Differentiation & activity of human pre-osteoclasts on CHITOSAN

1. Differentiation & activity of human pre-osteoclasts on CHITOSAN Nathalie Rochet, Thierry Balaguer, FlorianBoukhechba, Jean-pierre, Danielle Quincey, StephaneGoncalves& Georges F. Carle Ashish Sharma BME 672

5. Linear poly saccharide composed of Glucosamine/N-acetyl Glucosamine

6. Biodegradable

7. Can be molded in porous structures

8. In-situ it forms hydroxyapetite

9. Assosiation with CPC shows enhanced mechanical properties

11. INTRODUCTION It has been studied chitosan promotes growth and mineral rich matrix deposition by osteoblasts in-vitro. Its influence on osteoclasts differentiation which also plays an important role in bone remodelling has never been described. Bone remodelling is a life long process where matured bone tissue is removed from the skeleton and a new bone tissue is formed(ossification).

13. LIVE/DEAD fluorescent assay tartrate-resistant acid(TRACP) staining, Scanning electron microscopy & quantitative RT-PCR have been used.

15. Cementek/chitosan obtained by addition of 83% deacetylatedchitosan to cementek

16. 13mm diameter & 1mm thick disks were manufactured in order to fit into 15mm diameter microwells

17. Sterilized by gamma irradiation

18. All the pellets were incubated for 4 days in the humid 5% co2 environment at 37°celsius

20. CELL AND CULTURE CONDITIONS Human osteoclast precursors and osteoclast differentiation medium kit were purchased from LONZA The cells were then thawed in osteoclast precursor growth medium following the manufacturer’s instructions They were then seeded at a density of 70,000 cells/pellet in osteoclast differentiation medium containing hM-CSF & hRANK-L at the final concentration of 33 ng/ml and 66 ng/ml respectively In parallel the same cells were seeded on plastic culture plates in order to follow osteoclast differentiation as large multinucletaed cells by phase microscopy Cell attachment & viability were ensured using a fluorescent assay

21. CELL ATTACHMENT & VIABILITY ON CEMENTEK, CEMENTEK/CHITOSAN & PMMA PELLETS The LIVE/DEAD viability/cytotoxicity assay kit provides a two color fluorescence cell viability assay Determine live and dead cells with two probes that measure two recognized parameters of cell viability- intracellular esterase activity and plasma membrane integrity Molecular probes has found that calceinAM & Ethidiumhomodimer are optimal dyes for the application. Live cells are distinguished by the presence of ubiquitous intracellular esterase activity determined by the enzymatic conversion of the virtually non fluorescent cell permeantcalcein AM to the intensely fluorescent calcein Calcein dye produces the uniform green color EthD-1 enters cells with damaged membranes and undergoes a 40-fold enhancement of fluorescence upon binding to nucleic acids thereby producing a bright red fluorescence in dead cells.

22. TARTRATE-RESISTANT ACID PHOOSPHATASE STAINING Pellets with cells or plastic cultured cells were washed in PBS TRACP activity was analyzed using the kit 386A TRACP activity is expressed by bone-resorbingosteoclasts and activated macrophages TRACP positive cells appeared in red/purple

23. FIELD EMISSION SCANNING ELECTRON MICROSCOPY With the help of this microscopy tiny structures as small as 1 nanometer (= one millionth of a millimeter = 10-9m!) can be visualize in small objects. Pellets with cells were fixed for 30min at 4°c in 1.6% glutraldehyde solution in a phosphate buffer at pH 7.2 The samples were then dehydrated through a graded ethanol series immersed in hexamethyldisilazane The final sample will then mounted on aluminum stubs and sputter coated with gold palladium Examination was performed using a FESEM with a resolution of 1nm at 15kv

24. Quantitative RT-PCR analysis PCR or polymerase chain reaction is a scientific technique to amplify a single or a few copies of DNA Generates thousands to millions of copies of a particular DNA sequence RT-PCR enables both detection and quantification of one or more specific sequences in a DNA sample Total RNA from cells were adsorbed onto silica membranes using nucleospin RNAII kit 1µgm of total RNA was reverse transcribed with random primers according to the manufacturer protocol RT-PCR was performed on an ABI prism 7700 Primers for TRACP & for the acidic ribosomal phosphoprotein P0 control gene were chosen to span introns so that signals from genomics DNA could be distinguished from cDNA The acidic ribosomal phosphoprotein P0 control gene were chosen to span introns so that signals from genomic DNA could be distinguished from cDNA

25. TRACP F: 5’GACCACCTTGGCAATGTCTCTG3’ TRACP R: 5’TGGCTGAGGAAGTCATCTGAGTTG3’ 36B4 F: 5’TGCATCAGTACCCCATTCTATCAT3’ 36B4 R: 5’AGGCAGATGGATCAGCCAAGA-3’ The reactions were performed in a 20µl final volume using 5µl of diluted cDNA Gene expression was quantified using the comparative 2-DCt method

27. Calcium and phosphate amounts were measured in the culture medium before and after incubation in the presence of cementek & cemetek/chitosan pellets for various time over a 3-day culture period

28. Both cementek & cementek/chitosan induced a depletion of calcium and a release of phosphate

30. Calcium values returned respectively to 68.7 ± 2.7 and 66.1 ± 2.8 mg kg−1in the supernatant of Cementek® and Cementek®/chitosan, compared to 73.8 + 3.2 mg kg−1 in the control medium. Phosphate values returned respectively to 40.1 ± 1.8 and 48.6 ± 2.4 mg kg−1 for Cementek® and Cementek®/chitosan supernatants compared to 36.9 ± 1.9 mg kg−1 in the control medium. These data led us to determine a pre-incubation period of 4 days with medium renewal just before cell seeding, for both biomaterials.

31. 2) Osteoclast precursor differentiation on the different biomaterials: proliferation, viability and morphology Single cell suspension of human osteoclast precursors was seeded on Cementek®, Cementek®/chitosan, PMMA pellets or directly on plastic, in 24-well micro-plate in the presence of differentiating agents LIVE/DEAD assay test showed the number of dead cells didn’t exceed 1% of the total of the total cell number whatever the biomaterial used In all cases, the osteoclast precursors proliferated and reached a similar high density Among the cells present on Cementek® and Cementek®/chitosan, 30% appeared with a very large and spread morphology evoking giant osteoclast-like cells . These cells had a mean size of 100 μm on Cementek® and were even larger on Cementek®/chitosan all the cells present on PMMA had a fibroblastic morphology and remained much smaller

32. Viability of human osteoclast precursors cultured on Cementek®, Cementek®/chitosan and PMMA pellets for 7 days in the presence of rhRANK-L and rhM-CSF

33. 3. TRACP activity of the cells present on the pellets and on the plastic surrounding the pellets TRACP activity was performed after 7 days of differentiation directly in the wells This allowed to analyze the TRACP activity of the cells cultured on the biomaterials and also the TRACP activity of the cells cultured on the plastic surface surrounding the pellets in the corresponding culture wells the PMMA pellets were covered with small fibroblastic TRACP positive cells Cementek®pellets were covered with both numerous large purple TRACP positive cells and small fibroblastic TRACP positive cells Cementek®/chitosan pellets almost no TRACP positive cells were observed suggesting that almost all the cells observed in LIVE/DEAD cell fluorescence assay were TRACP negative.

34. TRACP activity on Cementek®, Cementek®/chitosan and PMMA pellets with human osteoclast precursors cultured for 7 days in the presence of rhRANK-L and rhM-CSF.

35. 4. Resorbability of the biomaterials Scanning electronic microscopy was used to look for the presence of resorption lacunae on the three biomaterial osteoclastic precursors cultured on PMMA surfaces did not differentiate into giant cells but into macrophage-like cells and no resorption pictures were observed On Cementek® surfaces, many giant cells were visualized and many resorption lacunae were observed Conversely, on Cementek/chitosan, very large and spread cells were identified but resorption lacunae were never detected

36. Scanning electron microscopy analysis of osteoclast precursors cultured for 7 days in the presence of rhRANK-L and rhM-CSF on (A,B) PMMA; (C,D) Cementek® and (E,F) Cementek®/chitosan pellets.

37. 5. TRACP gene expression analysis The expression of TRACP gene by the osteoclastic precursors assessed using real-time qPCR TRACP expression was decreased for the cells cultured on Cementek® and Cementek®/chitosan compared to plastic TRACP expression level was more markedly down regulated in the cells cultured on PMMA These results strongly suggest that the inhibition of TRACP activity that we observed on Cementek®/chitosan compared to Cementek®did not result from an inhibitory effect at a transcription level but might result from an inhibition of the enzymatic activity of the TRACP protein.

38. qPCR analysis of TRACP gene expression. Comparative analysis from RNA expressed by human primary osteoclast precursor cells cultured on PMMA, Cementek®, Cementek®/chitosan and plastic

39. ETHICS Use of animals & animal’s products in Experiment FDA and GLP

40. CONCLUSION The presence of chitosan resulted in the inhibition of the cell resorption of the composite It resulted in the dramatic inhibition of the TRACP enzymatic activity of the cells attached on the composite biomaterial compared to the cells attached on the cement alone Based on these results one can suggest that this property of chitosan may be involved in its positive influence on bone formation observed by other investigators in vivo

41. Q: Does chitosan has any immunolgical effect and can we use it with every hydroxyapetite implant?A: Chitosan is a non-toxic,immune enhancing antimicrobial and wound healing properties but physically it would be improper to use in the areas where it receives a lot of force because it has low physical properties

42. QUESTIONS