O slideshow foi denunciado.
Utilizamos seu perfil e dados de atividades no LinkedIn para personalizar e exibir anúncios mais relevantes. Altere suas preferências de anúncios quando desejar.
1 de 46

Innovaciones en el Mejoramiento de la Papa

  1. 1. Innovaciones en el Mejoramiento de la Papa Merideth Bonierbale Cusco, 25 Mayo, 2010
  2. 2. Las Innovaciones en el Mejoramiento han contribuido a: 1. Mejorar la interpretación de la estructura e historia de la diversidad genética 2. Identificar nuevas características para garantizar la seguridad alimentaria y la productividad estable 3. Facilitar la comprensión de la base genética de la variación de caracteres en la fuente de genes del cultivo 4. Ampliar la base genética de caracteres de adaptación 5. Minimizar los efectos ambientales para maximizar el poder de selección
  3. 3. rap ver pcs ber amb tbr chq san mcd acl adg sto chc acg pur spl 1. Mejorar la interpretación de la estructura e historia de la diversidad genética
  4. 4. Caracterización de Colecciones de Germoplasma A. Identidad/Distinción (duplicados ID) C. Medidas cuantitativas de las distancias genéticas B. Riqueza de Alelos
  5. 5. Formación de Colecciones Núcleos Species Series Ploidy(EBN) Especies taxonómicas Origen geográfico Caracteres morfológicas Diversidad molecular (structural) Respuesta Hospedero- Patógenos Diversidad molecular (funcional)
  6. 6. Correlacionando la variación genotípica y fenotípica: Mapeo por Desequilibrio de Ligamiento Pij(k) = µ + Ck + αXi(k) + gi(k) + yj + ei(k)j Diversidad Genética Ind.1 Ind.2 Ind.3 Ind.4 Ind.5 Ind 6 Ind.7 Ind.8 Ind.9 Ind.10 Ind.11 QTL Gen Candidato
  7. 7. Caracterización fenotípica de la resistencia al tizón tardío en la Población B1 n 0º Colombi AUDPC= Σ (X i+j + X i ) (t i+1 - t i ) i=1 3º Ecuado a Concepción (Sierra 2 r 2600m) 6º Brazil 9º 12º Bolivi a 15º Oxapampa (Selva 18º Chile Alta; 1814m)
  8. 8. Asociando la variación fenotípica y genotípica de la resistencia al tizón tardío en la Población Mejorada B1 Chromosoma II Marcador SSR STG-0006 en el Cr 2 asociado a la resistencia por LD AUDPC 5500 Presencia 5000 4500 Ausencia 25 4000 3500 20 3000 15 2500 2000 10 1500 5 B1C5 1000 B1C0 500 0 B1C0 B1C0 B1C5-A B1C5-A B1C5-B B1C5-B Población AUDPC (Promedios) Frequency Marker alleles B1C0 B1C5 STG-0006.174 33% 0% STG-0006.170 19% 32% STG-0006.179 48% 67%
  9. 9. 2. Identificar nuevas características para garantizar la seguridad alimentaria y productividad estable 303846 303835 303845 303828 303842 303826 303841 303832
  10. 10. Análisis estadístico de Componentes Principales: Perfil de diferentes grupos de germoplasma en la acumulación de nutrientes C P1= 48.35 % C P2=32.43% SUM=80.78% 3 VITCDW 2 1 CP2 ZNDW 0 -1 FEDW -2 -3 -3 -2 -1 0 1 2 3 4 5 CP1 Poblacion LTVR Poblacion B3 Variedades del Mundo Variedades locales del Peru
  11. 11. Desarrollo de la técnica de “Espectroscopía de Infrarrojo Cercano” (NIRS) en la evaluación masal del contenido de micronutrientes en poblaciones mejoradas y germoplasma Limpieza Procesamiento Secado Análisis NIRS Muestras Llenado para ser Muestras 1 5 10 congeladas 14 de la Lavado procesadas cubeta Muestras listas Pelado 6 Liofilizado 15 para Clasificando 11 (72h) escanear 2 las muestras Una muestra 7 representativa 16 Escaneo Empacado NIRS 3 12 Molienda Obtención de la 8 muestra Espectro en rodajas 17 Almacena NIRS Muestras miento de 13 molidas 4 las muestras Pesar la 9 muestra Resultados fresca 18 NIRS
  12. 12. Estimados de parámetros genéticos para el contenido de micronutrientes en clones promisorios 0.6 GCA Fe 0.08 0.5 Mean of Fe 0.43 0.46 0.49 0.44 0.43 0.06 Hierro Heritability Estimates 0.42 0.43 0.42 0.41 0.40 0.40 0.39 Fe mg/100mg fw 0.4 0.04 gca effects General Combining Ability 0.3 0.02 0.2 0.00 0.1 -0.02 2 0.0 REICHE -0.04 h MONALISA PW88-6065 PW88-6187 88-108 C92.140 LR-93.160 OREB ATLANTIC LT-8 SPUNTA TXY.2 0.5 0.47 0.47 0.08 0.45 0.44 0.4 0.40 0.42 0.36 0.37 0.42 0.39 0.40 0.37 0.06 0.04 Zinc Zn mg/100 mg fw 0.02 gca effects 0.3 0.00 0.2 -0.02 -0.04 0.1 GCA Zn Mean Zn -0.06 0.0 20 18.8 -0.08 5 17.4 Vitamina C REICHE PW88-6065 PW88-6187 MONALISA 88.108 C92.140 LR-93.160 OREB LT-8 TXY.2 ATLANTIC SPUNTA 18 16.8 15.6 4 Vit C m g/100m g fw 15.0 14.4 15.1 16 13.7 14.3 3 13.1 13.4 14 gca effects 12.2 2 12 1 10 0 8 -1 6 4 GCA Vit C -2 2 Mean Vit C -3 0 -4 R EIC H E PW 88-6065 PW 88-6187 M O N A LISA 88.108 C 92.140 LR -93.160 O R EB LT-8 TXY.2 A TLA N TIC SPU N TA
  13. 13. Ganancia genética para la concentración de Hierro (Fe) y Zinc (Zn) en base fresca (mg/100mg pf) en papas nativas diploides (2x) 2005 2007 1.20 1.20 Mean =0.60+0.13 Ciclo 0 Fe (mg/100g,PF) N=16 0.90 Mean =0.49 +0.07 0.88 28 progenitores N=28 0.80 0.72 (cultivares 0.65 0.60 0.55 0.64 0.60 0.56 nativos de stn, gon, phu) en 0.50 0.49 0.48 0.45 0.40 0.40 0.35 0.32 NCDI – 16 0.00 0.00 familias 0.90 0.90 Mean=0.50+0.07 Ciclo 1 N=16 Zn (mg/100g,PF) Mean=0.38+0.08 N=28 0.65 16 progenitores 0.60 0.60 0.55 0.50 0.50 0.45 Fe y Zn NCDII - 0.40 0.38 0.30 0.40 0.35 32 families 0.20 0.00 0.00 0 1Selection Cycle 2
  14. 14. “Captura de Caracteres” resistente susceptible Herramientas Genómicas para evaluar características de adaptación: Resistente Susceptible Tolerancia a la Sequía Microarreglos: Comparación de la • Analisis de expresión génica significancia global. • Atribución de Cambios en la genes a vías o expresión de genes de señales clones resistentes y metabólicas Lista de genes susceptibles. candidatos
  15. 15. Caracteres Fisiológicos Comparación de la eficiencia en el uso de agua de dos clones tetraploides: Tolerante y Susceptible CLONE: CANCHAN Control Estomático Ajuste Osmótico
  16. 16. Características de tolerancia a la sequía Comparación entre el clon CIP 397077.16 (resistente) y la variedad Canchán (susceptible) a nivel morfológico, agronómico, fisiológico y genómico Perfil fisiologico CIP 397077.16 Canchán Pérdida de rendimiento debajo del 30% 60% Conductancia estomática menor mayor Ajuste osmótico fuerte débil Area foliar menor mayor RWC no hay cambios no hay cambios Perfil de expresión génica (6k ARC chip) Genes inducidos 204 82 Genes reprimidos 84 29 Regulación transcripcional NAC-TF, WRKY4 Ajuste osmótico osmotina Detoxificación Glutarredoxina Rescate celular Hsp, chaperonas, cloroplastos inhibidores de proteasas de permanencia verde, Lea chaperonas Mobilización de Almidones α-amilasa Membrana Proteinas que tranfieren lípidos Metabolismo secundario Biosíntesis de terpenos
  17. 17. GATCCCCGCCAA ACCCT AT TGTTGGTACTAGTTCACGGG TCATTCTGCT ATGCA 280 290 300 310 320 0 POX67 7 TG523 10 PCO002 18 PCO93 19 CT182 21 22 23 E32M48R6 C2At2_TaqI.2 C2At2_TaqI.1 3. Facilitar la comprensión de la 26 27 32 NL25_HpaII PCO93all RecepSer/ThrKin base genética de la variación de 36 43 44 TG651 NBS5_HaeIIIR2 TG497 caracteres de adaptación en las 51 TG629 fuentes de genes del cultivo 57 TG147 59 P2_HaeIIIR3 66 69 P3_HaeIIIR4 NBS9_MseIR6 NBS LRR 72 NBS5a_HaeIIIR3 75 CT055 82 TG400 P-loop Kinase-2 GLPL 90 TG044 S1 NBS5a6 NBS9 S2 KIN1 GLPL4 P-loop1 NBS3
  18. 18. Limitación • Falta de información genética específica para la mayoría de características agronómicamente importantes. • Esta falta de “genes a la mano” impide el progreso en el mejoramiento para caracteristicas complejas y aún para algunas de herencia simple.
  19. 19. Descubriendo fuentes de resistencia complementarias al tizón tardío a nivel poblacional S. piurae S. paucissectum OCH11640 S. chiquidenum OCHS15210 S. chomatophilum S. acroglosum S. cajamarquense Acc. SCL 5050 3000 2500 2000 s S AUDPC 1500 1000 r OCH 14187 R 500 0 acg cjm chq chm pcs pur chm
  20. 20. Identificación de fuentes genéticas para el PASOS carácter Construcción de poblaciones segregantes Identificación de marcadores que rodean al gen de interés Localización de QTL I II III IV V VI VII VIII IX X XI XII tbr Meyer et al., 1998 tbr Ewing et al., 2000 tbr Ghislain et al., 2000 tbr Leonards-Schippers et al., 1994 phu Ghislain et al., 2000 tbr, ktz, vrn, tar, stn Collins et al., 1999 blb Naess et al., 2000 tbr, chc, ktz, stn, vrn Oberhagemann et al., 1999 mcd Sandbrink et al., 2000
  21. 21. Construcción de la población segregante PCC1 (S. paucissectum/ .chomatophilum//S.chomatophilum) para resistencia al tizón tardío S. paucissectum S. chomatophilum PI 473489-1 PI 310991-1 Resistant susceptible F1 MP1-8 PCC1 Resistant n=192 35 Monserrate Mean=1968.07 LBr-40 Chata Blanca Yungay SD=698.93 30 pcs n=176 Atzimba 473489.1 ( C ) 25 Female MP1-8(R) 20 15 10 5 0 666.88 975.13 1283.39 1591.65 1899.90 2208.16 2516.42 2824.67 3132.93 3441.19 Mean AUDPC 77 DAP
  22. 22. e46m42.I e34m33.o e32r33.f e32m48.b e36r36.a BGL.11rr S13.700 E41M59.F e34r33.b e36r36.c E34r61.B 8.9 5.7 8.1 11.2 AJ8.1120 10.6 3.3 e31m48.g H10.2400 14.9 14.5 20.7 e32m48.d e31r58.c 20.3 e32m49.a e46r42.f 5.0 5.6 23.2 6.9 8.6 6.1 E34r61.A 4.5 R6.2100 28.5 3.3 T11.810 S017.p1 E39r61.C e32r48.g e32r61.d e38r49.d 5.0 E34M61.C 3.3 e39r50.d 4.4 7.1 11.2 e45r42.e J3.6rr 2.2 AJ8.520 3.4 3.3 e46m42.b 3.3 e35m61.a 6.2 e31r54.b E38r39.D e45r42.f 14.3 e32m61.w 7.3 G13.880 3.4 2.2 1.1 T4.1720 G3.950 AR1.1rrr 3.4 e32m61.b e34m33.L 27.8 1.1 2.6 AML.1000 E35M48.B 32.7 I12.75r G3.113r 6.3 14.7 2.2 E35r54.A E32M49.E e32m33.d 23.0 23.0 10.7 3.7 11.5 e32m51.e e45r59.b 22.3 3.3 1.4 18.3 M11.1250 7.2 E35r54.B e31r58.f E45M60.D e46m42.e AML.2100 6.2 2.2 32.6 e46r42.c Y6.420 N1.1750 e45m42.d e31m48.j E32M61.F 12.5 14.8 e32m61.a e31m58.b 12.2 6.2 e39m50.a 15.9 3.5 13.0 24.0 e45m59.e 7.5 11.9 Q7.34r S106.p1 2.2 e34r33.k 4.5 B8.790 21.3 e34r33.j 8.6 17.2 B4.78r 5.9 BG3.13rr e32r61.e e35m48.a 2.9 J9.450 9.2 4.4 e31m54.t e34m34.a 7.2 B8.1190 8.0 M11.2650 1.6 e33r34.a E40M51.D 9.3 e34m33.n 3.3 E41M59.B e46r42.d E35r58.B e31m58.e e36m50.e 10.7 10.8 8.1 e32r61.c 4.5 8.5 e46m42.j E35M58.D E38r39.A 5.8 12.7 e34r33.m 22.2 e46r42.h 27.1 E39M61.D 9.8 3.3 2.4 22.1 AD3.1700 e45m59.c E39r61.E 24.4 e32m51.c 1.1 5.7 E34r61.H e45r42.h 17.7 5.9 N3.780 5.7 12.7 e32m51.d 4.4 e36r50.a e31m36.a e45r59.d e46m42.a B6.1400 6.8 M2r.78r E34M61.I 3.3 K8.78r E35r58.C 5.0 1.3 13.9 S8.940 23.4 Z1.8rr 4.2 H6.125r E39r50.E 18.1 S064.r2 e36r36.d I II III IV V VI VII VIII IX X XI XII Oxapampa 40 % Región “Hotspot” QTL y genes Comas 30% mayores en el chr11 1R3, 2R3a, b, 15% 3R6, R7 4 R10, R11 10% 1 El Kharbotly et al 1994 2 Huang et al 2004 POX67 3 El Kharbotly et al 1996 PCO093 4 Bradshaw et al 2006 5 Leister et al 1996 6 Hämäläinen et al 1997 5N,6Ry
  23. 23. Genes Candidatos útiles en la caracterización de QTL Ejemplo : Carotenoides Genes Candidatos Mapas Genéticos (genética clásica) Tomate Pimiento Cromosoma 3 Thorup et al. 2000
  24. 24. Localización de Genes Candidatos de la Biosíntesis de Carotenoides en la Papa Chr. 2 (PD) Chr. 2 (BCT) Chr. 3 (PD) Chr. 4 (PCC1) Zeaxanthin epoxidase β-carotene Phytoene hydroxylas Synthase e Asociado con β Lycopene-β- • zeaxantina cyclase • Totales Asociado con • luteina, β -caroteno • zeaxantina • totales Asociado con • , luteina β -caroteno • Totales Asociado con , zeaxantina Totles
  25. 25. Asociando la variación fenotípica para el contenido de carotenoides con la variación genotípica o polimorfismos de marcadores SSR en el Grupo Phureja: Mapeo por Desequilibrio de Ligamiento (LD) S T M 5140 -19 3 A s s o c ia te d alle le s S T G 0 016- 1 55 S T M 2 022-195 S T I00 24-177 S T M 1 053-186 S T M 5140 -19 9 S T I0 023-212 T o tal C aro te n o id s ↑ + 38 3 ↑ + 1 60 A n th e ro x an th in ↓ - 43 ↑ + 38 ↓ - 32 Z eaxan th in ↓ - 150 ↓ - 1 24 β -caro ten e ↑ + 2 .4 I II III IV X * *** ** 703352 * Gon 703168 703831 *** *** * Gon *** Phytoene synthase ß-caroteno Lycopene 701165 Zeaxanthin epoxidase hydroxylase ß-cyclase Phu
  26. 26. Perfil de Expresión de Genes: Microarreglos en el descubrimiento de genes asociados a una característica: Ejemplo Resistencia la tizón tardío Diseño Clon avanzado Entrada resistente de resistente de la la especie silvestre S. B3 Población B3 cajamarquense (cjm) 274 30 cjm Inoculación con aislamientos POX067 y PE 329 Recognition Colección de Muestras R genes CC-NBS Bs2-like CTV2 ADR1 CC-NBS Bs2-like CTV2 ADR1 Dirigent Dirigent 72h y 96h luego de inoculación LRR class LRR class protein protein Chr10 Chr10 Hibridación con arreglo de papa TIGR10K Proteolysis ProteolysisPAD4 Signaling Signaling Chr9 Chr9 C3HC4-type EDS1 ACRE74 RING Chr6 ACRE276 finger EDS5 Chr6 Study # 83 at Solanaceae Gene expression database: Ubiquitination Ubiquitination pathway PAL Chr9 Chr9 http://www.tigr.org/tdb/potato/SGED_index2.shtml Chr12 Chr12 Chr3 SA Chr3 SA
  27. 27. .. Genes Ortólogos: genes que comparten un ancestro común por especiación [Paterson y col. 1995. Science] Demostró que la mayoría de las mutaciones seleccionadas por los agricultores en la domesticación de pastos a partir de los parientes silvestres eran los mismos genes en diferentes especies tales como el arroz, maíz y trigo
  28. 28. Uso de secuencias ortólogas disponibles entre especies, en la ubicación de genes y sus funciones, en otra donde no se dispone de dicha información COS COS COS COS COS COS COS COS COS COS COS COS COS Arabidopsis Seleccionar Sub- COS Lycopersicum thaliana set de COS sculentum “domesticación” COS COS COS Ubicar y secuenciar COS en mapas genéticos de COS papa COS Solanum N=84 tuberosum COS
  29. 29. Secuenciamiento del Genoma de la Papa PGSC por Secuenciamiento de novo Ensamblaje de los Contigs a partir de insertos de 150~ 500 bp de librerías genómicas Lecturas Contigs Ensamblaje los Scaffolds a partir de insertos de 2kb. 5kb, 10kb de librerías genómicas a gran escala Scaffold Ensamblaje de superscaffold por 454, Extremos pareados Fosmid y BAC Superscaffold 中国农业科学院蔬菜花卉研究所 Institute of Vegetables and Flowers Chinese Academy of Agricultural Sciences
  31. 31. Especies Las primeras Variedades Silvestres domesticadas Modernas 4. Ampliar la base genética de caracteres de adaptación
  32. 32. Utilizando especies silvestres y cultivadas heterocigóticas Aprovechando interacciones génicas no aditivas: Método: Poliploidización sexual Uni y Bilateral Fuentes diploides Progenitores silvestres y cultivadas (2x) tetraploides (4x) Gametos 2n rap pcs chqber mcd phu x gon chm stn pur spl
  33. 33. Rescate de Embriones: Método para acceder al Acerbo Terciario Bayas Abrir las bayas en (19-27 días condiciones asépticas. después Usar cámara de flujo polinización) laminar. Extirpar bajo Estereomicrsocopio Esterilizar Superficie (Etanol Torpedo 70% 30s Polinización Hipoclorito de Ca Globular Acorazonado Transferir pro- Propagación in-vitro Plántulas de embriones (fase Transplante al en medio tres nódulos de torpedo) a invernadero Murashinge Skoog medio de cultivo
  34. 34. Híbridos inter- específicos resistentes a P. infestans desde rescate de embriones confirmados por marcadores SSR A B C D E F Group Goniocalyx × S. chiquidenum A B C D E F
  35. 35. Hibridación Inter-poblacional: Aprovechando las interacciones génicas no aditivas en papas tetraploides Ganancia genética por Heterosis Población Población Combinando B3 resistencia a virus y LTVR tizón tardío Resistencia de campo al tizón Resistencia tardío a virus Adaptación a Adaptación trópicos altos a trópicos bajos
  36. 36. Mayor frecuencia de familias heteróticas en la nueva población híbrida interpoblacional Distancias genéticas basadas en SSR útiles en la predicción de grupos heteróticos Las poblaciones progenitoras forman dos grupos claramente definidos 393242.50 391004.18 170 392639.31 160 B3 392639.8 150 B3 393280.64 140 LTVR 392637.27 130 120 LTVRB3 392650.49 110 392657.8 H% 393074.86 100 90 C97.158 80 C97.270 70 WA.077 60 C93.154 50 LTVR C97.214 40 30 LR93.309 20 C90.266 10 LR93.050 0 92.187 -10 0.40 0.50 0.60 0.70 0.80 0.90 9 10 11 12 13 14 15 16 Coeficiente de Similaridad de Jaccard Coeficiente de Similaridad de Jaccard Número de tubérculos
  37. 37. 5. Minimizar los efectos ambientales para maximizar el poder de selección 38 Air Temperature ºC 34 30 Max Day Tº 26 22 18 Max Night Tº 14 10 Oct Nov Dec Jan Feb Mar (Midmore, 1992)
  38. 38. Selección Asistida por Marcadores (MAS) Ejemplo: Resistencia Extrema al PVY CP58, CT182 Ry markers Ryadg , Rysto RYSC3, M17, Elimina efectos ambientales sobre el CD17, TG508, M5, M45, M6 fenotipo del caracter GP125 CT 168 Elimina tempranamente los genotipos TG 497 indeseables en una población de mejoramiento TG 327 TG 57 Acelera el progreso en el mejoramiento ahorrando espacio, tiempo y mejorando el CT55 uso de los recursos TG546 TG26 TG393 XI M 17
  39. 39. Selección de Progenitores Multíplices Asistida por Marcadores: Técnica de Disociación de Alta Resolución (HRM) Escaneador de Luz
  40. 40. Mejorar los métodos de tamizados masal = Mejora de estimados genéticos (más precisos). Caso: Resistencia al PLRV Inoculación en Componentes Prueba de Inoculación Genéticos de Exposición en brotes brotes Variancia Natural en Campo DE DE σ2A 190.7 72.7 264.4 98.1 σ2D 121.1 52.7 103.4 37.4 σ2AxL 18.0 14.2 13.0 8.7 σ2DxL 40.1 41.1 3.5 23.2 Exposición en σ2e 60.7 6.2 42.6 4.3 Campo σ2P 351.0 383.1 h2 0.54 0.20 0.69 0.26 Infectores σ2D/σ2A 0.64 0.39
  41. 41. Métodos Masales de Selección en Generaciones tempranas para tolerancia al calor Método en Invernadero Método in-vitro Patrones de Tuberización Tuberización Periodo Vegetativo Normal 25oC I II III IV Desórdenes Fisiológicos Inducción de tuberización
  42. 42. Herramientas para la evaluación masal de poblaciones de mejoramiento y germoplasma bajo ambientes contrastantes. Ejemplo: Estrés hídrico Cámaras Infrarrojas Termómetro Infrarrojo
  43. 43. Cámaras Infrarrojas en la captura de imágenes en tiempo real. Diferentes niveles de estrés hídrico NDVI 0-0.1 S catterplot of N DVI vs Mean Geometric 0.1-0.2 0.2-0.3 131 Env 0.6 DI TD C an ch an 118 0.5 C an ch an 135 0.3-0.4 135 126 131 U n ic a 103 128 U n ica 0.4-0.5 NDVI 124 130 0.4 Reich e 122 128 M .Bo n ita 130 118 Reich e 124 0.5-0.6 0.3 r=0.50 126 103 Fresh yield (t/ha) 0.2 5 M .Bo n ita 10 15 20 25 <16 Scatterplot of NDVI camera vs Yield Mean (t ha -1) Mea n Geome tric 0,7 M.Bonita >24 118 Env DI 131 NI 122 Reiche 130 131 TD 0,6 103 126 Canchan 128 124 Canchan 118 135 NDVI camera 135 Unica 0,5 Canchan 131 135 126 128 103 124 Unica 130 Reiche Unica 0,4 Reiche 130 M.Bonita 124 122 118 128 r=0.88 Riego Normal 0,3 126 103 M.Bonita 0,2 0,0 10,0 13,6 20,0 30,0 40,0 Yield Mean (t ha -1) Déficit de Riego Sequía terminal
  44. 44. Flujograma para manejo de Información Publicación de métodos Muestras Información de pedigrí Datos de invernadero Plataforma Repositorio Plataforma Datos de para para pública campo mejoradores Mejoradores Datos de Laboratorio Análisis de datos Calidad Reportes de datos reproducibles
  45. 45. Alianzas Estrtegicas Alcanzando Preferencias y Requisitos de Usuarios Multiples
  46. 46. Agradecimientos • W Amoros, G. Burgos, T. Zum Felde • J. Landeo, M. Gastelo • R. Schafleitner, R, Gutierrez • R. Quiroz, C. Barreda • D.Koeyer, L. Portal; R. Simon • M. Ghislain, R. Herrera • H. Villamin. S, de Haan, D. Caldiz • H. Kreuze, M. Orrillo, E. Mihovilovich, E. Salas
