2012 12 02_epigenetic_profiling_environmental_health_sciences
•
1 gostou•1,007 visualizações
Epigenetics in Evironmental Health Sciences
Recomendados
Recomendados
Mais conteúdo relacionado
Mais procurados
Mais procurados (20)
Destaque
Destaque (9)
Semelhante a 2012 12 02_epigenetic_profiling_environmental_health_sciences
Semelhante a 2012 12 02_epigenetic_profiling_environmental_health_sciences (20)
Mais de Prof. Wim Van Criekinge
Mais de Prof. Wim Van Criekinge (20)
Último
Último (20)
2012 12 02_epigenetic_profiling_environmental_health_sciences
- 1. Slides available www.bioinformatics.be 4th December 2012 Johns Hopkins Bloomberg School of Public Health
- 2. Lab for Bioinformatics and computational genomics 10 “genome hackers” mostly engineers (statistics) 42 scientists technicians, geneticists, clinicians >100 people hardware engineers, mathematicians, molecular biologists
- 3. Can bioinformatics bridge the gap ?
- 4. The genome is just the start …
- 5. 250 different cell types Epigenetic (meta)information = stem cells
- 6. Cellular programming Epigenetic (meta)information = stem cells
- 7. Defining Epigene*cs Genome DNA § Reversible changes in gene expression/func5on § Without changes in DNA Chroma*n sequence Epigenome § Can be inherited from precursor cells Gene Expression § Allows to integrate intrinsic with environmental signals Phenotype (including diet)
- 8. DNA Methylation Differentiates Totipotent Embryonic Stem Cells from Unipotent Adult Stem Cells! Alex Meissner, Henry Stewart Talks
- 9. Reprogramming the DNA methylome Paula Vertino, Henry Stewart Talks
- 12. The epigenome is ac5onable
- 13. The epigenome is ac5onable
- 15. Epigene*c Changes are Important in Causing Cancer GENETIC EPIGENETIC Example: Example: Replica*on errors Chroma*n modifica*on errors X X Altered Altered DNA sequence chroma*n structure Oncogenesis Altered Altered levels of DNA/mRNA/proteins mRNA/proteins Tumor
- 16. Example of Methyla*on vs Muta*on: Colon & Breast Cancer 120 100 80 60 Dx 40 20 CDx 0 Methylated Mutated Source: Schuebel et al 2007 76-‐100 51-‐75 21-‐50 1-‐20
- 17. MGMT Biology O6 Methyl-‐Guanine Methyl Transferase Essen5al DNA Repair Enzyme Removes alkyl groups from damaged guanine bases Healthy individual: -‐ MGMT is an essen5al DNA repair enzyme Loss of MGMT ac5vity makes individuals suscep5ble to DNA damage and prone to tumor development Glioblastoma pa*ent on alkylator chemotherapy: -‐ Pa5ents with MGMT promoter methyla5on show have longer PFS and OS with the use of alkyla5ng agents as chemotherapy
- 18. MGMT Promoter Methyla*on Predicts Benefit form DNA-‐Alkyla*ng Chemotherapy Post-‐hoc subgroup analysis of Temozolomide Clinical trial with primary glioblastoma pa5ents show benefit for pa5ents with MGMT promoter methyla5on Median Overall Survival 25 21.7 months 20 plus temozolomide 15 12.7 months radiotherapy 10 radiotherapy 5 Adapted from Hegi et al. NEJM 2005 0 352(10):1036-‐8. Non-‐Methylated Methylated Study with 207 pa5ents MGMT Gene MGMT Gene
- 19. Profiling the Epigenome # markers Discovery Verifica5on Valida5on # samples
- 20. Genome-‐wide methyla*on by methyla*on sensi*ve restric*on enzymes
- 21. Genome-‐wide methyla*on by probes
- 22. Profiling the Epigenome By next gen sequencing # markers Discovery Verifica5on Valida5on # samples
- 23. MBD_Seq Condensed Chroma5n DNA Sheared Immobilized Methyl Binding Domain DNA Sheared
- 24. MBD_Seq Immobilized Methyl binding domain MgCl2 Next Gen Sequencing GA Illumina: 100 million reads
- 25. Kit Comparison 0.25 ● ● 0.20 ● Fraction of reads 0.15 ● 0.10 ● 0.05 ● ● ● ● ● 0.00 ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● 0 10 20 30 40 50 Number of CG's 25
- 26. MBD_Seq MGMT = dual core
- 27. Profiling the epigenome …. by next genera*on sequencing # markers 1-‐2 million MBD_Seq methyla5on cores Discovery # samples
- 28. Bock et al, Nature, 2012 Bock et al. Nature 2012 28
- 29. 29
- 30. Data integra*on Correla*on tracks expression expression Corr =-1 Corr = 1 methylation methylation 30
- 31. Correla*on track in GBM @ MGMT +1 -1 31
- 32. Next_next miRNA, (l)ncRNA, CIS/TRANS splicing, SV, fusion loci , bidirec*onal promoters ? RNA_seq: sequence RNA molecules Next Gen Pla`orm Total RNA_seq: all RNA molecules (normalisa*on procedure) Direc*onal Total RNA_seq: before amplifica*on use different 5’ and 3’ adaptors Integrated Direc*onal Total RNA_seq: Combine with other datasets eg. enrichment sequencing data, visualise and query in genome browser 32
- 33. Direc*on RNAseq bidirec*onal promoters 33
- 34. Profiling the Epigenome …. by next genera*on sequencing # markers MBD_Seq Discovery 454_BT_Seq Verifica5on Valida5on # samples
- 35. Where is the mC ? GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
- 37. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25% 50% 25% GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT
- 38. GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT 25% 50% 25% GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT GCATCGTGACTAGCGACTGATCGATGGATGCTAGCAT Dense methylated needed for transcrip5onal silencing Are there alleles with all three posi.ons methylated ?
- 39. Deep Sequencing unmethylated alleles methylated alleles less methyla5on more methyla5on GCATCGTGACTTACGACTGATCGATGGATGCTAGCAT!
- 40. Deep MGMT Heterogenic complexity
- 41. Conclusion Combina5on of different sequencing techniques is emerging as best prac5ce Bioinforma5cs is challenging § Methods for normalisa5on under construc5on § Reference databases are generated Data visualiza5on and integra5on is key 41
- 42. Slides available www.bioinformatics.be 4th December 2012 Johns Hopkins Bloomberg School of Public Health
- 43. biobix wvcrieki biobix.be bioinformatics.be 43