2. Shrishaila cd
Dept of Genetics and Plant B
DNA NANOTECHNOLOGY
SEMINAR 2
ON
Shrishaila CD(GPB) UASR
3. Introduction
History of Nanotechnology
Nano particles
Applications of Nanotechnology
DNA Nanotechnology
DNA Nano Structures
Case Studies
Applications of DNA Nanotechnology
Conclusions
Shrishaila CD(GPB) UASR
4. Nanotechnology
“Nanotechnology is the art and science of manipulating matter at
nanoscale”
‘Nano’ is a Greek word, means Dwarf
1 nm = 10ˉ⁹ m i.e. one billionth of a meter
Shrishaila CD(GPB) UASR
6. Richard Feynman,
Father of nanotechnology
Nobel Laureate(Physics)1965
Norio Taniguchi
coined the term “Nanotechnology” (1974)
Michael Faraday
1831
Shrishaila CD(GPB) UASR
8. (Royal Society and Royal Academy of Engineering, 2004)
TOP DOWN APPROACH
METHODS OF NANOPARTICLE PRODUCTION
Shrishaila CD(GPB) UASR
9. (Royal Society and Royal Academy of Engineering, 2004)
BOTTOM UPAPPROACH
Shrishaila CD(GPB) UASR
10. Properties of Nano particles
• Every substance regardless of composition exhibits new properties
when the size is reduced to nano scale
• Properties of material is changed due to quantum effect
Shrishaila CD(GPB) UASR
11. Things behave differently in nano-world
Carbon in the form of Graphite (i.e. pencil lead) is
soft, at the nano-scale, can be stronger than steel and
is six times lighter
Nano-scale copper is a highly elastic metal at room
temperature, stretching to 50 times its original length
without breaking
Shiny orange yellow Gold changes its colour to
brownish black on reducing the size
Absorption of solar radiation in photovoltaic cells is
much higher in nanoparticles than it is in thin films
of continuous sheets of bulk material
Shrishaila CD(GPB) UASR
14. In Agriculture and Allied Sciences
Food science and technology
Smart packaging with Nano silicon embedded durethan polymer to enhance
the shelf life of the food materials
Seed technology
Use of carbon Nanotubes increases the germination through better penetration
of the moisture
Soil remediation
Nanotech-based soil binder called SoilSet employed to avoid soil erosion
Water treatments
magnetite (iron oxide) nanocrystals to capture and remove arsenic from
contaminated water
Agricultural Engineering Issues
Nano coating of agricultural tools to increase their resistance against wear
and corrosion Shrishaila CD(GPB) UASR
15. Operates like human nose &Identify different
types of odours and their concentrations
e-Nose
Medicine Cancer treatment ,Bone treatment, Drug delivery
Smaller, faster, more energy efficient and
powerful computing and other IT-based systems
Information
Technology
Advanced packaging materials, sensors
and lab-on-chips for food quality testing
Foods and
beverages
Shrishaila CD(GPB) UASR
17. It is the design and manufacture of artificial nucleic acid structures
for technological uses
Also known as Nucleic Acid Nanotechnology
DNA is the carrier of Genetic information but here used as a
structural component
Shrishaila CD(GPB) UASR
18. History of DNA Nanotechnology
• 1964-Holliday Junction
• 1970-Sticky Ends
• 1980-DNA Nanotechnology
• 1991-first synthetic 3D DNA Nanostructure developed
• 1998-2D DNA Lattice
• 2006-2D DNA Origami developed
• 2009-3D DNA Origami developed
Shrishaila CD(GPB) UASR
19. DNA nanotechnology was first laid out by Nadrian C Seeman in
the early 1980s
In 1991, Seeman's laboratory published a report on the first synthetic
cube made up of DNA
Shrishaila CD(GPB) UASR
21. Why DNA IN NANO WORLD
• Basic Geometric and Thermodynamic properties of DNA are well known
and predictable by available software's like TILE SOFT, GenoCAD
• DNA’s Ladder like structure provides the key frame work to the
scientists
• Existence of commercially available modifying enzymes
• Persistent length of DNA is about 500Å
• Self assembly property of DNA makes easy to construct the variety of
structures in a predictable manner
• Shapes of DNA nanostructures can be controllable
• Synthesis of SsDNA is less expensive
• Assembled structures can be characterized by various techniques like
AFM,TEM,CryoEM
Shrishaila CD(GPB) UASR
22. Construction of DNA Nanostructures
Mainly by using the following motifs
• Stem loop(Hair pin) structure
• Sticky ends
• Holliday Junction
Shrishaila CD(GPB) UASR
23. Unpaired region occur in Ss DNA or RNA
The structure is also known as a hairpin or hairpin loop
Shrishaila CD(GPB) UASR
24. Sticky ends
• An overhang is a stretch of unpaired nucleotides in the end of a DNA
molecule
• These overhangs are in most cases Palindromic
• Sticky ends are often used to combine two DNA nanostructures
together via hybridization of their complementary SsDNA
Shrishaila CD(GPB) UASR
25. Holliday junction
• Robin Holliday proposed its existence in 1964
• Two parallel DNA helices form a junction with one strand of each
DNA helix crossing over to the other DNA helix
Shrishaila CD(GPB) UASR
27. DNA Lattice
A DNA tile is a DNA nanostructure that has a number of
sticky ends on its sides, which are termed pads
A DNA lattice is a DNA nanostructure composed of a
group of DNA tiles that are assembled together via
hybridization of their pads
Winfree, Yang and Seeman (1996) developed a family
of DNA tiles known collectively as DX tiles
Shrishaila CD(GPB) UASR
28. DNA Cube
• It is the first 3D DNA Structure
• DNA Axes connected to form the cube
• Each edge of the cube has 2 molecules
of dsDNA which are connected to
each other
• It contains 6 different strands
Shrishaila CD(GPB) UASR
29. DNA Origami
• Rothemund used the 5
SsDNA of M13 Phage 2006
• In 2009 Anderson et al.
Extended to 3D Origami
• It is the nanoscale folding
of SsDNA to create non-
arbitrary two- and three-
dimensional shapes
• SARSE software is using for
developing the structure Shrishaila CD(GPB) UASR
30. • Double cross over arrays can be
folded to form the DNA Nanotubes
• Can be made in to rings and spirals
• Potential use in the fields of
Drug delivery
Gene therapy
Electronic circuits
Shrishaila CD(GPB) UASR
31. • By shih, Quispe & joyce 2004
• By folding the five 40bp synthetic Ss DNA using a wire frame
structures
Shrishaila CD(GPB) UASR
33. Fabrication of DNA nanotubes using origami-based
nanostructures with sticky ends
Mohammad Mousavi-Khattat ,Adele Rafati ,Pooria Gill
5th February 2015
Objective:- Fabrication of DNA nanotubes using a minimum numbers of
staple oligomers for DNA origami
Shrishaila CD(GPB) UASR
40. Self-assembled aptamer-tethered DNA nanotrains for
targeted transport of molecular drugs
in cancer theranostics
Guizhi Zhu, Jing Zheng, Erqun Song, Michael Donovan, Kejing Zhang,
Chen Liu, and Weihong Tana
May 14, 2013
Shrishaila CD(GPB) UASR
41. Materials and Methods
Preparation of sgc8–NTrs and Drug Loading into Nanotrains
M1:- 5’CGTCGTGCAGCAGCAGCAGCAGCAACGGCTTGCTGCTGCTGCTGCTGC3’
M2:-5’TGCTGCTGCTGCTGCTGCACGACGGCAGCAGCAGCAGCAGCAAGCCGT3’
Sgc8 :-5’ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA3’
Sgc8–trigger
5’TGCTGCTGCTGCTGCTGCACGACGTTTATCTAACTGCTGCGCCGCCGGG3’
5 NOD.Cg-Prkdc (scid) IL2 mice were
purchased from The Jackson Laboratory and
maintained under pathogen Free conditions
Shrishaila CD(GPB) UASR
42. Guizhi Zhu et al. PNAS 2013;110:7998-8003
Shrishaila CD(GPB) UASR
43. Guizhi Zhu et al. PNAS 2013;110:7998-8003Shrishaila CD(GPB) UASR
44. Guizhi Zhu et al. PNAS 2013;110:7998-8003
Shrishaila CD(GPB) UASR
45. Guizhi Zhu et al. PNAS 2013;110:7998-8003
Shrishaila CD(GPB) UASR
46. Guizhi Zhu et al. PNAS 2013;110:7998-8003
Shrishaila CD(GPB) UASR
47. Guizhi Zhu et al. PNAS 2013;110:7998-8003Shrishaila CD(GPB) UASR
48. Guizhi Zhu et al. PNAS 2013;110:7998-8003
Shrishaila CD(GPB) UASR
50. ATOMCALLY MODIFIED ORGANISMS
In March 2004, ETC Group reported on a nanotech research initiative in
Thailand
That aims to atomically modify the characteristics of local rice varieties.
Researchers “drilled” a hole through the membrane of a rice cell in order
to insert a nitrogen atom that would stimulate the rearrangement of the
rice’s DNA.
Shrishaila CD(GPB) UASR
51. Researchers have been able
to alter the colour of a local
rice variety from purple to
green Named as BKOS6
Thai jasmine rice (Oryza sativa L.
cv.KDML 105) Rice embryos
bombarded with N++N2+ ions at
an energy level of 60 keV
and ion fluence of 2×1016
ions/cm2
Shrishaila CD(GPB) UASR
52. HAT-RAPD was applied for analysis of genomic variation in the mutant
out Of 10 primers,
two primers detected two additional DNA bands at 450 bp and 400 bp.
Indicates presence of amino acid sequence of flavanoids
Shrishaila CD(GPB) UASR
54. DNA is the best nano wire in existence
BCZ..
1. It can self assemble
2. It can self replicate
3. It can adopt various states and
conformations
Rapid Disease Detection using the DNA
Nanotubes
And Molecular treatment
Shrishaila CD(GPB) UASR
55. Wide range of uses ranging from
building blocks to robotics
DNA Robotics
Used in making much smaller microchips than
the current semiconductor fabrication
technology
DNA Nanochips
Shrishaila CD(GPB) UASR
56. DNA
Computers
DNA can be used to make
computers instead of
silicon.
• Maya-II is an example.
DNA Sensors
made to detect any metal
• Much faster than traditional test
for lead and mercury
Shrishaila CD(GPB) UASR
57. DNA
Walkers
DNA nanotechnology can be
used to create walking bipedal
nano robots
• The walkers move on a DNA
track
Protein structure determination
NANO Mosquitoes
Used in militaries
Shrishaila CD(GPB) UASR
58. NANO In INDIA
• The Department of Science and Technology has a plan called Nano
Mission. It promotes basic research, infrastructure development,
nano-applications and technology development, human resource
development, and international collaborations. And it is headed by
BHARATH RATNA Dr. C N R RAO
• The Department of Electronics and Information Technology
focuses on nano electronics and technology development and on
nanofabrication.
Shrishaila CD(GPB) UASR
59. Two centres in India focusing on development of nanotechnology were
established in
BENGALURU and MUMBAI
• India is among the top ten publishing countries in this area with rise in
9.1%in the past ten years
• In 2013 , 87 patents in nanotechnology were published by Indian assignees
Shrishaila CD(GPB) UASR
62. Conclusions
Inaugurating the Global Forum On Agricultural Research(GFAR)Triennial conference –New Delhi
2006 ,President Dr. A.P.J ABDUL KALAM Focussed on the Nanotechnology as
the new technology that must be applied in Agriculture and Food industry
Shrishaila CD(GPB) UASR