Spark Summit EU talk by Erwin Datema and Roeland van Ham
•
2 gostaram•889 visualizações
High-Throughput Genomics at Your Fingertips with Apache Spark
Recomendados
Recomendados
Mais conteúdo relacionado
Mais procurados
Mais procurados (20)
Destaque
Destaque (20)
Semelhante a Spark Summit EU talk by Erwin Datema and Roeland van Ham
Semelhante a Spark Summit EU talk by Erwin Datema and Roeland van Ham (20)
Mais de Spark Summit
Mais de Spark Summit (20)
Último
Último (20)
Spark Summit EU talk by Erwin Datema and Roeland van Ham
- 1. High-throughputGenomics at Your Fingertips with Apache Spark Erwin Datema Roeland van Ham Spark Summit EU 2016, October 26, Brussels
- 2. Overview High-throughput Genomics at Your Fingertips with Apache Spark • Disclaimer : I am a scientist in computational biology (bioinformatics) • I am not a computer scientist • I am not a data scientist • Scope • KeyGene’s journey into Spark to analyze genomics data • Goal: enable interactive genomics data processing and querying • Told from a user’s perspective • Contents • Introduction to KeyGene • Crash Course Genomics • Big Data Challenges The crop innovation company 2
- 3. Global trends The crop innovation company 33 World population grows from 7 to 9 billion people in 2050 Climate change Limited/bad land, water and fossil fuels More obese people Malnourished people
- 4. Agricultural challenges The crop innovation company 4 YIELD: Producing more food on less land Population 3.0 billion Population 4.4 billion Population 6.0 billion Population 7.5 billion 4.3 hectares arable land per person 3.o hectares arable land per person 2.2 hectares arable land per person 1.8 hectares arable land per person
- 5. Genetic improvementof crops The crop innovation company 5 Molecular breeding Molecular mutagenesis Our strategy: Use of natural genetic variation in crops Not GM: At this moment too costly (20-100 mil €) Regulatory, societal and technical hurdles
- 6. About KeyGene The crop innovation company 6 working for the future of global agriculture Current shareholders Founded in 1989 > Go-to Ag Biotech company for higher crop yield & quality
- 7. R&D strategy The crop innovation company 7 Fundamental research Developing technologies & traits Applying molecular breeding of crops Breeding Seed products Market Universities KeyGene Partners breeding industry
- 8. Big Data in Genomics Relevance The crop innovation company 8 image source: https://www.genome.gov/images/content/costpermb2015_4.jpg datasource: https://www.ncbi.nlm.nih.gov/genbank/statistics/ • Genomic data is being produced on an unprecedented scale • The cost to sequence a genome is now a few thousand dollars • We can routinely sequence tens to hundreds of individual plants Totaldata volume (# bases) in NCBIGenBank
- 9. Plant Genomics Different from human genomics! The crop innovation company 9 one genome many genomes genomics as a diagnostic tool genomics as a tool to direct breeding “simple” genetics complex genetics high quality, shared resources variable quality, fragmented resources understand and cure diseases improve crop yield and quality
- 10. ~16 Gb~5.5 Gb~3.5 Gb~850 Mb~450 Mb Crash Course Genomics Plant genome sizes The crop innovation company 10 OnionWheatPepperPotatoMelon diploidhexaploiddiploidtetraploiddiploid Mb = megabases Gb = gigabases diploid = two sets of chromosomes tetraploid = four sets of chromosomes
- 11. Crash Course Genomics DNA, chromosomes, nucleotides • DNA consists of four different elements (nucleotides or bases) • We represent DNA as strings of characters from the alphabet A C G T The crop innovation company 11 • DNA is organized into chromosomes • Each chromosome contains millions of nucleotides (characters) • We can only ‘read’ short pieces of DNA (hundreds to thousands of nucleotides)
- 12. Crash Course Genomics Genes and traits The crop innovation company 12 drought tolerance fruit size genome genes • Genes are (some of) the functional elements in the genome • We represent genes as an interval on a chromosome
- 13. Crash Course Genomics Polymorphisms and their impact The crop innovation company 13 large fruits small fruits no impact
- 14. Crash Course Genomics Read alignment and variant calling The crop innovation company 14 • The ‘reference genome’ represents the known sequence of a species • Reads are aligned against the reference genome (string similarity search) • Complex: sequence variation, repetitive regions and data errors • Variants are called from differences observed in ‘pile-ups’ of reads
- 15. Crash Course Genomics Population-scale genome sequencing The crop innovation company 15 genome genes reads (individual 1) reads (individual 2) reads (individual n) 5 Gigabases 1 billionreads 1 billionreads 1 billionreads • Align a billion reads x 1,000 individuals to a 5 Gb genome • Call hundreds of millions (up to potentially billions) of sequence variants
- 16. Crash Course Genomics Recap • Genome sequences are represented as strings of A C G T • Variation between genome sequences underlies differences in traits • We can “read” the genome in little pieces • High throughput, massively parallel sequencing technologies • Up to thousands of individual plants from a given species • Genomics data analysis is challenging • Rapid increase in data generation • Rapid turnover of sequencing technologies and their outputs • Scientific software is (often) bad (Nature News, Oct 13 2010) The crop innovation company 16
- 17. Genomics data analysis High Performance Computing • Computational challenges • Align billions of reads to the reference genome • Call millions or billions of sequence variants • Determine the small number of variants that impact a given trait • HPC infrastructure (e.g. SGE clusters) are the de facto standard • Manually split large datasets (to accommodate the job scheduler) • Manually deal with failures: check logs, resubmit jobs… • Many software tools are in fact large, monolithic “pipelines” • No fine-grained control over resource usage • A single error often implies a complete re-run of the analysis The crop innovation company 17
- 18. High Performance Computing Big Data technologies The crop innovation company 18 compute node compute node compute node compute node compute node submit host compute node compute node storage storage storage storage storage storage storage storage storageserver computecluster Conventional Compute Cluster Expensive, proprietary storage Expensive network connections Expensive, high-reliability hardware Spark Cluster Sparkcluster compute + storage compute + storage compute + storage compute + storage compute + storage admin / name node compute + storage compute + storage Commodity hardware Linear scalability Fault tolerance
- 19. Genomics application landscape Opportunities for Big Data technologies 19 ? Conventional Compute Cluster Compute tool High Memory Hardware Accelerated (GPU / FPGA) Spark (and Hadoop)
- 20. Big Data in Genomics Challenges The crop innovation company 20 FASTQ SAM BAM VCF DNA sequencer reads alignments variants • Genomics is a dynamic, rapidly changing field • Data generators and analysis algorithms are in constant flux • Tools are generally built around flat, text-based file formats • Workflow is file-centric (POSIX file system; no streaming…)
- 21. Big Data in Genomics Our ‘Sparkified’ pipeline The crop innovation company 21 Scala BWA GATK4 Mark Duplicates ADAM Guacamole FASTQ HDFS SAM HDFS BAM HDFS VCF local read alignment processing variant calling
- 22. Genomics on Spark Solutions to legacy designs The crop innovation company 22 FASTQ DNA sequencer reads FASTQ reads @SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 identifier sequence separator quality RDD[String] f1.zip(f2).map (e => e._1+ e._2) ‘interleaved’ reads class FastQRecordReader extends RecordReader
- 23. Genomics on Spark Read alignment The crop innovation company 23 FASTQ FASTQ FASTQ FASTQ FASTQ RDD Scala partition 1 partition 2 partition n … BWA partition 1 partition 2 … partition n memory RDD SAM Scala HDFSHDFS perl wrapper for BWA called by rdd.pipe() class FastQRecordReader extends RecordReader sort output and add header
- 24. Genomics on Spark Processing and variant calling The crop innovation company 24 Broad Institute,Cambridge Broad Institute,Cambridge AMPlab, University of California • Alignment processing • Variant calling (in development) • Data schemas + APIs • Variant calling (Guacamole) • Variant analysis • You’ve all attended the Keynote talk…
- 25. Genomics on Spark Variant selection and analysis The crop innovation company 25 VCF Scala parquet HDFSlocal RDD tempTable SQL selection Scala VCF localmemory Variant selection phenotypes GWAS • Interactive, “real-time” selection of variant data with simple SQL queries • GWAS analysis on Spark (e.g. hail) or conventional infra (e.g. PLINK)
- 26. Big Data in Genomics KeyGene’s ambition The crop innovation company 26
- 27. Wrap-up Conclusions and lessons learnt • Initial success in applying Spark to plant genomics • Proof-of-concept for enabling interactive GWAS analysis on Spark • Spark appears to be a good fit for (some of our current) Genomics problems • Developer community needed to translate core Genomics applications! • Paradigm shift required to move away from flat POSIX files… • Opportunities for streaming data analysis The crop innovation company 27
- 28. The End High-throughput Genomics at Your Fingertips with Apache Spark The crop innovation company 28 • Erwin Datema erwin.datema@keygene.com • Roeland van Ham roeland.van-ham@keygene.com