2. What is a primer?
A primer is a short synthetic oligonucleotide which is used in many
molecular techniques. These primers are designed to have a sequence
which is the reverse compliment a region of template or target DNA to
which we wish the primer to anneal.
3’ 5’
TGACCTGAAAAGAC Primer
GATGGACTGATTACCGATGACTGGACTTTTCTG Template
5’ 3’
3’ 5’
TGACCTGAAAAGAC
:: ::: : : : : : : : :
GATGGACTGATTACCGATGACTGGACTTTTCTG Annealing
5’ 3’
05/15/12 NBFGR karan veer singh
4. Diagram for PCR Primer
Design
Sequence from
which to choose
primers
Results of search,
PCR reaction including suggested
parameters Primer annealing temperatures
Design shown in list
Primer Selection
Rules
Primer design is an art when done by human beings, and a far
better done by machines.
machines
5. Primer Design Criteria
• Primer uniqueness
• Primer length
• Melting temperature
• GC content range
• 3'-clamp properties (terminal residue,
CG-content)
• Avoid hairpins in primers
• Length of amplified region
• Avoid primer-primer interaction
• Melting temperature compatability
05/15/12 NBFGR karan veer singh
6. A simple set of rules for primer sequence design is as
follows
٭Primers should be 17-28 bases in length;
¼ chance (4ˉ¹) of finding an A, G, C or T in any given DNA sequence;
1/16 chance (4ˉ²) of finding any dinucleotide sequence (eg. AG);
1/256 chance of finding a given 4-base sequence.
Thus, a sixteen base sequence will statistically be present only once in every
4¹6 bases (=4 294 967 296, or 4 billion) about the size of the human or maize
genome
05/15/12 NBFGR karan veer singh
7. ٭Base composition should be 50-60% (G+C);
٭Primers should end (3') in a G or C, or CG or
GC: this prevents "breathing" of ends and
increases efficiency of priming;
٭Tms between 55-80ºC are preferred;
Tm = 4(G + C) + 2(A + T) ºC.
05/15/12 NBFGR karan veer singh
8. Common problems in primer design
٭Runs of three or more Cs or Gs at the 3'-ends of primers
may promote mispriming at G or C-rich sequences (because
of stability of annealing), and should be avoided;
-'3٭ends of primers should not be complementary
٭Primer self-complementarity (ability to form 2º structures
such as hairpins) should be avoided.
05/15/12 NBFGR karan veer singh
12. When is a “PRIMER” a Primer?
05/15/12 NBFGR karan veer singh
13. Designing Degenerative Oligonucleotide
A group of degenerate oligonucleotides contain related sequences with
differences at specific locations.
One common use of degenerative oligonucletides is when the amino acid
sequences of a protein is known. One can reverse translate this sequence to
determine all of the possible nucleotide sequences that could encode that
amino acid sequence. A set of degenerate oligonucleotides would then be
produce matching those DNA sequences .
http:// cvmbs.colostate.edu/molkit/rtranslate/
AspGluGlyPheLeuSerTyrCysTrpLeuProHisGln
GATGAAGGTTTTCTTTCTTATTGTTGGCTTCCTCATCAA
C G C CT CAGC C C T C C C G
A A A A A
G G G G G
05/15/12 NBFGR karan veer singh
14. Related Bioinformatics Programs:
٭Primer3 http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi
٭Web Primer http://seq.yeastgenome.org/cgi-bin/web-primer
٭Gene Fisher (http://bibiserv.techfak.uni-bielefeld.de/genefisher/)
٭GeneWalker (http://www.cybergene.se/primerdesign/)
٭CODEHOP (http://www.blocks.fhcrc.org/codehop.html)
٭Net Primer
(http://www.premierbiosoft.com/netprimer/netprlaunch/netprlaunch.html )
…….and many others
05/15/12 NBFGR karan veer singh
15. PCR Mastermix Box Titration Calculator
- http://www.attotron.com/pub/pcrtitr.htm
PCR Optimization Program Helper –
http://www.molbiol.ru/eng/scripts/01_14.html
٭MGH-PGA Proteomic Tools PCR Primer design for
peptide sequences
٭Oligo Calculator -- to calculate Tm, GC%, etc for a
given oligo.
05/15/12 NBFGR karan veer singh
17. Other Primer Databases:
RTPrimerDB - Real Time PCR Primer and Probe Database
(submitted by researchers).
Real Time PCR Primer Sets Real time PCR primers
(submitted by researchers).
The Quantitative PCR Primer Database (QPPD) provides
information about primers and probes that can be used for
human and mouse real time RT–PCR assays (published
articles)
IMGT/PRIMER-DB, the IMGT database for primers of the
immunoglobulins (IG), T cell receptors (TR) and related
proteins of the immune system (RPI).
05/15/12 NBFGR karan veer singh
18. Components Volume Per Concentration
sample reaction
DDW 38.8 µl -
Buffer 5.00 µl 1X
dNTP’s 1.00 µl (0.25 µl 200 μM each
each)
Primer F 0.04 µl 5-10 p moles
Primer R 0.04 µl 5-10 p moles
MgCl2 2.00 µl -
Taq Polymerase 0.04 µl 1.5 U
Total Volume 48.00 µl -
05/15/12 NBFGR karan veer singh
19. Buffer:
1X, usually comes as 10X stock.
For 25µL reactions, this means 2.5µL.
05/15/12 NBFGR karan veer singh
20. dNTP’s:
•a 2mM stock of dNTPs means that the final
concentration of EACH dNTP (dATP,
dCTP, dGTP, and dTTP) is 2mM -- NOT
that all dNTPs together make 2mM.
•dNTPs come as 100mM stocks -- thaw and
add 10µL of each dNTP to 460µL of ddH20
to make 2mM. Store at -20°C.
05/15/12 NBFGR karan veer singh
21. Primers:
A good place to start with primer
concentration is 50pmol of each primer
per reaction.
If you don’t get your desired product, you
can increase to 75pmol or 100pmol. This
usually does the trick.
05/15/12 NBFGR karan veer singh
22. MgCl2 Concentration.
•Mg2+ ions form complexes with dNTPs, primers and DNA templates,
the optimal concentration of MgCl2 has to be selected for each
experiment.
Too few Mg2+ ions result in a low yield of PCR product, and too
many increase the yield of non-specific products and promote
misincorporation.
Lower Mg2+ concentrations are desirable when fidelity of DNA
synthesis is critical.
05/15/12 NBFGR karan veer singh
23. Taq DNA Polymerase:
Usually 1-1.5u of Taq DNA Polymerase are used in 50µl of
reaction mix. Higher Taq DNA Polymerase concentrations
may cause synthesis of nonspecific products.
However, if inhibitors are present in the reaction mix (e.g., if
the template DNA used is not highly purified), higher
amounts of Taq DNA Polymerase (2-3u) may be necessary to
obtain a better yield of amplification products.
05/15/12 NBFGR karan veer singh
24. Template:
It’s not usually necessary to be incredibly
fastidious about how much template you
add to a reaction. You can get product
with incredibly small amounts of starting
DNA.
05/15/12 NBFGR karan veer singh