGCACTATA TCTTTCAAAGATGACGGGAACTACAAGACGCGT GCTGAAGTCAAGTTTGAAGGTGATACCCTTGTT AATCGTATCGAGTTAAAAGGTATTGATTTTAAA GAAGATGGAAACATTCTCGGACACAAACTCGAG TACAACTATAACTCACACAATGTATACATCACG GCAGACAAACAAAAGAATGGAATCAAAGCTAAC TTCAAAATTCGCCACAACATTGAAGATGGATCC GTTCAACTAGCAGACCATTATCAACAAAATACT CCAATTGGCGATGGCCCTGTCCTTTTACCAGAC AACCATTACCTGTCGACACAATCTGCCCTTTCG AAAGATCCCAACGAAAAGCGTGACCACATGGTC CTTCTTGAGTTTGTAACTGCTGCTGGGATTACA CATGGCATGGATGAGCTCTACAAAT Test DNA Sequence: bio 1.0
So, our sequence contains the  Green Fluorescent Protein (GFP)  Gene sequence…  bio 1.0
http:// en.wikipedia.org/wiki/Green_fluorescent_protein bio 1.0
Cells “engineered” to express GFP: bio 1.0
Take Home II Many genes encode for the amino acid sequence of proteins… Many genes code for proteins bio 1.0
The lac Operon-an example of  how bacterial genes are turned  “ on” and “off”… http:// www.youtube.com/watch?v =oBwtxdI1zvk bio 1.0
Take Home III Genes are tuned “on” and “off” by complex interactions of factors and DNA sequences… Genes are regulated  bio 1.0
Protein Functions in the Body  http:// www.youtube.com/watch?v =T500B5yTy58 bio 1.0
Take Home IV Proteins do most of the “work” in cells and most of the cell structure is made-up of proteins… The proteins encoded by genes shape the cell and do its work… bio 1.0
Protein Functions in the Body:  An example-ATP Synthase http:// www.youtube.com/watch?v =3y1dO4nNaKY bio 1.0
Looking at GFP at the  molecular level… bio 1.0
Download and install CN3D: http://www.ncbi.nlm.nih.gov/Structure/CN3D/cn3d.shtml bio 1.0
A look at GFP structure  with CN3D… http://www.screencast.com/t/oCq2i3YcX bio 1.0
Take Home V Proteins function according to their 3 Dimensional structures… How proteins work… bio 1.0
Virtual experiment: making bacteria  that glow green by giving them a GFP gene…  http://www.youtube.com/watch?v=Jyfi5e2JoYc & http:// www.youtube.com/watch?v =7zJ-Xe9rZh8 bio 1.0
Next Week: The bacterial world How bacteria are structured and how they function… bio 1.0
instructor Mark E Minie PhD [email_address]   bio 1.0

Mais conteúdo relacionado

Semelhante a Lecture 3 Genes And Proteins 10212009

Biopython programming workshop at UGA
Biopython programming workshop at UGABiopython programming workshop at UGA
Biopython programming workshop at UGAEric Talevich
 
Annotated biology technology resources
Annotated biology technology resourcesAnnotated biology technology resources
Annotated biology technology resourcesMarilyn Brouette
 
Lecture 1 bioscience overview 592010 post without videos
Lecture 1 bioscience overview 592010 post without videosLecture 1 bioscience overview 592010 post without videos
Lecture 1 bioscience overview 592010 post without videosmeminie
 
Lecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 postLecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 postmeminie
 
Lecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 postLecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 postmeminie
 
Introduction to NCBI
Introduction to NCBIIntroduction to NCBI
Introduction to NCBIgeetikaJethra
 
Lecture 1 bioscience overview 592010 post with videos
Lecture 1 bioscience overview 592010 post with videosLecture 1 bioscience overview 592010 post with videos
Lecture 1 bioscience overview 592010 post with videosmeminie
 
Protein Analysis
Protein AnalysisProtein Analysis
Protein AnalysisSyed Lokman
 
TheUniProtKBpptx__2022_03_30_13_07_41.pptx
TheUniProtKBpptx__2022_03_30_13_07_41.pptxTheUniProtKBpptx__2022_03_30_13_07_41.pptx
TheUniProtKBpptx__2022_03_30_13_07_41.pptxPRIYANKAZALA9
 
B.sc biochem i bobi u 2 database
B.sc biochem i bobi u 2 databaseB.sc biochem i bobi u 2 database
B.sc biochem i bobi u 2 databaseRai University
 
What Synthetic Biology Can Do For You
What Synthetic Biology Can Do For YouWhat Synthetic Biology Can Do For You
What Synthetic Biology Can Do For YouEric Ma
 
CRI - Teaching Through Research - Melanie Stegman - Immune Defense
CRI - Teaching Through Research - Melanie Stegman - Immune DefenseCRI - Teaching Through Research - Melanie Stegman - Immune Defense
CRI - Teaching Through Research - Melanie Stegman - Immune DefenseLeadershipProgram
 
Collaboratively Creating the Knowledge Graph of Life
Collaboratively Creating the Knowledge Graph of LifeCollaboratively Creating the Knowledge Graph of Life
Collaboratively Creating the Knowledge Graph of LifeChris Mungall
 

Semelhante a Lecture 3 Genes And Proteins 10212009 (20)

Biopython programming workshop at UGA
Biopython programming workshop at UGABiopython programming workshop at UGA
Biopython programming workshop at UGA
 
Bio4j
Bio4jBio4j
Bio4j
 
Synthetic Biology
Synthetic BiologySynthetic Biology
Synthetic Biology
 
簡報1
簡報1簡報1
簡報1
 
Annotated biology technology resources
Annotated biology technology resourcesAnnotated biology technology resources
Annotated biology technology resources
 
Biopharma VS Small Molecules Therapeutic
Biopharma VS Small Molecules TherapeuticBiopharma VS Small Molecules Therapeutic
Biopharma VS Small Molecules Therapeutic
 
Lecture 1 bioscience overview 592010 post without videos
Lecture 1 bioscience overview 592010 post without videosLecture 1 bioscience overview 592010 post without videos
Lecture 1 bioscience overview 592010 post without videos
 
Lecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 postLecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 post
 
Lecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 postLecture 1 bioscience overview 592010 post
Lecture 1 bioscience overview 592010 post
 
Introduction to NCBI
Introduction to NCBIIntroduction to NCBI
Introduction to NCBI
 
Lecture 1 bioscience overview 592010 post with videos
Lecture 1 bioscience overview 592010 post with videosLecture 1 bioscience overview 592010 post with videos
Lecture 1 bioscience overview 592010 post with videos
 
Protein Analysis
Protein AnalysisProtein Analysis
Protein Analysis
 
ED 205 IPP
ED 205 IPPED 205 IPP
ED 205 IPP
 
Biopharmaceutical
Biopharmaceutical Biopharmaceutical
Biopharmaceutical
 
Neo4j and bioinformatics
Neo4j and bioinformaticsNeo4j and bioinformatics
Neo4j and bioinformatics
 
TheUniProtKBpptx__2022_03_30_13_07_41.pptx
TheUniProtKBpptx__2022_03_30_13_07_41.pptxTheUniProtKBpptx__2022_03_30_13_07_41.pptx
TheUniProtKBpptx__2022_03_30_13_07_41.pptx
 
B.sc biochem i bobi u 2 database
B.sc biochem i bobi u 2 databaseB.sc biochem i bobi u 2 database
B.sc biochem i bobi u 2 database
 
What Synthetic Biology Can Do For You
What Synthetic Biology Can Do For YouWhat Synthetic Biology Can Do For You
What Synthetic Biology Can Do For You
 
CRI - Teaching Through Research - Melanie Stegman - Immune Defense
CRI - Teaching Through Research - Melanie Stegman - Immune DefenseCRI - Teaching Through Research - Melanie Stegman - Immune Defense
CRI - Teaching Through Research - Melanie Stegman - Immune Defense
 
Collaboratively Creating the Knowledge Graph of Life
Collaboratively Creating the Knowledge Graph of LifeCollaboratively Creating the Knowledge Graph of Life
Collaboratively Creating the Knowledge Graph of Life
 

Último

Artificial intelligence in cctv survelliance.pptx
Artificial intelligence in cctv survelliance.pptxArtificial intelligence in cctv survelliance.pptx
Artificial intelligence in cctv survelliance.pptxhariprasad279825
 
CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):comworks
 
Unleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding ClubUnleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding ClubKalema Edgar
 
Commit 2024 - Secret Management made easy
Commit 2024 - Secret Management made easyCommit 2024 - Secret Management made easy
Commit 2024 - Secret Management made easyAlfredo García Lavilla
 
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptxMerck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptxLoriGlavin3
 
Powerpoint exploring the locations used in television show Time Clash
Powerpoint exploring the locations used in television show Time ClashPowerpoint exploring the locations used in television show Time Clash
Powerpoint exploring the locations used in television show Time Clashcharlottematthew16
 
Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 3652toLead Limited
 
Unraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdfUnraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdfAlex Barbosa Coqueiro
 
TrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data PrivacyTrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data PrivacyTrustArc
 
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek SchlawackFwdays
 
Scanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsScanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsRizwan Syed
 
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024BookNet Canada
 
How to write a Business Continuity Plan
How to write a Business Continuity PlanHow to write a Business Continuity Plan
How to write a Business Continuity PlanDatabarracks
 
Anypoint Exchange: It’s Not Just a Repo!
Anypoint Exchange: It’s Not Just a Repo!Anypoint Exchange: It’s Not Just a Repo!
Anypoint Exchange: It’s Not Just a Repo!Manik S Magar
 
Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?Mattias Andersson
 
From Family Reminiscence to Scholarly Archive .
From Family Reminiscence to Scholarly Archive .From Family Reminiscence to Scholarly Archive .
From Family Reminiscence to Scholarly Archive .Alan Dix
 
Advanced Computer Architecture – An Introduction
Advanced Computer Architecture – An IntroductionAdvanced Computer Architecture – An Introduction
Advanced Computer Architecture – An IntroductionDilum Bandara
 
How AI, OpenAI, and ChatGPT impact business and software.
How AI, OpenAI, and ChatGPT impact business and software.How AI, OpenAI, and ChatGPT impact business and software.
How AI, OpenAI, and ChatGPT impact business and software.Curtis Poe
 
SIP trunking in Janus @ Kamailio World 2024
SIP trunking in Janus @ Kamailio World 2024SIP trunking in Janus @ Kamailio World 2024
SIP trunking in Janus @ Kamailio World 2024Lorenzo Miniero
 
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024BookNet Canada
 

Último (20)

Artificial intelligence in cctv survelliance.pptx
Artificial intelligence in cctv survelliance.pptxArtificial intelligence in cctv survelliance.pptx
Artificial intelligence in cctv survelliance.pptx
 
CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):
 
Unleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding ClubUnleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding Club
 
Commit 2024 - Secret Management made easy
Commit 2024 - Secret Management made easyCommit 2024 - Secret Management made easy
Commit 2024 - Secret Management made easy
 
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptxMerck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptx
 
Powerpoint exploring the locations used in television show Time Clash
Powerpoint exploring the locations used in television show Time ClashPowerpoint exploring the locations used in television show Time Clash
Powerpoint exploring the locations used in television show Time Clash
 
Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365
 
Unraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdfUnraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdf
 
TrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data PrivacyTrustArc Webinar - How to Build Consumer Trust Through Data Privacy
TrustArc Webinar - How to Build Consumer Trust Through Data Privacy
 
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
 
Scanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsScanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL Certs
 
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
 
How to write a Business Continuity Plan
How to write a Business Continuity PlanHow to write a Business Continuity Plan
How to write a Business Continuity Plan
 
Anypoint Exchange: It’s Not Just a Repo!
Anypoint Exchange: It’s Not Just a Repo!Anypoint Exchange: It’s Not Just a Repo!
Anypoint Exchange: It’s Not Just a Repo!
 
Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?
 
From Family Reminiscence to Scholarly Archive .
From Family Reminiscence to Scholarly Archive .From Family Reminiscence to Scholarly Archive .
From Family Reminiscence to Scholarly Archive .
 
Advanced Computer Architecture – An Introduction
Advanced Computer Architecture – An IntroductionAdvanced Computer Architecture – An Introduction
Advanced Computer Architecture – An Introduction
 
How AI, OpenAI, and ChatGPT impact business and software.
How AI, OpenAI, and ChatGPT impact business and software.How AI, OpenAI, and ChatGPT impact business and software.
How AI, OpenAI, and ChatGPT impact business and software.
 
SIP trunking in Janus @ Kamailio World 2024
SIP trunking in Janus @ Kamailio World 2024SIP trunking in Janus @ Kamailio World 2024
SIP trunking in Janus @ Kamailio World 2024
 
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
 

Lecture 3 Genes And Proteins 10212009

  • 1. Online bioscience course for grades 6-12 Fall 2009 bio 1.0
  • 2.
  • 3. Lecture 3: Genes and proteins bio 1.0
  • 4.
  • 5.
  • 6. Take Home I Genes are DNA sequences that encode a heritable trait… What is a gene? bio 1.0
  • 8. How the genetic code works II: Transcribed strand mRNA Peptide (“protein”) bio 1.0
  • 9. How the genetic code works III bio 1.0
  • 11. Using a computer program to define a gene from a sequence: http:// www.ncbi.nlm.nih.gov/gorf/gorf.html bio 1.0
  • 12. Step-by-step video showing how to use the ORF Finder with our DNA sequence to find out if it encodes a protein… http:// www.screencast.com/t/gzxXnMwLWNI bio 1.0
  • 13. >EXPERIMENTAL DNA SEQUENCE I ATGGCTAGCAAAGGAGAAGAACTTTTCACTGGA GTTGTCCCAATTCTTGTTGAATTAGATGGTGAT GTTAATGGGCACAAATTTTCTGTCAGTGGAGAG GGTGAAGGTGATGCTACATACGGAAAGCTTACC CTTAAATTTATTTGCACTACTGGAAAACTACCT GTTCCATGGCCAACACTTGTCACTACTTTCTCT TATGGTGTTCAATGCTTTTCCCGTTATCCGGAT CATATGAAACGGCATGACTTTTTCAAGAGTGCC ATGCCCGAAGGTTATGTACAGGAACGCACTATA TCTTTCAAAGATGACGGGAACTACAAGACGCGT GCTGAAGTCAAGTTTGAAGGTGATACCCTTGTT AATCGTATCGAGTTAAAAGGTATTGATTTTAAA GAAGATGGAAACATTCTCGGACACAAACTCGAG TACAACTATAACTCACACAATGTATACATCACG GCAGACAAACAAAAGAATGGAATCAAAGCTAAC TTCAAAATTCGCCACAACATTGAAGATGGATCC GTTCAACTAGCAGACCATTATCAACAAAATACT CCAATTGGCGATGGCCCTGTCCTTTTACCAGAC AACCATTACCTGTCGACACAATCTGCCCTTTCG AAAGATCCCAACGAAAAGCGTGACCACATGGTC CTTCTTGAGTTTGTAACTGCTGCTGGGATTACA CATGGCATGGATGAGCTCTACAAAT Test DNA Sequence: bio 1.0
  • 14. So, our sequence contains the Green Fluorescent Protein (GFP) Gene sequence… bio 1.0
  • 16. Cells “engineered” to express GFP: bio 1.0
  • 17. Take Home II Many genes encode for the amino acid sequence of proteins… Many genes code for proteins bio 1.0
  • 18. The lac Operon-an example of how bacterial genes are turned “ on” and “off”… http:// www.youtube.com/watch?v =oBwtxdI1zvk bio 1.0
  • 19. Take Home III Genes are tuned “on” and “off” by complex interactions of factors and DNA sequences… Genes are regulated bio 1.0
  • 20. Protein Functions in the Body http:// www.youtube.com/watch?v =T500B5yTy58 bio 1.0
  • 21. Take Home IV Proteins do most of the “work” in cells and most of the cell structure is made-up of proteins… The proteins encoded by genes shape the cell and do its work… bio 1.0
  • 22. Protein Functions in the Body: An example-ATP Synthase http:// www.youtube.com/watch?v =3y1dO4nNaKY bio 1.0
  • 23. Looking at GFP at the molecular level… bio 1.0
  • 24. Download and install CN3D: http://www.ncbi.nlm.nih.gov/Structure/CN3D/cn3d.shtml bio 1.0
  • 25. A look at GFP structure with CN3D… http://www.screencast.com/t/oCq2i3YcX bio 1.0
  • 26. Take Home V Proteins function according to their 3 Dimensional structures… How proteins work… bio 1.0
  • 27. Virtual experiment: making bacteria that glow green by giving them a GFP gene… http://www.youtube.com/watch?v=Jyfi5e2JoYc & http:// www.youtube.com/watch?v =7zJ-Xe9rZh8 bio 1.0
  • 28. Next Week: The bacterial world How bacteria are structured and how they function… bio 1.0
  • 29. instructor Mark E Minie PhD [email_address] bio 1.0