1. The DNA metabarcoding approach
for analyzing environmental
samples: high throughput plant and
animal identification
Pierre Taberlet, Eric Coissac, François Pompanon,
Johan Pansu, Wasim Shehzad, Tiayyba Riaz
Laboratoire d'Ecologie Alpine, CNRS UMR 5553
Université Joseph Fourier, Grenoble, France

2. Need for high throughput
collection of biodiversity data
• For research
• For management
At the moment, no
possibilty to use satellites
for identifying taxa and
collecting biodiversity data.
Why not using DNA
metabarcoding?
NASA Earth Observing System: Terra Satellite Platform

3. Our goal: a new high throughput
approach for obtaining
biodiversity data
(based on the DNA-barcoding concept, and
using next generation sequencers)
• A single sampling in the field
• Simple and robust metabarcoding
experiments at the bench
• Complete biodiversity assessment at
the sampling site

4. Environmental DNA (eDNA)
• Environmental DNA refers to DNA that can be
extracted from air, water, or soil, without isolating
any specific type of organism beforehand
• Two types:
– intracellular eDNA
– extracellular eDNA
• Intracellular eDNA commonly used by
microbiologists
• We focus on extracellular eDNA

5. Constraints of working with
environmental DNA
• Complex mixture containing degraded DNA
• The eDNA extract must be representative of the local
biodiversity
• The standard DNA barcodes are not optimal (they are by
far too long to reveal the whole spectrum of biodiversity)
• The primers must be highly versatile (to equally amplify
the different target DNAs)
• Problem of the taxonomic resolution when using very
short barcodes
• At the moment, problem of the reference database when
using non-standard barcodes

7. "Roche Noire" experiment
in French Alps
• Four plant communities
– dry high alpine meadows dominated by Kobresia myosuroides
– low alpine meadows dominated by Carex sempervirens
– subalpine heath dominated by Vaccinium sp.
– subalpine grasslands dominated by Festuca paniculata
• Three plots per plant community (12 plots)
• Two soil samples per plot (with 80 cores per sample)
• Two DNA extractions per sample
• Two DNA amplifications per extraction

8. "Roche Noire" experiment in
French Alps
80 soil cores per sample
10m
● Extraction of extracellular DNA from kilograms of soil using a phosphate buffer
● DNA amplification of the P6 loop of the chloroplast trnL (UAA) intron
● Sequencing on the 454

13. "Roche Noire" experiment: projections
of a between class analysis
Axe 2 (15.4%) Axe 3 (13.2%)
Axe 1 (18.9%) Axe 2 (15.4%)
Carex
Festuca
Kobresia
Vaccinium
A B
Taberlet P, Prud'homme S, Campione E, et al. (2012) Extraction of extracellular DNA from large
amount of soil for metabarcoding studies. Molecular Ecology, 21, in press.
doi: 10.1111/j.1365-1294X.2011.05317.x.

14. Simple and robust
metabarcoding experiments
• In silico analysis: design and test of short
metabarcodes (ecoPrimers, ecoPCR)
• Empirical experiments
– DNA amplification with barcode primers
– Sequencing of the PCR products on next generation
sequencers
• Sequence analysis
– OBITools (www.prabi.grenoble.fr/trac/OBITools)
Ficetola GF, Coissac E, Zundel S, et al. (2010) An in silico approach for the evaluation of DNA
barcodes. BMC Genomics, 11, 434.
Riaz T, Shehzad W, Viari A, Pompanon F, Taberlet P, Coissac E (2011) ecoPrimers: inference of
new DNA barcode markers from whole genome sequence analysis. Nucleic Acids Research,
doi:10.1093/nar/gkr1732.

15. A collection of metabarcoding primers
Taxonomic group Gene Length Accuracy (Bs)
Angiosperms/Gymnosperms cpDNA trnL intron 10-100 bp Genus/Species
Poaceae ITS1 54-88 bp Species
Fungi ITS1 ~ 200 bp Species ?
Vertebrates mtDNA 12S V05 76-110 bp Genus/Species
Teleost fishes mtDNA 12S 60-70 bp Species
Batrachia mtDNA 12S ~ 42-57 bp Species
Earthworms mtDNA 16S (ewB/ewC) ~ 30 bp Species
Earthworms mtDNA 16S (ewD/ewE) ~ 70 bp Species
Oligochaetes mtDNA 16S (ewB/ewE) ~ 120 bp Species
Arthropods/Mollusks mtDNA 16S 35-40 bp Family/Genus
Termites mtDNA 12S ~ 30 bp Species ?
Termites mtDNA 12S ~ 70 bp Species ?
Collembola mtDNA 12S 39-44 bp Species ?
Collembola mtDNA 12S 125-138 bp Species ?
More information soon on www.metabarcoding.org

16. Earthworms from soil DNA
• Eight soil samples collected per plot
• Universal short metabarcodes for earthworms
• Reference database built using samples identified with the
standardized COI barcoding approach
• Sequencing on Illumina GA IIx
d e
b c
mtDNA 12S
30 bp 70 bp

17. Earthworms from soil DNA: results
Chartreuse Grenoble
Species Barcode Plot 1 Plot 2 Plot 1 Plot 2
Aporrectodea icterica catcttaatgaagactaaaacttcactaaa 836954 649677 834031 1359355
Aporrectodea longa tattttaacaaaaacccaaaaattttcaataaa 2 6 244463 271829
Aporrectodea sp cattttaataaaaattataaattttactaaa 0 0 236024 236678
Octolasion cyaneum cattttaatagaagcttactattctaataaa 468462 3823 0 2
Lumbricus terrestris aatttaaataaatataaaaaatttactaaa 0 0 174286 143682
Octolasion tyrtaeum cattttaatagaaaaataatatcctaataaa 306476 0 0 2
Lumbricus castaneus aatttaaataaatataaaaaaatttactaaa 0 0 56 131001
Aporrectodea longa tattttaacaaaacccaaaaattttcaataaa 2469 105312 159 145
Allobophora chlorotica cattttaataaagatataaactttactaaa 0 0 51953 43196
Aporrectodea caliginosa tattttaataaaaaaatataaatttttaataa 0 23005 0 0
number of sequence reads
Bienert R, de Danieli S, Miquel C, Coissac E, Poillot C, Brun JJ, Taberlet P (2012) Tracking
earthworm communities from soil DNA. Molecular Ecology, 21, in press.

18. Current limitations of the PCR-
based approach
• Dependency on PCR
– Amplification introduces errors
– Difficulty to find suitable barcodes
– Different groups of organisms are analyzed
separately
• Lack of comprehensive taxonomic reference
databases for non-standard metabarcodes
• Limitations linked to the use of organellar
markers

19. Future: capture
• Easier to find a single
conserved region for designing
the probe for the capture than
two close conserved regions for
PCR
• ecoProbes: computer program
for designing suitable probes
(comparable to ecoPrimers)
• Possibility to use hundreds of
probes at the same time
• Both organellar and nuclear
DNA can be analyzed at the
same time
e.g. Briggs AW, Good JM, Green RE, et al. (2009) Targeted retrieval and analysis of five Neandertal
mtDNA genomes. Science, 325, 318-321.

20. An idea of the HiSeq 2000
production per run
• 6 billions of reads of 100 bp
• 6 lines per read
• 55 lines per page (time 11)
• 654 545 454 pages
• 194 400 km long
• 70.5 km high
• more than 3,000 tons of
paper

21. Future: shotgun sequencing
• Shotgun sequencing of soil extracellular
DNA on HiSeq 2000
• We do not know the percentage of
informative reads
• Might allow to use the standard barcode
reference libraries
• Real bioinformatics challenge
• Ongoing experiments…

22. Acknowledgements
Rike Bienert, Kari Anne Bråthen, Christian Brochmann, Anne Krag Brysting, Etienne
Campione, Corinne Cruaud; Francesco de Bello, Tony Dejean, Mary Edwards,
Francesco Ficetola, Frédérick Gavory, Ludovic Gielly, James Haile, Christelle Melo de
Lima, Christian Miquel, Stéphanie Pellier-Cuit, Sophie Prud'homme, Delphine Rioux,
Julien Roy, Jorn Henrik Sønstebø, Wilfried Thuiller, Alice Valentini, Eske Willerslev,
Patrick Wincker, Nigel Yoccoz

23. Thank you for
your attention
Contacts: eric.coissac@inria.f; pierre.taberlet@ujf-grenoble.fr
Molecular Ecology will publish in 2012 a special issue on Environmental DNA