SlideShare uma empresa Scribd logo
1 de 35
Biology Final Exam Review

        Good Luck!!
Chapter 8 Karyotypes
• Examine, determine sex, normal or not and
  justify why!
Karyotype
Chapter 9 Genetics
• Punnett Squares: set one up, complete it and
  determine ratios and percents.
• Genotype of Parents:
• Heterozygous: Aa
• Phenotype of Parents:
• Dominant
• Offspring Ratios:
• ¼ AA, 2/4 Aa, ¼ aa
• Homozygous Dominant
• Heterozygous
• Homozygous Recessive
Chapter 9 vocabulary
• Genotype: genetic make-up, example: Rr, BB
• Phenotype: physical appearance, Round, blue
• Homozygous: 2 alleles are the same: BB
• Heterozygous: 2 alleles are different: Rr
• Dominant: allele masks the presence of another
  (capital letter). Only have to have one to exhibit
  the trait.
• Recessive: is masked by the presence of another
  allele (lower case). Need to have two to exhibit
  the trait (homozygous)
Chapter 10
DNA: Deoxyribonucleic Acid     RNA: Ribonucleic Acid
• 2 Strands                    • 1 strand
• Twisted ladder               • mRNA: straight
• Double helix                   (messenger)
• A-T and C-G                  • tRNA: hairpin (transfer)
• Codes for amino acid         • rRNA: globular (ribosomes)
  sequence (instructions for
  building proteins)           • A-U and C-G
• Never leaves nucleus         • Carries directions from DNA
• Discovered by Watson and       in Nucleus out to cell
  Crick
Chapter 10
• Codons: code for amino acids, sequence of 3
  nucleotides of mRNA
• AACUUGCAUGGUACCGGUAUCCUA
• Use table to find amino acid sequence (codon
  bingo)
Ch. 12 Pedigrees




• Fully shaded: Has disorder
• Half shaded: Carries allele for trait (or has it if the
  trait is dominant)
• Unshaded: Does not have trait
• Use info to construct Punnett Squares
• Marriage, cousins, siblings, generations, etc.
Ch. 12 Sex-linked inheritance
• Hemophilia: blood clotting disorder
• Carried on X chromosome.
• Phenotypes and Genotypes




• Why is it rare for females to have hemophilia?
Ch. 12 Sex-linked Inheritance
• Notation for Sex-linked traits use Sex
  Chromosomes XX or XY.




• Muscular Dystrophy, Color Blindness are SL.
Ch. 12 Genetic Disorders
• Non-disjunction: copies of chromosomes do
  not properly separate during meiosis.
• Result: gametes (egg or sperm) have either an
  extra copy of a chromosome or are missing a
  chromosome.
Ch. 12 Genetic Disorders
• Extra copy of a chromosome = Trisomy
• Examples of Trisomy: Trisomy 21 = Down
  syndrome, XXY Klinefelter’s Syndrome
• Missing copy of a chromosome = Monosomy
• Example of Monosomy: X _ = Turner’s
  Syndrome
Ch. 13. DNA Fingerprints
• Investigators use them because EVERYONE
  (except identical twins) have unique DNA.
• DNA fingerprints are the pattern of bands
  made up of specific fragments from an
  individuals DNA.
• DNA fingerprints are collected by first
  collecting CELLS left at the crime scene by the
  suspect, DNA is in the nucleus of the CELLS!!
Ch. 14 Biogenesis vs. Spontaneous
             Generation
Redi’s Experiment proved maggots from flies




Control         Experimental
Ch. 14 Biogenesis vs. Spontaneous
               Generation
• Spallanzani killed the “vital force”
•                                   Control




•                                   Experimental
Pasteur credit for disproving S.G.
Ch. 14 Early Earth
• Early ancestors of cyanobacteria (first
  autotrophic cells) put oxygen into
  atmosphere.
• Performed photosynthesis.
• First cells on Earth were prokaryotic and
  heterotrophic
• Prokaryotic = single celled, small, no nucleus
• Heterotrophic = eat for energy
Ch. 15 Evolution
• Darwin’s Finches: size and shape of beak
  related to food they eat.
• Natural Selection: organisms with most
  successful traits survive, reproduce, pass
  favorable trait on to offspring. Number of
  members of population with favorable trait
  increase each generation.
Chapter 16 Evolution Cont.
• Speciation: process of species forming
• Geographic Isolation: physical separation of
  member of a population, gene flow
  stops, each evolve into different species
  because pressures are different in each area.
• Reproductive Isolation: barriers to successful
  breeding between population groups in the
  same area.
Chapter 17 Amino Acid Sequences and
     Evolutionary Relationships
• The greater the similarity between amino acid
  sequences (more in common) of two species
  the more closely related the two species are
  evolutionarily.
• The longer the 2 species have been diverging
  (V) from a common ancestor, the greater the
  differences in sequences (less in common)
Ch. 19 Environmental Issues
• Global Warming: rise in average high
  temperatures around the world.
• Greenhouse Effect: gases in the atmosphere
  (water vapor, carbon dioxide, methane) reflect
  heat and direct it back to Earth.
Ch. 19 Environmental Issues
• Hole in the Ozone: Ozone is needed to block
  UV Radiation from the sun. Hole leads to
  more cases of cancer. Discovered in 1985.
  Ban on use of ozone destroying chemicals like.
• CFC’s (chloroflourocarbons)
Ch. 19 important vocabulary
• Abiotic Factor: non-living components in
  ecosystem. Examples: temperature,
  precipitation, landscape, minerals in soil,
  rocks.
• Biotic Factor: living components in ecosystem.
• Agricultural Revolution: increased, steady
  food supply lead to explosion of human
  population. Later medical advances and
  sanitation also contributed.
Ch. 21
• Competition (-,-)
• Competitive Exclusion: 1 species is eliminated
  from a community because of competition for
  same limited resource. Example?
• Resource Partitioning: when similar species co-
  exist, each uses only part of the available
  resource. Example?
• Character Displacement: evolution of physical
  differences that reduce competition between
  similar species. Example?
Ch. 21
• Parasitism (+,-)
• Parasite (+): Organism obtains nutrition at the
  expense of another organism. Example:
• Host(-): organism that is being hurt or fed off
  of.
Ch. 21
• Predation (+,-)
• Predator (+): obtains energy by eating another
  organism (plant or animal)
• Prey (-): organism being eat by the predator.
Ch. 21
•   Mutualism (+,+)
•   Interaction in which both species benefit.
•   Commensalism (+,0)
•   Interaction in which one species benefit and
    another is not affected.
Ch. 21
• Primary Succession: No soil exists, nothing
  growing, pioneer species grow, then herbs,
  then shrubs, then trees, then a mature forest.
• Secondary Succession: Soil exists, climax
  community, disaster destroys ecosystem,
  pioneer species, herbs, shrubs, trees, mature
  forest.
Ch. 22
• Consumers are heterotrophs.
• Carnivore eat meat. (secondary, tertiary)
• Herbivore eat plants. (primary)
• Omnivore eat both meat and plants.
  (secondary)
• Producers: autotrophs, plants, produce own
  food with energy from the sun, perform
  photosynthesis.
Ch. 22
• Food webs: examine and determine
  relationships and domino effect
Ch. 22
• Biomes/Ecosystems: know characteristics
• Tundra: cold, low biodiversity, found at poles.
• Tiaga: south of poles, evergreen trees, less
  rain than here, colder.
• Temperate Deciduous Forest: here, 4 seasons,
  trees lose leaves.
• Grassland: less rain than here, 4 seasons,
  Nebraska.
Ch. 22
• Desert: Cold at night, little rain, hot daytime,
  found in interior of continents.
• Savanna: Warm, wet and dry seasons, grasses
• Tropical Rain Forest: year long growing
  season, steady rain, HIGHEST biodiversity,
  found near equator.
Ch. 22 Biome Location
Biodiversity
• Highest in Tropical Rainforest.
• Lowest in Tundra
• Traveling from Equator to Tundra = to traveling
  up a mountain (peak like Tundra).
Ethical
• 1. pertaining to or dealing with morals
  or principles of morality; pertaining to right and
  wrong in conduct.
• 2. being in accordance with the rules or standards
  for right conduct or practice, especially the
  standards of a profession: It was not considered
  ethical for physicians to advertise.
• Think of it in terms of science and conducting
  research, experiments, studies.

Mais conteúdo relacionado

Mais procurados

Darwinian evolution & natural selection
Darwinian evolution & natural selectionDarwinian evolution & natural selection
Darwinian evolution & natural selection
SingerGurlE88
 
Evolution natural selection
Evolution natural selectionEvolution natural selection
Evolution natural selection
Kelly D
 

Mais procurados (17)

Evolution and natural selection 2015
Evolution and natural selection 2015Evolution and natural selection 2015
Evolution and natural selection 2015
 
heredity and evolution
heredity and evolutionheredity and evolution
heredity and evolution
 
Heridity and evolution
Heridity and evolutionHeridity and evolution
Heridity and evolution
 
Heredity and Evolution Class X Priya Jha
Heredity  and Evolution Class X Priya JhaHeredity  and Evolution Class X Priya Jha
Heredity and Evolution Class X Priya Jha
 
5.2 natural selection
5.2 natural selection5.2 natural selection
5.2 natural selection
 
Science 9 Unit A Biological Diversity Section2 Lesson Variation
Science 9 Unit A Biological Diversity Section2 Lesson VariationScience 9 Unit A Biological Diversity Section2 Lesson Variation
Science 9 Unit A Biological Diversity Section2 Lesson Variation
 
Heridity and Evolution - Biology Class 10 CBSE
Heridity and Evolution - Biology Class 10 CBSEHeridity and Evolution - Biology Class 10 CBSE
Heridity and Evolution - Biology Class 10 CBSE
 
Darwinism and Neo Darwinism
Darwinism and Neo DarwinismDarwinism and Neo Darwinism
Darwinism and Neo Darwinism
 
Heredity and evolution class 10th Questions
Heredity and evolution class 10th QuestionsHeredity and evolution class 10th Questions
Heredity and evolution class 10th Questions
 
Bio 40s evolution
Bio 40s evolutionBio 40s evolution
Bio 40s evolution
 
Evolution_PMSD_Biology
Evolution_PMSD_BiologyEvolution_PMSD_Biology
Evolution_PMSD_Biology
 
Heredity and Evolution
Heredity and EvolutionHeredity and Evolution
Heredity and Evolution
 
Darwinian evolution & natural selection
Darwinian evolution & natural selectionDarwinian evolution & natural selection
Darwinian evolution & natural selection
 
4. heredity and evolution
4. heredity and evolution4. heredity and evolution
4. heredity and evolution
 
Sbc174 evolution 2014 week2
Sbc174 evolution 2014 week2Sbc174 evolution 2014 week2
Sbc174 evolution 2014 week2
 
Evolution natural selection
Evolution natural selectionEvolution natural selection
Evolution natural selection
 
Chpt. 15.1
Chpt. 15.1Chpt. 15.1
Chpt. 15.1
 

Semelhante a Biology final exam review

BiologyEcology-222-Genetics-topic1a.pptx
BiologyEcology-222-Genetics-topic1a.pptxBiologyEcology-222-Genetics-topic1a.pptx
BiologyEcology-222-Genetics-topic1a.pptx
IskakMohaimin
 
Biology remediation review
Biology remediation reviewBiology remediation review
Biology remediation review
Jaibyrd
 
Chapter 5 principles of inheritance and variation
Chapter 5 principles of inheritance and variationChapter 5 principles of inheritance and variation
Chapter 5 principles of inheritance and variation
mohan bio
 
Mendelian genetics by mohanbio
Mendelian genetics by mohanbioMendelian genetics by mohanbio
Mendelian genetics by mohanbio
mohan bio
 
Genetics..............................ppt
Genetics..............................pptGenetics..............................ppt
Genetics..............................ppt
rheapalmaortego
 

Semelhante a Biology final exam review (20)

Biology sol review 2014
Biology sol review 2014Biology sol review 2014
Biology sol review 2014
 
BiologyEcology-222-Genetics-topic1a.pptx
BiologyEcology-222-Genetics-topic1a.pptxBiologyEcology-222-Genetics-topic1a.pptx
BiologyEcology-222-Genetics-topic1a.pptx
 
Classical and modern genetics
Classical and modern geneticsClassical and modern genetics
Classical and modern genetics
 
MolecularGeneticsUnit4-1_000.pptx
MolecularGeneticsUnit4-1_000.pptxMolecularGeneticsUnit4-1_000.pptx
MolecularGeneticsUnit4-1_000.pptx
 
Biology remediation review
Biology remediation reviewBiology remediation review
Biology remediation review
 
Chapter 5 principles of inheritance and variation
Chapter 5 principles of inheritance and variationChapter 5 principles of inheritance and variation
Chapter 5 principles of inheritance and variation
 
Ch16genetics 150405165056-conversion-gate01
Ch16genetics 150405165056-conversion-gate01Ch16genetics 150405165056-conversion-gate01
Ch16genetics 150405165056-conversion-gate01
 
Ch16 genetics
Ch16  geneticsCh16  genetics
Ch16 genetics
 
Ch16genetics 150405165056-conversion-gate01
Ch16genetics 150405165056-conversion-gate01Ch16genetics 150405165056-conversion-gate01
Ch16genetics 150405165056-conversion-gate01
 
Mendelian genetics by mohanbio
Mendelian genetics by mohanbioMendelian genetics by mohanbio
Mendelian genetics by mohanbio
 
BIS2C_2020. Lecture 6. The Tree of Life.
BIS2C_2020. Lecture 6. The Tree of Life. BIS2C_2020. Lecture 6. The Tree of Life.
BIS2C_2020. Lecture 6. The Tree of Life.
 
Evolution and Genetics
Evolution and GeneticsEvolution and Genetics
Evolution and Genetics
 
1-geneticmaterial-160926221754 (1).pptx
1-geneticmaterial-160926221754  (1).pptx1-geneticmaterial-160926221754  (1).pptx
1-geneticmaterial-160926221754 (1).pptx
 
chromosomal aberration
chromosomal aberrationchromosomal aberration
chromosomal aberration
 
Genetics..............................ppt
Genetics..............................pptGenetics..............................ppt
Genetics..............................ppt
 
Genetics dentistry part 1 2017
Genetics dentistry part  1 2017Genetics dentistry part  1 2017
Genetics dentistry part 1 2017
 
B.tech biotech i bls u 4 mendal's genetics
B.tech biotech i bls u 4 mendal's geneticsB.tech biotech i bls u 4 mendal's genetics
B.tech biotech i bls u 4 mendal's genetics
 
Genetics PowerPoint 2.pptx
Genetics PowerPoint 2.pptxGenetics PowerPoint 2.pptx
Genetics PowerPoint 2.pptx
 
Vinay @ dna
Vinay @ dnaVinay @ dna
Vinay @ dna
 
Principles of ecology
Principles of ecologyPrinciples of ecology
Principles of ecology
 

Mais de eruder

5th ogt olympics closing ceremony
5th ogt olympics closing ceremony5th ogt olympics closing ceremony
5th ogt olympics closing ceremony
eruder
 
Nervous system review
Nervous system reviewNervous system review
Nervous system review
eruder
 
Unit 1 review
Unit 1 reviewUnit 1 review
Unit 1 review
eruder
 
A&p ch 1 review
A&p ch 1 reviewA&p ch 1 review
A&p ch 1 review
eruder
 
Anatomical terminology
Anatomical terminologyAnatomical terminology
Anatomical terminology
eruder
 
Understanding terminology
Understanding terminologyUnderstanding terminology
Understanding terminology
eruder
 
Scientific method
Scientific methodScientific method
Scientific method
eruder
 
Eco ch6 jeopardy
Eco ch6 jeopardyEco ch6 jeopardy
Eco ch6 jeopardy
eruder
 
Population growth and urbanization
Population growth and urbanizationPopulation growth and urbanization
Population growth and urbanization
eruder
 
Bacteria jeopardy
Bacteria jeopardyBacteria jeopardy
Bacteria jeopardy
eruder
 
Viruses
VirusesViruses
Viruses
eruder
 
Bacteria
BacteriaBacteria
Bacteria
eruder
 
Genetic disorders ruder
Genetic disorders ruderGenetic disorders ruder
Genetic disorders ruder
eruder
 
Population growth
Population growthPopulation growth
Population growth
eruder
 
Biosphere and biomes
Biosphere and biomesBiosphere and biomes
Biosphere and biomes
eruder
 
Ecology jeopardy (2)
Ecology jeopardy (2)Ecology jeopardy (2)
Ecology jeopardy (2)
eruder
 
Ecology bio jeopardy
Ecology bio jeopardyEcology bio jeopardy
Ecology bio jeopardy
eruder
 
Ogt science review
Ogt science reviewOgt science review
Ogt science review
eruder
 
Ogt review science
Ogt review scienceOgt review science
Ogt review science
eruder
 
Ogt olympics results 2012
Ogt olympics results 2012Ogt olympics results 2012
Ogt olympics results 2012
eruder
 

Mais de eruder (20)

5th ogt olympics closing ceremony
5th ogt olympics closing ceremony5th ogt olympics closing ceremony
5th ogt olympics closing ceremony
 
Nervous system review
Nervous system reviewNervous system review
Nervous system review
 
Unit 1 review
Unit 1 reviewUnit 1 review
Unit 1 review
 
A&p ch 1 review
A&p ch 1 reviewA&p ch 1 review
A&p ch 1 review
 
Anatomical terminology
Anatomical terminologyAnatomical terminology
Anatomical terminology
 
Understanding terminology
Understanding terminologyUnderstanding terminology
Understanding terminology
 
Scientific method
Scientific methodScientific method
Scientific method
 
Eco ch6 jeopardy
Eco ch6 jeopardyEco ch6 jeopardy
Eco ch6 jeopardy
 
Population growth and urbanization
Population growth and urbanizationPopulation growth and urbanization
Population growth and urbanization
 
Bacteria jeopardy
Bacteria jeopardyBacteria jeopardy
Bacteria jeopardy
 
Viruses
VirusesViruses
Viruses
 
Bacteria
BacteriaBacteria
Bacteria
 
Genetic disorders ruder
Genetic disorders ruderGenetic disorders ruder
Genetic disorders ruder
 
Population growth
Population growthPopulation growth
Population growth
 
Biosphere and biomes
Biosphere and biomesBiosphere and biomes
Biosphere and biomes
 
Ecology jeopardy (2)
Ecology jeopardy (2)Ecology jeopardy (2)
Ecology jeopardy (2)
 
Ecology bio jeopardy
Ecology bio jeopardyEcology bio jeopardy
Ecology bio jeopardy
 
Ogt science review
Ogt science reviewOgt science review
Ogt science review
 
Ogt review science
Ogt review scienceOgt review science
Ogt review science
 
Ogt olympics results 2012
Ogt olympics results 2012Ogt olympics results 2012
Ogt olympics results 2012
 

Último

Finding Java's Hidden Performance Traps @ DevoxxUK 2024
Finding Java's Hidden Performance Traps @ DevoxxUK 2024Finding Java's Hidden Performance Traps @ DevoxxUK 2024
Finding Java's Hidden Performance Traps @ DevoxxUK 2024
Victor Rentea
 
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
Victor Rentea
 
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers:  A Deep Dive into Serverless Spatial Data and FMECloud Frontiers:  A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Safe Software
 
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers:  A Deep Dive into Serverless Spatial Data and FMECloud Frontiers:  A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Safe Software
 
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
?#DUbAI#??##{{(☎️+971_581248768%)**%*]'#abortion pills for sale in dubai@
 

Último (20)

Finding Java's Hidden Performance Traps @ DevoxxUK 2024
Finding Java's Hidden Performance Traps @ DevoxxUK 2024Finding Java's Hidden Performance Traps @ DevoxxUK 2024
Finding Java's Hidden Performance Traps @ DevoxxUK 2024
 
Apidays New York 2024 - APIs in 2030: The Risk of Technological Sleepwalk by ...
Apidays New York 2024 - APIs in 2030: The Risk of Technological Sleepwalk by ...Apidays New York 2024 - APIs in 2030: The Risk of Technological Sleepwalk by ...
Apidays New York 2024 - APIs in 2030: The Risk of Technological Sleepwalk by ...
 
presentation ICT roal in 21st century education
presentation ICT roal in 21st century educationpresentation ICT roal in 21st century education
presentation ICT roal in 21st century education
 
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
 
Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...Apidays New York 2024 - The value of a flexible API Management solution for O...
Apidays New York 2024 - The value of a flexible API Management solution for O...
 
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
 
CNIC Information System with Pakdata Cf In Pakistan
CNIC Information System with Pakdata Cf In PakistanCNIC Information System with Pakdata Cf In Pakistan
CNIC Information System with Pakdata Cf In Pakistan
 
Understanding the FAA Part 107 License ..
Understanding the FAA Part 107 License ..Understanding the FAA Part 107 License ..
Understanding the FAA Part 107 License ..
 
Elevate Developer Efficiency & build GenAI Application with Amazon Q​
Elevate Developer Efficiency & build GenAI Application with Amazon Q​Elevate Developer Efficiency & build GenAI Application with Amazon Q​
Elevate Developer Efficiency & build GenAI Application with Amazon Q​
 
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers:  A Deep Dive into Serverless Spatial Data and FMECloud Frontiers:  A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
 
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers:  A Deep Dive into Serverless Spatial Data and FMECloud Frontiers:  A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
 
Vector Search -An Introduction in Oracle Database 23ai.pptx
Vector Search -An Introduction in Oracle Database 23ai.pptxVector Search -An Introduction in Oracle Database 23ai.pptx
Vector Search -An Introduction in Oracle Database 23ai.pptx
 
Web Form Automation for Bonterra Impact Management (fka Social Solutions Apri...
Web Form Automation for Bonterra Impact Management (fka Social Solutions Apri...Web Form Automation for Bonterra Impact Management (fka Social Solutions Apri...
Web Form Automation for Bonterra Impact Management (fka Social Solutions Apri...
 
Artificial Intelligence Chap.5 : Uncertainty
Artificial Intelligence Chap.5 : UncertaintyArtificial Intelligence Chap.5 : Uncertainty
Artificial Intelligence Chap.5 : Uncertainty
 
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
 
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost SavingRepurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
 
Rising Above_ Dubai Floods and the Fortitude of Dubai International Airport.pdf
Rising Above_ Dubai Floods and the Fortitude of Dubai International Airport.pdfRising Above_ Dubai Floods and the Fortitude of Dubai International Airport.pdf
Rising Above_ Dubai Floods and the Fortitude of Dubai International Airport.pdf
 
DBX First Quarter 2024 Investor Presentation
DBX First Quarter 2024 Investor PresentationDBX First Quarter 2024 Investor Presentation
DBX First Quarter 2024 Investor Presentation
 
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
 
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin WoodPolkadot JAM Slides - Token2049 - By Dr. Gavin Wood
Polkadot JAM Slides - Token2049 - By Dr. Gavin Wood
 

Biology final exam review

  • 1. Biology Final Exam Review Good Luck!!
  • 2. Chapter 8 Karyotypes • Examine, determine sex, normal or not and justify why!
  • 4. Chapter 9 Genetics • Punnett Squares: set one up, complete it and determine ratios and percents. • Genotype of Parents: • Heterozygous: Aa • Phenotype of Parents: • Dominant • Offspring Ratios: • ¼ AA, 2/4 Aa, ¼ aa • Homozygous Dominant • Heterozygous • Homozygous Recessive
  • 5. Chapter 9 vocabulary • Genotype: genetic make-up, example: Rr, BB • Phenotype: physical appearance, Round, blue • Homozygous: 2 alleles are the same: BB • Heterozygous: 2 alleles are different: Rr • Dominant: allele masks the presence of another (capital letter). Only have to have one to exhibit the trait. • Recessive: is masked by the presence of another allele (lower case). Need to have two to exhibit the trait (homozygous)
  • 6. Chapter 10 DNA: Deoxyribonucleic Acid RNA: Ribonucleic Acid • 2 Strands • 1 strand • Twisted ladder • mRNA: straight • Double helix (messenger) • A-T and C-G • tRNA: hairpin (transfer) • Codes for amino acid • rRNA: globular (ribosomes) sequence (instructions for building proteins) • A-U and C-G • Never leaves nucleus • Carries directions from DNA • Discovered by Watson and in Nucleus out to cell Crick
  • 7. Chapter 10 • Codons: code for amino acids, sequence of 3 nucleotides of mRNA • AACUUGCAUGGUACCGGUAUCCUA • Use table to find amino acid sequence (codon bingo)
  • 8. Ch. 12 Pedigrees • Fully shaded: Has disorder • Half shaded: Carries allele for trait (or has it if the trait is dominant) • Unshaded: Does not have trait • Use info to construct Punnett Squares • Marriage, cousins, siblings, generations, etc.
  • 9. Ch. 12 Sex-linked inheritance • Hemophilia: blood clotting disorder • Carried on X chromosome. • Phenotypes and Genotypes • Why is it rare for females to have hemophilia?
  • 10. Ch. 12 Sex-linked Inheritance • Notation for Sex-linked traits use Sex Chromosomes XX or XY. • Muscular Dystrophy, Color Blindness are SL.
  • 11. Ch. 12 Genetic Disorders • Non-disjunction: copies of chromosomes do not properly separate during meiosis. • Result: gametes (egg or sperm) have either an extra copy of a chromosome or are missing a chromosome.
  • 12. Ch. 12 Genetic Disorders • Extra copy of a chromosome = Trisomy • Examples of Trisomy: Trisomy 21 = Down syndrome, XXY Klinefelter’s Syndrome • Missing copy of a chromosome = Monosomy • Example of Monosomy: X _ = Turner’s Syndrome
  • 13. Ch. 13. DNA Fingerprints • Investigators use them because EVERYONE (except identical twins) have unique DNA. • DNA fingerprints are the pattern of bands made up of specific fragments from an individuals DNA. • DNA fingerprints are collected by first collecting CELLS left at the crime scene by the suspect, DNA is in the nucleus of the CELLS!!
  • 14. Ch. 14 Biogenesis vs. Spontaneous Generation Redi’s Experiment proved maggots from flies Control Experimental
  • 15. Ch. 14 Biogenesis vs. Spontaneous Generation • Spallanzani killed the “vital force” • Control • Experimental
  • 16. Pasteur credit for disproving S.G.
  • 17. Ch. 14 Early Earth • Early ancestors of cyanobacteria (first autotrophic cells) put oxygen into atmosphere. • Performed photosynthesis. • First cells on Earth were prokaryotic and heterotrophic • Prokaryotic = single celled, small, no nucleus • Heterotrophic = eat for energy
  • 18. Ch. 15 Evolution • Darwin’s Finches: size and shape of beak related to food they eat. • Natural Selection: organisms with most successful traits survive, reproduce, pass favorable trait on to offspring. Number of members of population with favorable trait increase each generation.
  • 19. Chapter 16 Evolution Cont. • Speciation: process of species forming • Geographic Isolation: physical separation of member of a population, gene flow stops, each evolve into different species because pressures are different in each area. • Reproductive Isolation: barriers to successful breeding between population groups in the same area.
  • 20. Chapter 17 Amino Acid Sequences and Evolutionary Relationships • The greater the similarity between amino acid sequences (more in common) of two species the more closely related the two species are evolutionarily. • The longer the 2 species have been diverging (V) from a common ancestor, the greater the differences in sequences (less in common)
  • 21. Ch. 19 Environmental Issues • Global Warming: rise in average high temperatures around the world. • Greenhouse Effect: gases in the atmosphere (water vapor, carbon dioxide, methane) reflect heat and direct it back to Earth.
  • 22. Ch. 19 Environmental Issues • Hole in the Ozone: Ozone is needed to block UV Radiation from the sun. Hole leads to more cases of cancer. Discovered in 1985. Ban on use of ozone destroying chemicals like. • CFC’s (chloroflourocarbons)
  • 23. Ch. 19 important vocabulary • Abiotic Factor: non-living components in ecosystem. Examples: temperature, precipitation, landscape, minerals in soil, rocks. • Biotic Factor: living components in ecosystem. • Agricultural Revolution: increased, steady food supply lead to explosion of human population. Later medical advances and sanitation also contributed.
  • 24. Ch. 21 • Competition (-,-) • Competitive Exclusion: 1 species is eliminated from a community because of competition for same limited resource. Example? • Resource Partitioning: when similar species co- exist, each uses only part of the available resource. Example? • Character Displacement: evolution of physical differences that reduce competition between similar species. Example?
  • 25. Ch. 21 • Parasitism (+,-) • Parasite (+): Organism obtains nutrition at the expense of another organism. Example: • Host(-): organism that is being hurt or fed off of.
  • 26. Ch. 21 • Predation (+,-) • Predator (+): obtains energy by eating another organism (plant or animal) • Prey (-): organism being eat by the predator.
  • 27. Ch. 21 • Mutualism (+,+) • Interaction in which both species benefit. • Commensalism (+,0) • Interaction in which one species benefit and another is not affected.
  • 28. Ch. 21 • Primary Succession: No soil exists, nothing growing, pioneer species grow, then herbs, then shrubs, then trees, then a mature forest. • Secondary Succession: Soil exists, climax community, disaster destroys ecosystem, pioneer species, herbs, shrubs, trees, mature forest.
  • 29. Ch. 22 • Consumers are heterotrophs. • Carnivore eat meat. (secondary, tertiary) • Herbivore eat plants. (primary) • Omnivore eat both meat and plants. (secondary) • Producers: autotrophs, plants, produce own food with energy from the sun, perform photosynthesis.
  • 30. Ch. 22 • Food webs: examine and determine relationships and domino effect
  • 31. Ch. 22 • Biomes/Ecosystems: know characteristics • Tundra: cold, low biodiversity, found at poles. • Tiaga: south of poles, evergreen trees, less rain than here, colder. • Temperate Deciduous Forest: here, 4 seasons, trees lose leaves. • Grassland: less rain than here, 4 seasons, Nebraska.
  • 32. Ch. 22 • Desert: Cold at night, little rain, hot daytime, found in interior of continents. • Savanna: Warm, wet and dry seasons, grasses • Tropical Rain Forest: year long growing season, steady rain, HIGHEST biodiversity, found near equator.
  • 33. Ch. 22 Biome Location
  • 34. Biodiversity • Highest in Tropical Rainforest. • Lowest in Tundra • Traveling from Equator to Tundra = to traveling up a mountain (peak like Tundra).
  • 35. Ethical • 1. pertaining to or dealing with morals or principles of morality; pertaining to right and wrong in conduct. • 2. being in accordance with the rules or standards for right conduct or practice, especially the standards of a profession: It was not considered ethical for physicians to advertise. • Think of it in terms of science and conducting research, experiments, studies.