1. METU-Plant Mol Biol & Gen
Middle East Technical University
Mahinur S. Akkaya
akkayams@metu.edu.tr

2. METU-Plant Mol Biol & Gen
Effector-triggered immunity
Catanzariti et al. 2007
2nd
International Stripe Rust Symposium Izmir, 28 April-1 May 2014

3. Predicted secreted effectors of cDNA library of Pst haustoria (Yin et al., 2009)
METU-Plant Mol Biol & Gen
2nd
International Stripe Rust Symposium Izmir, 28 April-1 May 2014

4. Pstha2a5 gene motif region
MEME Suite GLAM2 of putative and predicted effector candidates
METU-Plant Mol Biol & Gen
2nd
International Stripe Rust Symposium Izmir, 28 April-1 May 2014

5. Pstha2a5 gene synthesis and pJL48-TRBO cloning
PCR
METU-Plant Mol Biol & Gen
2nd
International Stripe Rust Symposium Izmir, 28 April-1 May 2014

6. METU-Plant Mol Biol & Gen
Interacting host proteins
Tagged protein co-immunoprecipitation
METU-Plant Mol Biol & Gen

7. PstHa2a5 interacts with Ta-Glox
METU-Plant Mol Biol & Gen

8. PstHa2a5 facilitates ETS
Pieterse et al. 2009
METU-Plant Mol Biol & Gen

9. METU-Plant Mol Biol & Gen
Subcellular localization
PCR
Flag-Tag Linker
CACCATGGACTACAAGGACGACGATGACAAAGTCAAGCTTCTCGAGAATTCCttcaagtgtcccggtttgcatggaacgccaagcc
aaacacatggttattgcaccagatcaatcaccgatgaagaacgaaaggcaaaaaagattggcaaggagttcaccatgtggaaggaa
gaaatcaagacagtcgacgggaaattctcgtgtgataaagtggacttgaatgggtcggttgccacagatagcttctgttgtgacgt
tgcaggtagaattggtgaagttgagaaaagtaaacaagctatgtggacaaacaactgctccaaagcatcttag
METU-Plant Mol Biol & Gen
2nd
International Stripe Rust Symposium Izmir, 28 April-1 May 2014

10. METU-Plant Mol Biol & Gen
Gateway cloning
METU-Plant Mol Biol & Gen
2nd
International Stripe Rust Symposium Izmir, 28 April-1 May 2014

11. METU-Plant Mol Biol & Gen
GFP & RFP expression
GFP and FLAG-RFP expression in Nicotiana benthamiana, 3-day post infiltration. In picture A and B, leaves
infiltrated with Agrobacterium containing pJL48-TRBO-GFP were shot under GFP fluorescence filter at 40X and
10X magnifications, respectively. Pictures D and E were taken using RFP fluorescence filter, and leaf
infiltrated with Agrobacterium with pJL48-TRBO-FLAG-RFP was shot under 40X and 10X magnifications,
respectively. In controls, non-infiltrated (normal) leaf was shot in picture C and F under GFP and RFP
fluorescence filter, respectively, at 40 X magnifications.
METU-Plant Mol Biol & Gen

12. Subcellular localizations
Subcellular localization studies can assist in determining the classification of a particular protein
and it can give more information about its possible function.
2nd
International Stripe Rust Symposium Izmir, 28 April-1 May 2014

13. Predicted secreted effectors of cDNA library of Pst haustoria (Yin et al., 2009)
METU-Plant Mol Biol & Gen
2nd
International Stripe Rust Symposium Izmir, 28 April-1 May 2014

14. METU-Plant Mol Biol & Gen
Subcellular localization of PstHa12h2
for their growth and optimization of these conditions is very hard. For visualizaton, two days
post inoculation leaves were cut from infiltration sites and they were analyzed with light
microscope and confocal microscope which is shown in Figure 3.6.
Figure 3.6 Imaging of Pstha12h2 effector protein subcellular localization in Nicotiana
benthamiana. In this part, imaging was performed with 2 dpi leaves samples magnification.
Subcellular localization was detected by GFP tagged transiently protein expression encoded by
PstHa12h2. A) and B) Observation was conducted by light microscope (Leica, DFC 280) with
GFP filter in 40X magnification. C) 40 X magnification with GFP filter of confocal microscope
(Zeiss, LSM 500) was used for imaging. D) Non-infiltrated leaf was analyzed at 40 X
magnification of light microscope with GFP filter.
B
D
A
C
METU-Plant Mol Biol & Gen
2nd
International Stripe Rust Symposium Izmir, 28 April-1 May 2014

15. METU-Plant Mol Biol & Gen
pEDV6: Effector detector vector
pEDV6 (Effector Detector Vector) is a Gateway
destination vector which is designed for delivering
bacterial effectors to the wheat by using TTSS of
Pseudomonas to activate plant defense system.
METU-Plant Mol Biol & Gen
2nd
International Stripe Rust Symposium Izmir, 28 April-1 May 2014

16. METU-Plant Mol Biol & Gen
Avr?
Figure 3.15 Photos of HR symptoms on infiltrated wheat line, Siete Cerros T66. (a)
Infiltrated primary leaf sample (b) Secondary leaf of the same leaf sample (c) Control
(MgCl2 infiltration)
3.4. Cloning into pK7FWG2 expression vector
(a) (b) (c)
PstHa15N21 / Siete Cerros
METU-Plant Mol Biol & Gen
2nd
International Stripe Rust Symposium Izmir, 28 April-1 May 2014

17. METU-Plant Mol Biol & Gen
Pst-78:Determination of candidate effector proteins
• PST-78 (gene, protein and transcript) sequences downloaded
from Broad Institute
• 20482 protein and 19542 gene in total are investigated
• Filtration of big proteins ( >150 a.a)
• SignalP analysis to select secreted proteins
• Cysteine count to first-rate Cyc rich proteins
• Multiple motif search
• The proteins are proved not to share any sequence similarity to
known proteins through BLAST
• Besides the motifs, high sequence similarity between the
proteins are found
METU-Plant Mol Biol & Gen
2nd
International Stripe Rust Symposium Izmir, 28 April-1 May 2014

18. METU-Plant Mol Biol & Gen
22 are identified as a specific type of effectors
METU-Plant Mol Biol & Gen
2nd
International Stripe Rust Symposium Izmir, 28 April-1 May 2014

19. Function
METU-Plant Mol Biol & GenMETU-Plant Mol Biol & Gen
2nd
International Stripe Rust Symposium Izmir, 28 April-1 May 2014

20. • Bayantes Dagvadorj
• Ahmet Çağlar Özketen
• Ayşe Andaç
• Kübra Narcı
• Burak Demıralay
• Osman Tolga BOZKURT (former PhD student)
Sainsbury Lab
• Hasan Ogul
Baskent University, Computer Science
• Tolga Can
METU, Computer Science
• Dr. Xianming CHEN
• Lesley BOYD
• Mogens Hovmoller
METU-Plant Mol Biol & Gen
ACKNOWLEDGEMENT
Supported by
•DPT
•ICGEB
•TUBITAK
2nd
International Stripe Rust Symposium Izmir, 28 April-1 May 2014