1. A Partial Knockout of the Chondroitin Sulfate Proteoglycan 4 Gene Slows Growth in
Melanoma Tumor Cells
Abhinav Bhaskar, Matthew A. Price§, James B. McCarthy§
§Department of Laboratory Medicine and Pathology, University of Minnesota, Minneapolis 55455
Introduction
Methods
Conclusions
References
Results
Making the 1205Lu 2.4F6 cell line: CRISPR gRNA’s were designed to
remove the CSPG4 gene. The targets sequences are 5’
CGAGCGCGGCTCTGCTCCTG 3’ and 5’AGAGACCTGGAGACACCAGG 3’. These
sequences, combined with a plasmid containing the cas 9 gene and a
plasmid with puromycin drug resistance were transfected into the
metastatic melanoma cell line 1205Lu. Individual cells were isolated and
grown up in puromycin containing media. These clonally derived cells were
then screened for CSPG4 expression by western blot and CRISPR deletion
of the CSPG4 gene by PCR.
Polymerase chain reaction (PCR): Genomic DNA was isolated from the
individual cloned cell lines using the PureLink genomic DNA kit (Invitrogen).
Genomic DNA was amplified using the Platinum Pfx DNA Polymerase kit
(Invitrogen). The genomic DNA (1μg) was combined with 1x amplification
buffer, 1x enhancer solution, 1mM magnesium sulfate, 10mM dNTP
mixture, and Pfx polymerase. The reactions were run for 35 cycles (94oC
30sec, 55-60oC 30sec, 72oC 1min). Primers that are on either side of the
CRISPR cut sites in the CSPG4 gene were used to amplify a short DNA
fragment that would only appear if the CSPG4 gene had been removed. The
primer sequences are 5’ GGGCCCTTTAAGAAGGTTGA 3’ and
GTTTTGACAGCCCAAACCAG.
Western Blot: Cells were rinsed with 1x PBS solution and treated with
250μl of RIPA lysis buffer(50mM Tris HCL pH 8.0, 150mM NaCl, 1% NP-40,
0.5% sodium deoxychlorate, 0.1% SDS, protease inhibitor, and 100 mM
sodium orthovandate). Equal amounts of protein were run on a 7.5%
acrylamide gel and transferred to PVDF membrane. The blot was blocked
with PBS w/ 0.1% tween-20 and then incubated with antibodies against
CSPG4 (9.2.27) and Tubulin (Calbiochem). The blot was developed using
goat-anti-mouse secondary antibody and enhanced chemoluminescence
reagents.
2D Growth Assay: Cells were released with Trypsin EDT-1 in order to
detach them from the flask and centrifuged at 500rpm for 5 minutes. Only
non-confluent cells were used. Concentrations in both cell lines were
recorded using an equal volume of Trypan Blue as well as a cell counter. An
original concentration of 5000 cells/mL of CSPG4 was taken along with
10mL of 2x growth media and placed into a 96 microwell plate which had
12 replicates per cell line. An MTS reagent was added to the wells, and was
incubated for a period of 7 days. The number of cells was observed by
measuring the OD number, which directly relates the number of cells to
the amount of 495 nm wavelength of light the cells absorb. The absorbance
rate was measured on day 2, 5, and 7. The Graphpad Prism software was
then used for statistical analysis.
Figure 4: 1205Lu 2.4F6 cells
demonstrated reduced
colony growth in a 3
dimensional growth assay..
The 3D Soft Agar growth
assay was used to
determine the rate of
anchorage-independent
growth for colonies in both
the 2.4F6 cell line, as well as
the 1205Lu parental cell
line. The data were graphed
+/- S.E. In all trials. A
statistical difference in the
colony growth was observed
where the 2.4F6 cell line
showed decreased growth
when compared to the
parental cell line over a time
period of 14 days.
*=p <.005 by student’s t-
test.
Figure 3: Cell line 1205Lu 2.4F6 grew
slower over a period of 7 days when
compared to the parental cell line
1205Lu Parent. Results were
measured on day 2, day 5, and day 7
as shown by measuring the OD
number. The OD number directly
correlates to the number of cells by
measuring the absorbance rate of
495nm wavelength of light. A higher
OD level signifies a higher count of
cells. Data from the 12 replicate wells
were graphed +/- S.E. Data showed a
statistical difference in the growth of
the two cell lines on both day 5 and
day 7 (p<.001 by student’s t-test).
Chondroitin sulfate proteoglycan 4 (CSPG4) is a transmembrane
proteoglycan which is associated with melanoma tumor formation and
poor prognosis in certain melanoma strains, as well as other cancer
types1. CSPG4 is involved in tumor cell growth, survival, and motility
(movement)1. The CRISPR–cas9 method can be used to target a gene
and cleaves that gene in the cell, removing it from the chromosome1.
In the current studies a CRISPR-cas9 method was employed in order to
create a knockout of the CSPG4 gene in the metastatic melanoma cell
line 1205Lu. A clonally derived 1205Lu mutant with decreased CSPG4
expression was used to analyze the haploinsufficiency of CSPG4 in
tumor cell growth (haploinsufficiency is generally described as an
organism with two copies of a gene in a cell has only one functional
copy of the gene). The cell line, 1205Lu 2.4F6, was found to contain a
partial knockout of the CSPG4 gene. Through the study, it is possible
to conclude that the 2.4F6 cell line experienced a partial knockout of
the CSPG4 gene and also experienced a slower rate of growth when
compared to the 1205 Lu parental cell line.
1Matthew A Price, Leah E Colvin Wanshura, Jianbo Yang, Jennifer Carlson, Bo
Xiang, Guiyuan Li, Soldano Ferrone, Arkadiusz Z. Dudek, Eva A. Turley, and
James B. McCarthy, CSPG4, a potential therapeutic target, facilitates malignant
progression of melanoma. PMC 2012.
• Expression of the CSPG4 gene was noticeably different after the CRISPR-cas9
technique was used as opposed to the parental tumor cell line. However, it was still
expressed to a certain degree. Thus, we believe we have produced a partial
knockout of the gene.
• The results from the PCR support the findings that the gene in the cell was at least
partially removed via the CRISPR-cas9 technique.
• CRISPR-cas9 procedure has reduced levels of both the protein in the cell as a result
of cleaving the CSPG4 gene in the cell as seen in the western blot, causing less
proteins to be created in turn and expressed.
• The 2.4F6 cell line appears to be haploinsufficient in the case of the CSPG4 gene
based on the evidence that a reduced expression of the gene was observed in both
the 2D and 3D growth assays.
• The CRISPR-cas9 technique is useful in producing knockouts as a gene and may be
utilized as a potential means for studying how the expression of genes affects cells.
• Lower levels of CSPG4 expression in the cell may lead to lower tumor growth as well
as motility and lower survival in the cell. Because CSPG4 directly or indirectly
enhances multiple signaling pathways in tumors, a lower expression of this gene will
limit the tumor cell’s ability to function and use oncogenic pathways.
Acknowledgements
Figure 2: The 2.4F6 cell line showed higher levels of
the CSPG4 Protein when compared to the parental cell
line, while maintaining levels of tubulin in the cell. The
western blotting technique was used to show the
expression of protein in the cell. A western blot with a
7.5% acrylamide gel and a 4% stacking gel was used
during gel electrophoresis, which moved the proteins
from the negative to positive poles based on their size
in bps. The results showed a lower level of expression in
the 2.4F6 cell line when compared to the 1205Lu
parental cell line. Tubulin, which was used as a loading
control in this experiment, was also measured in order
to ensure a lack of bias when loading the samples, as
well as to make sure that an equal concentration of
protein from each sample was loaded onto the gel .
*
Figure 1: Bands of the 2.4F6 cell line show that the
CRISPR-cas9 method was effective in cleaving the
CSPG4 gene. The Polymerase chain Reaction
(PCR)was used in order to verify that the gene of
interest was indeed cleaved. The gel was run under
three different temperature gradients in order to
optimize the Primers which were used to amplify
the gene of interest during the annealing period. As
shown in the results, a band of approximately 300
bps appears in the 2.4F6 column under 55oC which
shows that copies of the CSPG4 gene were cleaved.
It also shows that the DNA Polymerase was most
effective at the 55oC temperature in the annealing
process, which is why there is no band for the other
temperatures.
Soft Agar 3D Growth Assay: A 1% and 0.3%
Agarose solution was prepared for each cell line.
Cells were then released from flasks with Trypsin
EDT-1 to detach them from the flask. Only non-
confluent cells were used. Cells were then
aliquoted to a centrifuge tube and centrifuged at
500rpm for 5 minutes and then resuspended in 2x
media. Concentrations of cells in both cell lines
were recorded using an equal volume of Trypan
Blue and a cell counter. A total of 10,000 cells
were needed per well as well as 4mL of 0.3%
agarose solution and 3.9mL of 2x media. The 1%
agarose was plated in a 6 well tray and allowed to
cool.
The cells of each cell line were then plated
along with the 0.3% agarose. Each cell line was
plated in 3 wells. The plates were then
incubated for a period of 14 days. After the
incubation period, the tray was taken out. A
sample of 5 random areas on each well was
taken, and the number of colonies that formed
on each area was recorded. Colonies were
defined as those which exceeded 50 mm in
length or width. This process was repeated
one more time in order to gain reliable results.
Statistical analysis was then performed using
the Graphpad Prism software.
I would like to thank the McCarthy Laboratory for giving me the wonderful
opportunity to work in their lab as well as for providing me with their space,
materials, and time for this project.
I would also like to thank Honors Mentor Connections through district 287, and its
program leader, Dr. Dorothy Welch for giving me the opportunity to interview such
iimportant people and professors such as Dr. McCarthy as well as making this
project and other projects like mine possible through their hours of hard work.