Recomendados
Recomendados
Mais conteúdo relacionado
Mais procurados
Mais procurados (20)
Semelhante a Updated: New High Throughput Sequencing technologies at the Norwegian Sequencing Centre - and beyond
Semelhante a Updated: New High Throughput Sequencing technologies at the Norwegian Sequencing Centre - and beyond (20)
Mais de Lex Nederbragt
Mais de Lex Nederbragt (12)
Último
Último (20)
Updated: New High Throughput Sequencing technologies at the Norwegian Sequencing Centre - and beyond
- 1. New High Throughput Sequencing technologies at the Norwegian Sequencing Centre - and beyond Lex Nederbragt, NSC and CEES lex.nederbragt@bio.uio.no
- 2. Norwegian Sequencing Centre National technology core facility
- 3. Norwegian Sequencing Centre Offering sequencing services GS FLX from Roche/454 HiSeq 2000 from Illumina
- 4. 1) New instruments: Benchtop sequencers
- 5. High-throughput sequencing Phase 1: more is better 2005 GS20 200 000 reads 100 bp 0.02 Gb/run 2011 GS FLX+ 1.2 million reads 750 bp 0.7 Gb/run 2006 GA 28 million reads 25 bp 0.7 Gb/run 2011 HiSeq 2000 3 billion reads 2x100 bp 600 Gb/run
- 6. High-throughput sequencing Phase 2: smaller is better GS Junior from Roche/454 0.04 GB/run 400 bp reads 0.7 GB/run 700 bp reads MiSeq from Illumina 2 GB/run 2x150 bp reads 600 GB/run 2x100 bp reads PGM from Ion Torrent/ Life Technologies 0.01, 0.1 or 1 GB/run 100 or 200 bp reads
- 7. High-throughput sequencing Why benchtop sequencing instruments? GS Junior from Roche/454 10 hours 23 hours MiSeq from Illumina 27 hours 10 days PGM from Ion Torrent/ Life Technologies 3 hours
- 8. High-throughput sequencing Why benchtop sequencing instruments? Diagnostics Affordable price per instrument Small projects Fast turn around time http://pennystockalerts.com/ http://www.highqualitylinkbuildingservice.com/ http://www.vetlearn.com/ http://vanillajava.blogspot.com
- 9. High-throughput sequencing Benchtop sequencing instruments at the NSC ✖ ✔ ✔ ✔ ✔
- 11. Sequencing technology Reversible dye terminator sequencing-by-synthesis Reversible terminators Metzker 2010 Nat Rev Genet.11(1):31-46
- 12. Sequencing technology Pyrosequencing PPi: pyrophosphate
- 13. Sequencing technology Free proton current shift sequencing-by-synthesis
- 14. Error profiles Substitution errors ACGTAGCTGATTTTAGGCTTAGCT ACGTAGCTGCTTTTAGGCTTAGCT Homopolymer errors ACGTAGCTGATTTTAGGCTTAGCT ACGTAGCTGATTT-AGGCTTAGCT
- 15. Applications Illumina Illumina Platform 454 Ion Torrent HiSeq MiSeq resequencing - +++ ++ +++ de novo +++ + + ++ metagenomics +++ ++ + ++ mRNA ++ +++ ++ + miRNA - +++ +++ - ChIP - +++ ++ - DNA meth - +++ + -
- 16. Announced upgrades HiSeq 2000 HiSeq 2500 2x 250 bp reads 2x150 bp? Rapid run mode 27 hrs 8.5 Gbp 2x150 bp, 90 Gbp 750 bp reads? 400 bp reads Proton from Ion Torrent Fall 2012: 10 Gb on Proton I chip, 400 bp 2013: 4 x more wells on Proton II chip
- 17. Which instrument to choose?
- 19. Shameless self-promotion (1) @lexnederbragt
- 20. 2) New instruments: Pacific Biosciences RS
- 21. High-throughput sequencing Phase 3: single-molecule C2 (current) chemistry: Average read length 2500 bp 36 000 reads 90 MB per ‘run’
- 22. High-throughput sequencing REVI EW S Technology Pacific Biosciences — Real-time sequencing a Phospholinked hexaphosphate nucleotides G A b 1 nm 00 Zero-mode waveguide Limit of detection zone Glass Fluorescence pulse Intensity Epifluorescence detection T Figure 4 | Real-time sequencing. P acific Biosciences’ four-colour r a | The zero-mode waveguide (ZMW) design reduces the observatio fluorescently labelled molecules that enter the detection layer for a the dilemma that DNA polymerases perform optimally when fluore
- 23. High-throughput sequencing S Technology Real-time sequencing Phospholinked hexaphosphate nucleotides G A T C b Limit of detection zone Fluorescence pulse Intensity e detection Time Nature Reviews | Genetics Figure 4 | Real-time sequencing. Pacific Biosciences’ four-colour real-time sequencing method is shown.
- 24. High-throughput sequencing Library preparation SMRTBell'template' SMRTBell'template' Standard'Sequencing' Standard'Sequencing' Generates& pass& each& one& on& molecule& Insert& Large& Sizes& Generates& pass& each& one& on& molecule& Large& Insert& Sizes& sequenced& sequenced& Circular'Consensus'Sequencing' Circular'Consensus'Sequencing' Insert& Small& Sizes& Small& Insert& Sizes& mul8ple& Generates& passes& each& on& molecule& Generates& mul8ple& sequenced& passes& each& on& molecule& sequenced&
- 25. High-throughput sequencing Read length
- 26. High-throughput sequencing SMRTBell'template' Raw reads and subreads Standard'Sequencing' Generates& pass& each& one& on& molecule& Large& Insert& Sizes& sequenced& ‘Subreads’ Circular'Consensus'Sequencing' Small& Insert& Sizes& Generates& mul8ple& passes& each& on& molecule& sequenced&
- 27. High-throughput sequencing SMRTBell'template' SMRTBell'template' Raw read quality Standard'Sequencing' Generates& pass& each& one& on& molecule& Large& Insert& Sizes& Standard'Sequencing' sequenced& 85-87% accuracy Circular'Consensus'Sequencing' Large& Insert& Sizes& Random pass& each& Generates& one& sequenced& errors (!) on& molecule& Circular'Consensus'Sequencing' Small& Insert& Sizes& Generates& mul8ple& passes& each& on& molecule& sequenced& Small& Insert& Sizes& Generates& mul8ple& passes& each& on& molecule& sequenced& 4 to 5 passes: accuracies in the high 90's % 5 passes yields average Q30 (1:1000 chance of error)
- 28. Applications Illumina Illumina Platform 454 Ion Torrent PacBio HiSeq MiSeq* resequencing - +++ ++ - + de novo +++ + + +++ +++ metagenomics +++ ++ + +++ +/- mRNA ++ +++ ++ ++ ++ miRNA - +++ +++ - - ChIP - +++ ++ - - DNA meth - +++ + - !!! SNP validation + - - - ++
- 29. PacBio and base modifications
- 30. What use for PacBio? http://www.walker.co.uk/What-Use-Is-a-Moose-9780744578393.aspx
- 31. PacBio: uses Standard'Sequencing' Short reads high quality Generates& pass& each& one& on& molecule& Large& Insert& Sizes& sequenced& Circular'Consensus'Sequencing' Small& Insert& Sizes& Generates& mul8ple& passes& each& on& molecule& sequenced& SNP validation Short tandem repeats!
- 32. PacBio: uses SMRTBell'template' Long reads low quality Standard'Sequencing' Generates& pass& each& one& on& molecule& Large& Insert& Sizes& sequenced& 85-87% accuracy Circular'Consensus'Sequencing' Uses? Small& Insert& Sizes& Generates& mul8ple& passes& each& on& molecule& sequenced&
- 33. PacBio: uses Can long PacBio reads overcome repeats during de novo assembly? http://nopsa.hiit.fi/pmg/viewer/photo.php?id=14134
- 34. PacBio: long read uses For de novo For scaffolding http://schatzlab.cshl.edu/presentations/2012-01-17.PAG.SMRTassembly.pdf
- 35. PacBio: long read uses For de novo Error correct with short reads http://schatzlab.cshl.edu/presentations/2012-01-17.PAG.SMRTassembly.pdf
- 36. PacBio: long read uses For de novo http://schatzlab.cshl.edu/presentations/2012-01-17.PAG.SMRTassembly.pdf
- 37. PacBio: long read uses For de novo Koren et al, 2012
- 38. PacBio: long read uses For de novo
- 39. PacBio: long read uses For de novo - alternatives ALLPATHS_LG
- 41. 3) Preliminary results: Pacific Biosciences RS
- 42. PacBio: first results Samples Atlantic cod Fish X http://en.wikipedia.org http://www.drawinghowtodraw.com/
- 43. PacBio: first results SMRTBell'template' Libraries Standard'Sequencing' Generates& pass& each& one& on& molecule& Large& Insert& Sizes& sequenced& 4kb and 17b insert sizes Circular'Consensus'Sequencing' Small& Insert& Sizes& Generates& mul8ple& passes& each& on& molecule& sequenced&
- 44. PacBio: first results Raw reads ZMWs Mean readlength 30,000 4,000 25,000 3,500 3,000 20,000 2,500 15,000 2,000 10,000 1,500 1,000 5,000 500 0 0 cod 4kb cod 17kb Fish X 4kbFish X 4kb Fish X Fish X cod 4kb cod 17kb Fish X 4kb Fish X 4kb Fish X Fish X 17kb 17kb 17kb 17kb Longest read 25,000 20,000 15,000 10,000 5,000 0 cod 4kb cod 17kb Fish X 4kb Fish X 4kb Fish X 17kb Fish X 17kb
- 45. SMRTBell'template' PacBio: first results Length of longest subread for all raw reads Standard'Sequencing' Generates& pass& each& one& on& molecule& Large& Insert& Sizes& sequenced& Circular'Consensus'Sequencing' Average length 16,000 Largest Small& Insert& Sizes& 14,000 Generates& mul8ple& passes& each& on& molecule& 12,000 sequenced& 10,000 8,000 6,000 4,000 2,000 0 cod 4kb cod 17kb Fish X 4kb Fish X 4kb Fish X 17kb Fish X 17kb
- 46. PacBio: first results Length of longest subread for all raw reads Per SMRTCell longest subread length density distribution Fish X Salmon Atlantic Atlantic Cod 4kb libraries Cod 3e−04 17kb libraries 2e−04 Density 1e−04 0e+00 0 2000 4000 6000 8000 10000 Maximum subread length
- 47. PacBio: first results Mapping to the cod genome Long insert – single pass Short insert – many passes
- 48. PacBio: first results Mapping to the cod genome Long insert – single pass 11.4 kbp subread
- 49. PacBio: first results Mapping to the cod genome Long insert – single pass 10.6 kbp subread
- 50. PacBio: first results Mapping to the cod genome Long insert – single pass 10.9 kbp subread
- 51. 4) Beyond ‘second generation’ sequencing
- 52. High-throughput sequencing Phase 1: more is better Phase 2: smaller is better Phase 3: single-molecule Phase 4: the sky is the limit?
- 54. Oxford Nanopore AGBT conference, February 2012
- 55. Oxford Nanopore AGBT conference, February 2012 100 kbp reads Currently at 4% error 1% error at release GridION 2000 nanopores/node tens of Gb data per 24 hour Run until… 20 nodes 1 human genome in 15 minutes
- 56. Oxford Nanopore AGBT conference, February 2012 MinION 512 nanopores 150mb/hour Up to 6 hours $900
- 57. Nanopore sequencing Seeing is believing http://uwgcm.org
- 58. Nanopore sequencing Democratization of sequencing