Biotecnología

2.084 visualizações

Publicada em

Presentació al Foro HealthCare, organitzat per Barcelona Activa i l'IESE.

  • Seja o primeiro a comentar

Biotecnología

  1. 1. BIOTECNOLOGIA IESE – 11 de marzo de 2010
  2. 2. BIOTECNOLOGÍA Toda aplicación tecnológica que utilice sistemas biológicos y organismos vivos o sus derivados para la creación o modificación de productos o procesos para usos específicos.
  3. 3. QUÉ SISTEMA BIOLÓGICO ? QUÉ ORGANISMO VIVO? <ul><li>VIRUS </li></ul><ul><li>CÉLULAS PROCARIOTAS </li></ul><ul><ul><ul><li>Bacterias </li></ul></ul></ul><ul><li>CÉLULAS EUCARIOTAS: </li></ul><ul><ul><ul><li>Células Animales </li></ul></ul></ul><ul><ul><ul><li>Células Vegetales </li></ul></ul></ul><ul><ul><ul><li>Hongos </li></ul></ul></ul>
  4. 4. CREACIÓN O MODIFICACIÓN DE PRODUCTOS O PROCESOS <ul><li>UTILIZARLOS PARA LA PRODUCCIÓN DE PRODUCTOS </li></ul><ul><li>MODIFICARLOS PARA LA PRODUCCIÓN DE PRODUCTOS </li></ul><ul><ul><ul><li>Aumentando su productividad </li></ul></ul></ul><ul><ul><ul><li>Haciendo que fabriquen productos nuevos </li></ul></ul></ul><ul><ul><ul><li>Reparando sus ineficacias </li></ul></ul></ul><ul><ul><ul><li>Activando o inhibiendo sus procesos </li></ul></ul></ul>
  5. 5. <ul><li>DEL ADN A LAS PROTEINAS PASANDO POR EL ARN </li></ul><ul><li>LAS CÉLULAS CONTIENEN </li></ul><ul><ul><li>Nucleo donde reside el ADN: un hardware de base 4 (citosina, timina, adenina y guanina): CTAG. </li></ul></ul><ul><ul><li>Un citoplasma donde reside la fabrica de proteinas: un hardware de base 20: los aminoácidos esenciales. </li></ul></ul><ul><ul><li>Una membrana que las envuelve. </li></ul></ul>ENTENDIENDO LA VIDA. UN DOBLE HARDWARE
  6. 6. El DNA ES UNA SOPA DE LETRAS QUE ALMACENA TODA LA INFORMACION MEDIANTE UN SENCILLO ALFABETO DE 4 LETRAS (A,C,G,T,) ATGTTGACCTGATCGAAATGGATCCTCTCTCGACTATAACCA ATGATG GAAATGGATCATGTTGACCTGATC GATCCTCTCTCGACTTTGACCTGC ATGATGCCTAGCATGTTGACCTGATCGAAATGGATCCTCTCTCGACTA GGATCCTCTCTCGACTATAACCAATGATGCCTAGCACATGTTGACCTG CGACTATAACCAATGATGCCTAGCATGTTGACCTGATCGAAATGGATC CTAGCCAATGATGCCTAGCCAATGATGCCTAGCATGATGCCTAGCTTG TGGATCCTCTCTCGACTATAACCAATGATGCCTAGATGTTGACCTGAT GGATCCTCTCTCGACTATAACCAATGATGCCTAGCACATGTTGACCTG CCTGATCGAAATGGATCCTCTCTCGACTATAACCAATGATGCCTAGCA ATGTTGACCTGATCGAAATGGATCCTCTCTCGACTATAACCAATGATG CTAGCCAATGATGCCTAGCCAATGATGCCTAGCATGATGCCTAGCTTG GACTATAACC AATGATGCCTAGCACATGTTCTAGCCAAT GATGCACAT GTTCTAGCCCTAGCCAATGATGCCTAGCATGATGCCTAGCTTGTGATG
  7. 7. SÍNTESIS DE PROTEÍNAS CÓDIGO GENÉTICO . Es el conjunto de normas por las que la información codificada en el material genético (secuencias de ADN o ARN) se traduce en proteínas en las células vivas. El código define la relación entre secuencias de tres nucleótidos, llamadas codones, y los aminoácidos. La secuencia de codones determina la secuencia de una proteína en concreto, que tendrá una estructura y una función específicas
  8. 8. LOS GENES SON FRASES CON SIGNIFICADO FORMADAS POR PALABRAS DE TRES LETRAS ATGCCTACTT ATG CCA TTG ATTCCCAA aa1 aa2 aa3 PROTEINA
  9. 9. Genes Proteína Función Pérdida de función ENFERMEDAD Mutación
  10. 10. DNA P exón 1 exón 2 exón 3 Transcripción Splicing RNA proteína traducción LOS GENES ESTAN FRAGMENTADOS Intrón 1 Intrón 2
  11. 11. BIOTECNOLOGIA Y MEDICINA <ul><li>CREACIÓN O MODIFICACIÓN </li></ul><ul><ul><li>El ADN como objetivo: repararlo, modificarlo </li></ul></ul><ul><ul><li>Trabajar sobre el ARN: interfiriendo </li></ul></ul><ul><ul><li>Las proteínas como objetivo: reparándolas, produciéndolas con eficiencia </li></ul></ul><ul><ul><li>Las membranas: la barrera a superar y/o fuente de medicamentos </li></ul></ul>
  12. 12. MODIFICANDO EL ADN <ul><li>INTRODUCIR EL CÓDIGO DE UNA PROTEÍNA EN UNA CÉLULA BACTERIANA, VEGETAL O ANIMAL CON EL OBJETIVO DE PRODUCIRLA: </li></ul><ul><ul><li>Problema: cómo pasar las membranas. </li></ul></ul><ul><ul><li>Qué se patenta: el método de modificación vinculado al sustrato y al producto obtenido, los usos del producto obtenido por dicho método, las formas galénicas, etc. </li></ul></ul>
  13. 13. EJEMPLOS <ul><li>PRODUCIDO POR CELULAS BACTERIANAS: </li></ul><ul><ul><ul><li>ESCHERICHIA COLI: www.merckserono.com </li></ul></ul></ul><ul><ul><ul><li>INTERFERON ALFA 2B: www. schering-plough.es </li></ul></ul></ul><ul><li>PRODUCIDO POR CÉLULAS DE MAMIFERO: </li></ul><ul><ul><ul><li>EFALIZUMAB: www.merckserono.com </li></ul></ul></ul><ul><ul><ul><li>INTERFERON BETA 1A: www.merckserono.com </li></ul></ul></ul><ul><ul><ul><li>ERITOPROYETINA: www.roche.es </li></ul></ul></ul><ul><li>PRODUCIDAS EN CÉLULAS VEGETALES </li></ul><ul><ul><ul><li>DE ZANAHORIA: www.protalix.com </li></ul></ul></ul>
  14. 14. REPARANDO EL ADN <ul><li>EL SUEÑO DE LA TERAPIA GÉNICA: en cultivos celulares ya se ha conseguido reparar y reproducir el ADN reparado pero en animales aún tenemos que resolver: </li></ul><ul><ul><ul><li>llegar a la célula diana. </li></ul></ul></ul><ul><ul><ul><li>Atravesar la membrana celular. </li></ul></ul></ul><ul><ul><ul><li>Llegar al núcleo. </li></ul></ul></ul>
  15. 15. EN QUÉ SE INVESTIGA <ul><li>SOBRE LA MEMBRANA CELULAR: CÓMO RECONOCERLA SELECTIVAMENTE: PROTEÍNAS DE MEMBRANA. </li></ul><ul><li>SOBRE CÓMO TRASPASAR LA MEMBRANA CELULAR: VÍAS ESPECIALES DE ENTRADA, LIPOSOMAS, ETC. </li></ul><ul><li>CÓMO LLEGAR AL NÚCLEO: </li></ul><ul><ul><ul><li>Vectores víricos. </li></ul></ul></ul><ul><ul><ul><li>Mecanismos inversos: del citoplasma al núcleo. </li></ul></ul></ul><ul><ul><ul><li>Qué se patenta: todo aquello que no es un descubrimiento: el uso de proteínas como efecto diana, los liposomas y sus usos, etc. </li></ul></ul></ul>
  16. 16. <ul><li>INTERFIRIENDO EL ARN </li></ul><ul><li>www.sirna.com </li></ul><ul><li>The scientific community considers RNA interference the breakthrough biological discovery of the decade with the potential to change how diseases are treated. Sirna Therapeutics is at the forefront of the effort to create RNAi-based therapies and leverage the vast potential of this technology to ultimately treat patients. </li></ul>ARN
  17. 17. iRNA - PROBLEMAS Y OPORTUNIDADES <ul><li>TECHNOLOGY PLATFORM – DRUG DELIVERY </li></ul><ul><ul><ul><li>Novel polymers and lipids for encapsulation that exhibit Low toxicity </li></ul></ul></ul><ul><ul><ul><li>Molecular Targeting </li></ul></ul></ul><ul><li>LOCAL DELIVERY </li></ul><ul><ul><ul><li>Medium and high throughput screening techniques for siRNA quantitation </li></ul></ul></ul><ul><ul><ul><li>Assays for clinical biodistribution </li></ul></ul></ul><ul><ul><ul><li>Assays for pharmacodynamic evaluation of miRNA activity </li></ul></ul></ul><ul><ul><ul><li>High-throughput in vivo screening technologies for determining mRNA silencing </li></ul></ul></ul>
  18. 18. LA PRODUCCIÓN DE PROTEÍNAS <ul><li>REPARANDO EL STOP </li></ul><ul><ul><li>www.ptctherapeutics.com </li></ul></ul><ul><li>REPARANDO LA ESTRUCTURA ESPACIAL </li></ul><ul><ul><li>www.amicus.com </li></ul></ul><ul><li>PRODUCIÉNDOLAS CON EFICIENCIA </li></ul><ul><ul><li>www.erabiotech.com </li></ul></ul>
  19. 19. LAS MEMBRANAS <ul><li>FUENTE DE MEDICAMENTOS </li></ul><ul><ul><li>Creando vacunas </li></ul></ul><ul><ul><ul><ul><li>www.archivelfarma.com : tuberculosis </li></ul></ul></ul></ul><ul><ul><ul><ul><li>www.immatics.com : cáncer </li></ul></ul></ul></ul><ul><ul><li>Buscando ventanas de entrada: </li></ul></ul><ul><ul><ul><ul><li>www.gp-pharm.com : liposomas target </li></ul></ul></ul></ul><ul><ul><ul><ul><li>Canales iónicos de membrana </li></ul></ul></ul></ul>
  20. 20. EVALUAR PROYECTOS Y COMPAÑIAS <ul><li>Informacion sobre drogas huerfanas </li></ul><ul><li>Datamonitor </li></ul><ul><li>Clasificacion de las enfermedades </li></ul><ul><li>IMS </li></ul>
  21. 21. ENFERMEDADES POR ORDEN DECRECIENTE DE PREVALENCIA
  22. 22. ORPHAN DRUG DEVELOPMENT AND APPROVAL TRENDS H12009= Q1 2009 + Q22009 Number of designated and approved orphan drugs in the US, 1993 – Q2 2009
  23. 23. ORPHAN DRUG DEVELOPMENT AND APPROVAL TRENDS H12009= Q1 2009 + Q22009 Number of designated, approved, withdrawn/suspended and refused orphan drugs in the EU, 2000 – Q2 2009
  24. 24. MARKET DEFINITION – Cancer Market Note : The L2A3 class comprises LHRH analogs but for the purpose of this report it will be defined as &quot;LHRH agonists&quot;. LHRH antagonists are classified under the L2B9 class: other hormone antagonists. DNA = deoxyribonucleic acid; LHRH = luteinzing hormone-releasing hormone Source: Datamonitor
  25. 25. EXECUTIVE SUMMARY
  26. 26. EXECUTIVE SUMMARY
  27. 27. AGENTES ALQUILANTES
  28. 28. BUSINESS NEWS Biovitrum sells anti-obesity programme to AstraZeneca Astrazeneca is to pay biovitrum up to €186 million for its preclinical leptin. Novartis to pay up to $620 million for Corthera Novartis is to acquire the privately held US biopharmaceutical company Corthera for $120 million up front and up to $500 million in development and commercialisation milestones. Teva signs pact for OncoGenex’s cancer adjunct Teva is to pay $60 million up front and up to $370 million in milestones to access OncoGenex’s lead product, the cancer adjunct therapy candidate OGX-011. Novartis venture arm inks $200M deal with tiny Viamet Tiny Viamet Pharmaceuticals in Morrisville, NC has snared a $200 million licensing option deal with the venture arm of Swiss pharma giant Novartis.
  29. 29. TOP 20 BIOTECH VENTURE CAPITAL DEALS OF 2009 1. Clovis Oncology  - $146.30 million 2. Zogenix  - $70.96 million 3.  BioVex Group  - $70 million 4. Pacific Biosciences  - $68 million 5. Hyperion Therapeutics  - $68 million 6. Anacor Pharmaceuticals  $50 million 6. Proteon Therapeutics  $50 million 6. PTC Therapeutics  $50 million 9. Virdante Pharmaceuticals  - $47.75 million 10. Cempra Pharmaceuticals  - $46 million 11. Complete Genomics  - $45 million 11. SFJ Pharmaceuticals  - $45 million 13. Amyris Biotechnologies  - $41.75 million 14. Kolltan Pharmaceuticals  - $40.50 million 15. Ironwood Pharmaceuticals  - $40 million 15. Epizyme  - $40 million 15. Adamas Pharmaceuticals  - $40 million 15. Aileron Therapeutics  - $40 million 15. Regado Biosciences  - $40 million 20. GlycoMimetics  - $38.98 million
  30. 30. Sarcodoxome ®
  31. 31. Valuation approach and methods (I) <ul><li>The valuation model considers relevant value drivers such as the potential number of patients treated, product price, risks and costs. Discrete and continuous probability distributions are used to model major uncertainties. </li></ul>Current Competitors Target Population Future Competitors # Patients Treated Pharmaco- economics Benchmark Prices Product Price Cost Assumptions R&D Risks Revenue Projections Cash Flow Model Augmented NPV
  32. 32. Project values (including partnering scenarios) and company value <ul><li>The project values provided on the previous slide do not include potential partnering scenarios. </li></ul><ul><li>However, it is assumed that GP Pharm will license out the projects to big or mid-sized marketing partners. In any partnering agreement, both parties share the value of the project. </li></ul><ul><li>Based on the expected value split, GP Pharm’s value resulting from a project-by-project analysis is EUR 223 million. </li></ul><ul><li>Risperidone depot and Sarcodoxome ® and are the development projects with the highest values, followed by Lutrate ® and the contract manufacturing business. </li></ul><ul><li>The contract manufacturing business represents a stable value, which is not expected to change significantly over time. The R&D projects, however, have the potential to gain value with every successful completion of a milestone. </li></ul><ul><li>It should be noted that the actual value of GP Pharm may be significantly higher due to ownership of assets that have not been explicitly valued (e.g., land, manufacturing facilities). Furthermore, the analysis ignores the value generated from sales in countries not evaluated here (based on IMS Health almost 80% of global retail sales are generated in the USA and EU5). </li></ul>Note: sum of project values may not add to 223 due to rounding errors.
  33. 33. Company value and comparables <ul><li>As shown in a previous slide, the core company value for GP Pharm resulting from a project-by-project analysis is EUR 223 million. </li></ul><ul><li>The mean value for public companies with a comparable profile to GP Pharm is EUR 110 million (see adjoining table). </li></ul><ul><li>The higher value of GP Pharm can be explained by GP Pharm’s contract manufacturing business and an intelligent portfolio mix consisting of a) several late-stage projects with low remaining R&D risk (Lutrate ® , Sarcodoxome ® ) and b) early-stage projects with a high commercial potential and comparably low development risk (risperidone depot, FOD + simvastatin). </li></ul><ul><li>The listed public companies match GP Pharm because they have a </li></ul><ul><li>- focus on or at least strong activities in the areas of reformulation or drug delivery, </li></ul><ul><li>- market capitalization of less than EUR 500 million, </li></ul><ul><li>- staff below 200 employees. </li></ul>Mean = EUR 110 million  In summary, Bioscience Valuation believes that GP Pharm is fairly valued at about EUR 220 million. Note that this valuation does not consider drug sales in countries other than the EU5 and USA, nor does it fully consider all assets of GP Pharm (such as, e.g., land and facilities). Both factors tend to increase GP Pharm’s value beyond the EUR 223 million that results from Bioscience Valuation’s analysis.
  34. 34. Sarcodoxome ® - Assumptions Sarcodoxome ®
  35. 35. Product profile Source: Team meeting at GP Pharm <ul><li>USPs : </li></ul><ul><li>First registered therapy for STS </li></ul><ul><li>Less cardiotoxicity </li></ul><ul><li>No hand-foot syndrome </li></ul>Sarcodoxome ®
  36. 36. Decision tree Sarcodoxome ® <ul><li>This decision tree illustrates the most relevant milestones in the development of Sarcodoxome ® for STS, providing the assumed timing for these milestones (provided by GP Pharm) and their individual probability of success (POS). </li></ul><ul><li>GP Pharm has scheduled a discussion with EMEA in QII’2007. The outcome of this meeting will determine the trial design for Phase II/III. </li></ul>Note: Scenario probabilities do not add up to 100% due to rounding effects.
  37. 37. Derivation of patients eligible for treatment - STS <ul><li>Sources: </li></ul><ul><li>BSV population database </li></ul><ul><li>American Cancer Society </li></ul><ul><li>Cancer Research UK </li></ul><ul><li>Weisberg et al, 2003 </li></ul><ul><li>SEER fact sheets </li></ul><ul><li>Assumption by Bioscience Valuation </li></ul>2020 figures (USA, EU5) Total population USA: 330 million [1] EU5: 302 million [1] Patients receiving chemotherapy = patients eligible for Sarcodoxome ® Patients with soft tissue sarcoma (incidence) USA: 10,099 EU5: 8,705 USA: 10,782 EU5: 9,294 USA: 0.0031% [2] EU5: 0.0022% [3] USA: 7,574 EU5: 6,529 USA: 8,578 EU5: 7,349 STS patients excluding GIST Regional disease (prevalence) 75% [4] (70% - 75% - 80%, Pert) 25% [5] ( 19% - 25% - 31%, Pert) Adjusted for stage-specific 5-year survival rates [5] Distant disease (prevalence) 15% [5] ( 11% - 15% - 19%, Pert ) Adjusted for stage-specific 5-year survival rates [5] USA: 2,772 EU5: 2,390 95% [6] ( 90% - 95% - 100%, Pert ) Sarcodoxome ®
  38. 38. Pricing and patient share <ul><li>Notes: </li></ul><ul><li>See slide “Derivation of patients eligible for treatment” </li></ul><ul><li>Prices per vial are based on the assumption of GP Pharm: EUR 1,200 - 1,400 ( Uniform distribution )  20% deduction for calculation of MNF price </li></ul><ul><li>GP Pharm assumption </li></ul><ul><li>GP Pharm assumption </li></ul><ul><li>Bioscience Valuation estimate </li></ul><ul><li>For the USA Bioscience Valuation assumes an annual price increase of 2% from today onwards (BSV databases) </li></ul><ul><li>Final peak patient share estimation by GP Pharm that takes into account potential future competition </li></ul>2 3 4 5 6 1 Sarcodoxome ® 7
  39. 39. Competition - pipeline drugs for STS Sources: PJB Pharmaprojects, April 2007 Adis R&D Insight, April 2007 <ul><li>The list below includes only those products in development that may have a moderate impact on the final patient share of Sarcodoxome ® . </li></ul>Sarcodoxome ® * n.k. = development for STS is not mentioned * * * * * * * * <ul><li>For most of the doxorubicin-based products no specific information regarding STS is available. To account for their potential impact, Bioscience Valuation has rated them “moderate” and assumed that they are in preclinical development. </li></ul>
  40. 40. Patient penetration <ul><li>Bioscience Valuation expects a market uptake with a TTP (time-to-peak) of 5 years because Sarcodoxome ® will predominantly be marketed to clinical oncologists who usually adopt innovations fast. </li></ul><ul><li>Patent expiry of Sarcodoxome ® is assumed for 2020. GP Pharm assumes that Sarcodoxome ® ’s patient share will decline 5% annually from the year of patent expiry. </li></ul>Sarcodoxome ®
  41. 41. Commercial costs - promotional & sales force costs <ul><li>Phase IV costs make an additional 3% of peak sales in years 1 to 3. </li></ul>Source: BSV benchmarks <ul><li>The costs per sales representative are assumed as indicated in the adjoining table. </li></ul><ul><li>Example: one FTE targeting oncology specialists in the EU5 costs EUR 150,000 per year. </li></ul><ul><li>Sales force costs do not include promotional efforts. </li></ul>Sales force costs <ul><li>Determination of promotional costs in the absence of detailed marketing plans </li></ul><ul><li>Promotional costs (excluding Phase IV costs, excluding sales force costs) are estimated as percentage of peak sales. </li></ul>Sarcodoxome ®
  42. 42. Commercial costs - sales representatives per territory <ul><li>Bioscience Valuation assumes that Sarcodoxome ® will be marketed primarily to clinical oncologists. </li></ul><ul><li>To reflect pre-launch recruitment and training of sales representatives we assume that 30% of launch year costs are incurred in the year before. </li></ul>Sarcodoxome ® Source: BSV benchmarks
  43. 43. Further assumptions for the project model - Sarcodoxome ® <ul><li>Target markets: USA, EU5 (France, Germany, Italy, Spain, UK) </li></ul><ul><li>Launch: 2010 </li></ul><ul><li>Patent expiry: 2020 </li></ul><ul><li>G&A costs: 5% of sales </li></ul><ul><li>COGS: EUR 39 per vial (= EUR 415 per patient) </li></ul><ul><li>Tax rate: 30% </li></ul><ul><li>Discount rate: 25% until 2008 15% from 2009 onwards </li></ul><ul><li>R&D costs: (all in EUR million) Phase II/III: 6.20 CMC 0.18 Approval: 0.06 Internal costs: 1.29 </li></ul>Total R&D costs: EUR 7.73 million Sources: GP Pharm Sarcodoxome ®
  44. 44. Sarcodoxome ® - Results Sarcodoxome ®
  45. 45. Sales forecast <ul><li>Based on an appealing target profile and EU orphan drug status (resulting in a comparably high patient share) peak sales may reach EUR 70 million in the niche indication soft tissue sarcoma (STS). </li></ul>Sarcodoxome ® Note: Sales per region might not add up sales for all countries due to rounding effects.
  46. 46. NPV results Sarcodoxome ® Note: total costs = R&D costs + commercial costs <ul><li>The expected project NPV for Sarcodoxome ® is EUR 64 million. </li></ul><ul><li>The total cost per milestone include R&D cost as well as marketing & sales force cost. The total investment of EUR 14.1 million during the approval process consists of EUR 0,1 million for the regulatory / R&D effort and EUR 14.0 million for all pre-lunch marketing measures as well as recruitment and training of sales forces. </li></ul><ul><li>Based on current assumptions the value of Sarcodoxome ® at launch (i.e. after approval) would be EUR 166 million. </li></ul>

×