2013 International Symposium on Ranaviruses by Matthew Allender

1. Chelonian
Diagnostics,
Pathology, and
Treatment
Matt Allender, DVM, MS, PhD, Diplomate ACZM
Ranavirus Symposium
July 2013
@Turtle_Doc
#RV13

2. Ranavirus epidemiology
 Disease events are often clustered in local epizootics
 Some occur on annual basis
 Several sources report a significant threat to
biodiversity
 Population density mortality in salamander studies
 Environmental factors change prevalence
 Restoration efforts

4. Quantitative PCR
 TaqMan primer-probes were designed using Primer
Express targeting a portion of the MCP that was
contained within the 531 bp product
 Forward: AACGCCGACCGAAAACTG
 Reverse: GCTGCCAAGATGTCGGGTAA
 Probe: CCGGCTTTCGGGC
 Resultant segment was a 54 bp product

5. Conventional PCR
Level of Detection:
529,000 viral
copies
52 viral copies
Quantitative PCR

7. Epidemiologic evidence
Category Institution FV3 positive FV3
negative
Prevalence 95% CI
Free-living* OR
1 308 0.3% 0 – 1.8 %
Rehabilitation* 7 217 3.13% 1.5 – 6.3%
UT 3 35 7.9% 2.7 – 20.1 %
WCV 2 120 1.6% 0.4 – 5.9 %
NCSU 0 46 0.00% 0 – 7.7 %
AWC 2 14 14.3% 4.0 – 39.9 %
UGA 0 9 0.00% 0 – 29.9 %
Total 8 525 1.5% 0.8 – 2.9%
* Significant difference between prevalence in free-living population and
rehabilitation populations, p=0.01, one-tailed

8. Results
Variable FV3 positive FV3 negative Prevalence 95% CI
Female 3 168 1.8 % 0.6 – 5.0 %
Male 0 218 0.00% 0 – 1.7 %
Adult 2 398 0.5 % 0.1 – 1.8 %
Juvenile 2 55 3.5 % 0.9 – 11.9 %
Sex: p=0.157, observed power = 0.73
Age: p=0.081, observed power = 0.91

9. Housing
 Environmental chamber within Division of Animal
Resources at UI-CVM
 15’9” x 12”
 Temperature was acclimated for 1 week prior to
beginning study
 Recorded daily and maintained +/- 1°C throughout
duration of study
 Adult female red-eared sliders maintained in 45 or 50
gallon plastic enclosures with ~20 gallons freshwater
and basking spot

10. Virus
 Ranavirus isolated from infected eastern box turtle
 100% sequence homology to MCP of FV3
 Grown to confluence in TH-1
 Divided into aliquots of 5 x 105 TCID50
 Quantitative PCR performed on virus
 Four animal in each temperature group were
administered 1 aliquot (0.67 ml) in the right forelimb
muscle
 Uninfected controls administered same volume crude
cell lysate

11. Sample collection
 Weight, whole blood, oral and cloacal swabs collected
twice prior to inoculation to confirm negative status, then
twice weekly throughout duration of study
 PCV, TS, WBC, differential performed each sample
 Clinical signs were recorded daily
 Animals were euthanized when clinical signs were
severe (as described in IACUC) or at 30 days post-
inoculation
 Control animal was euthanized at same time as inoculated
animal
 Gross necropsy performed within 48 hours
 Histopathology of 8 tissues
 qPCR of necropsy tissues

12. Results
 Survival
 22°C – all inoculated turtles
were euthanized due to
severity of signs
 28°C – only 2 turtles were
euthanized due to clinical
signs
 One uninfected control
died of sepsis
 Median survival times
 22°C = 24 days (14 -30)
 28°C = 30 days (17-30)
22C
28C

13. Results
 *Significant increase over time (F=11.1, p=0.045)
 Significant difference between control and inoculated turtles
(p=0.035)
 #Significant increase over time (F=7.13, p=0.026)
Time 22°C
Weight
28°C
Weight
Pre-inoculation 1693.5625* 2063.1250#
Initial post-
inoculation
1692.50* 2082.50#
Terminal 1802.50* 2159.50#

17. Results
Tissue Parameter 22C
Viral Copies
28C
Viral Copies
Tongue Mean/median* 1.25 x 109* 5.94 x 106*
Skeletal
Muscle
Mean/median* 3.7 x 1010* 3.64 x 108*
Lung Mean/median* 6.29 x 109* 5.01 x 109*
Heart# Mean/median* 2.92 x 1010 1.27 x 109*
Liver^ Mean/median* 2.15 x 109 1.70 x 107*
Spleen Mean/median* 2.23 x 1010* 5.44 x 107*
Ovary Mean/median* 8.93 x 109* 9.06 x 106*
Kidney Mean/median* 3.46 x 1010* 2.54 x 108*
# Significant difference between environmental temperatures, p=0.012
^ Significant difference between environmental temperatures, p=0.011

18. Results

19. Temperature evidence
 Mortality
 22°C
 Significant association between inoculation and disease
(p=0.014)
 28°C
 No significant association between inoculation and
disease (p=0.214)
 Non-significant mortality was seen at lower
temperature (100%) than higher temperature (50%)
 Power = 0.34

20. Temperature evidence
 qPCR
 Viral copies quickly went from undetectable to
millions/billions of copies
 All positive turtles had between 2 and 4 positive samples
prior to death
 Highest in whole blood, lowest in cloacal swab (non-
significant) at 22°C
 Specificity and Sensitivity
 Whole blood
 100% specific and 100% sensitive
 Oral swab and cloacal swab
 100% specific and 83% sensitive

22. Results

25. Conclusions
 Prevalence in surveys of free-ranging populations are
low
 Are chelonians a spill-over host?
 Natural history characteristics make it difficult to identify
mortality events?
 Are chelonians a reservoir host and fail to develop signs?
 Are mechanisms of transmission different in chelonians
which provide natural protection?

26. Conclusions
 Environmental temperature leads to differences in
mortality in red-eared sliders
 Both host and pathogen factors that may lead to
protection at higher temperatures
 May play a role in persistence or transmission
 Do other species have similar response to changes in
temperature?
 Opportunity for therapeutic intervention

27. Funding Sources
 Morris Animal Foundation
 qPCR development and prevalence study
 CRESO
 Prevalence study
 Fluker’s Farms/Cox Pharmacology lab
 PK study

28. Questions?