SlideShare uma empresa Scribd logo
1 de 2
DNA translation and Protein Synthesis
1. For the following strands of DNA write out the corresponding mRNA
strand.
a. TACTTCGAGTACCATATT

b. TACATGGCTAGTCTGATT

2. For the parent strand of DNA listed below write out the mRNA strand and
then the polypeptide (protein chain) encoded by the strand. (Once you
have transcribed the strand – look for the start codon, start there and
continue until there is a stop codon)

GTAGCGTACAGCTGACGAACGTGCATTGCGACG

3. For the following RNA strand – write the corresponding DNA that would
have served as a template for it.

AUGCGGUACUACGGU
4. Part of the amino acid sequence of the A chain of insulin is "glutaminecysteine-cysteine-alanine". Use the genetic code chart (Figure 17.4) to decide
which of the following DNA strands could encode this tetrapeptide.
a) 5'-CCCCCGCAGAAG-3'

b) 5'-GGCATCGTGGAG-3'

c) 5'-CAGTGCTGTGCC-3'

d) 5'-CTGCCCCGACAC-3'

e) 5'-GTCACGACACGG-3'

Mais conteúdo relacionado

Mais de sbarkanic

Physical science final exam review
Physical science final exam reviewPhysical science final exam review
Physical science final exam reviewsbarkanic
 
Electric power
Electric powerElectric power
Electric powersbarkanic
 
Ac dc and circuits
Ac dc and circuitsAc dc and circuits
Ac dc and circuitssbarkanic
 
Ohm's law worksheet ccp
Ohm's law worksheet  ccpOhm's law worksheet  ccp
Ohm's law worksheet ccpsbarkanic
 
Ohm's law's calculations
Ohm's law's calculationsOhm's law's calculations
Ohm's law's calculationssbarkanic
 
Ohm's law worksheet ccp
Ohm's law worksheet  ccpOhm's law worksheet  ccp
Ohm's law worksheet ccpsbarkanic
 
Static electricity and electrical currants
Static electricity and electrical currantsStatic electricity and electrical currants
Static electricity and electrical currantssbarkanic
 
Acid bases and nuclear review sheet
Acid bases and nuclear review sheetAcid bases and nuclear review sheet
Acid bases and nuclear review sheetsbarkanic
 
Balancing equations worksheet
Balancing equations worksheetBalancing equations worksheet
Balancing equations worksheetsbarkanic
 
Chemical reactions
Chemical reactionsChemical reactions
Chemical reactionssbarkanic
 
Naming and writing compounds and molecules
Naming and writing compounds and moleculesNaming and writing compounds and molecules
Naming and writing compounds and moleculessbarkanic
 
Bonding practice
Bonding practiceBonding practice
Bonding practicesbarkanic
 
Atomic spectrum
Atomic spectrumAtomic spectrum
Atomic spectrumsbarkanic
 

Mais de sbarkanic (20)

Physical science final exam review
Physical science final exam reviewPhysical science final exam review
Physical science final exam review
 
Newton
NewtonNewton
Newton
 
Waves
WavesWaves
Waves
 
Electric power
Electric powerElectric power
Electric power
 
Ac dc and circuits
Ac dc and circuitsAc dc and circuits
Ac dc and circuits
 
Ohm's law worksheet ccp
Ohm's law worksheet  ccpOhm's law worksheet  ccp
Ohm's law worksheet ccp
 
Ohm's law's calculations
Ohm's law's calculationsOhm's law's calculations
Ohm's law's calculations
 
Ohm's law worksheet ccp
Ohm's law worksheet  ccpOhm's law worksheet  ccp
Ohm's law worksheet ccp
 
Ohm's law
Ohm's lawOhm's law
Ohm's law
 
Static electricity and electrical currants
Static electricity and electrical currantsStatic electricity and electrical currants
Static electricity and electrical currants
 
Acid bases and nuclear review sheet
Acid bases and nuclear review sheetAcid bases and nuclear review sheet
Acid bases and nuclear review sheet
 
Balancing equations worksheet
Balancing equations worksheetBalancing equations worksheet
Balancing equations worksheet
 
Chemical reactions
Chemical reactionsChemical reactions
Chemical reactions
 
Naming and writing compounds and molecules
Naming and writing compounds and moleculesNaming and writing compounds and molecules
Naming and writing compounds and molecules
 
Bonding practice
Bonding practiceBonding practice
Bonding practice
 
Atomic spectrum
Atomic spectrumAtomic spectrum
Atomic spectrum
 
Rutherford
RutherfordRutherford
Rutherford
 
Meinter
MeinterMeinter
Meinter
 
Gell mann
Gell mannGell mann
Gell mann
 
Democritus
DemocritusDemocritus
Democritus
 

Dna translation and protein synthesis

  • 1. DNA translation and Protein Synthesis 1. For the following strands of DNA write out the corresponding mRNA strand. a. TACTTCGAGTACCATATT b. TACATGGCTAGTCTGATT 2. For the parent strand of DNA listed below write out the mRNA strand and then the polypeptide (protein chain) encoded by the strand. (Once you have transcribed the strand – look for the start codon, start there and continue until there is a stop codon) GTAGCGTACAGCTGACGAACGTGCATTGCGACG 3. For the following RNA strand – write the corresponding DNA that would have served as a template for it. AUGCGGUACUACGGU
  • 2. 4. Part of the amino acid sequence of the A chain of insulin is "glutaminecysteine-cysteine-alanine". Use the genetic code chart (Figure 17.4) to decide which of the following DNA strands could encode this tetrapeptide. a) 5'-CCCCCGCAGAAG-3' b) 5'-GGCATCGTGGAG-3' c) 5'-CAGTGCTGTGCC-3' d) 5'-CTGCCCCGACAC-3' e) 5'-GTCACGACACGG-3'