1. Egyptian Journal of Biological Pest Control, 24(2), 2014, 421-429
Biochemical, Histological and Molecular Changes in Susceptible and Resistant Wheat
Cultivars Inoculated with Stripe Rust Fungus Puccinia striiformis f. sp. tritici
Abdelaal*, Kh. A. A.; Y. M. Hafez**; M. M. Badr**; W. A. Youseef*** and Samar M. Esmail***
*
Agric. Botany Dept. (Agric. Botany Branch, **
Plant Pathol. Branch), Fac.Agric., Kafrelsheikh Univ., Egypt
E-mail: hafezyasser@gmail.com
***
Wheat Dis. Res. Dept., Plant Pathol. Res. Inst., A.R.C., Sakha, Egypt.
(Received: September 29, 2014 and Accepted: October 30, 2014)
ABSTRACT
Stripe rust, caused by Puccinia striiformis f. sp. tritici, is one of the most disturbing diseases of wheat worldwide. Resistant
cultivars are the best strategy to control the disease. Importantly, the mechanisms of susceptibility and resistance are
required urgently. As a result of wheat inoculation, disease severity, disease symptoms and electrolyte leakage were
decreased significantly in resistant cultivars compared with susceptible ones, however, chlorophyll a and b concentrations
were increased significantly in the resistant cultivars. Yr18 resistant gene, over accumulated in resistant cultivars, resulted
in a much greater of reactive oxygen species (ROS), mainly superoxide (O2
·-
) and hydrogen peroxide (H2O2) accumulation
and lower catalase (CAT), peroxidase (POX) and polyphenol oxidase (PPO) activities together. Susceptible wheat cultivar
inoculated with P. striiformis was colonized extensively, produced large amount of spores, intercellular hyphae and
haustoria, compared with the resistant cultivar in which the haustoria and hyphae were restricted and abnormally developed.
Key words: Wheat, Stripe rust, Resistance, Histological changes, ROS, Yr18 gene.
INTRODUCTION
Wheat (Triticum aestivum L.) is one of the most
important cereal crops in the world for both human
food and animal feed; therefore, many efforts were
devoted to improve its production in Egypt.
Researchers face many problems to increase wheat
yield, one of the most serious problems is the stripe
rust (yellow rust) caused by the fungus Puccinia
striiformis f. sp. tritici (Wang et al., 2002; Chen et al.,
2003 and Mallard et al., 2005). Control of cereal
diseases is carried out by fungicide applications.
However, the application of fungicides is limited
because of the development of pathogenic strains
with fungicide resistance, the action on human health
and environmental pollution (Hafez et al., 2014).
Resistant cultivars are the most effective and
economical method of disease control (Line and
Chen, 1995). Identification, development and
deployment of resistant genotypes are the most
effective, economical and environmentally friendly
approach for controlling this disease (Chen, 2009).
For these reasons, advanced studies were conducted
to explain structural components and molecular
mechanisms of resistance response in wheat (Wang et
al., 2010).
Resistant host plant is the most effective means to
control the rust disease, therefore, planting resistant
cultivars is recommended. However, different races
of the fungus can occur from one year to the next and
might overcome resistance. Infections of plants by
microorganisms (mostly fungi, bacteria and viruses)
in many cases are associated with accumulation of
reactive oxygen species (ROS) which induce
oxidative stress in plants. Under natural conditions,
up-regulation of antioxidant defense systems seems
to be a general response to oxidative stress (Hafez and
El-Baghdady, 2013). Hydrogen peroxide (H2O2) and
superoxide (O2
.-
) are the most important ROS
associated with oxidative stress, can up-regulate
antioxidant systems even at very low concentrations
(Gechev et al., 2002 and Hafez et al., 2012). ROS are
produced by all aerobic organisms as inevitable by-
products of several metabolic pathways, including
electron flows in mitochondria and chloroplasts, lipid
catabolism and photorespiration in glyoxysomes and
peroxisomes, as well as enzymatic oxygenase
reactions having a different cellular localization. In
order to avoid ROS toxicity, aerobic cells are
provided with a flexible set of enzymes and
metabolites involved in ROS catabolism, which often
acts at the site of ROS production. Although much
metabolic energy is spent on ROS removal by plant
cells, ROS are also actively produced by cell
metabolism under optimal growth conditions (Heath,
2000). Fortunately, cells make a variety of
antioxidant enzymes to fight the dangerous side-
effects of life with oxygen. Two important players are
superoxide dismutase, which converts O2
.-
into H2O2,
and catalase, which converts H2O2 into water and
oxygen gas (Apel and Hirt, 2004).
The aim of this research was to study the
mechanisms of susceptibility and resistance of some
wheat cultivars in relation to biochemical,
histological and molecular changes which are very
important for plant breeders to produce new resistant
cultivars resulted in high national income.
MATERIALS AND METHODS
Plant materials
The research was carried out in a greenhouse of
Wheat Pathology Department, Agricultural Research
Station (ARC), Sakha, Kafrelsheikh, Egypt, for two

2. 422
growing seasons 2012/13 and 2013/14. Moroccan
and ten Egyptian wheat cultivars (Giza 160, Giza 168,
Giza 171, Sakha 93, Sakha 94, Misr 1, Misr 2, Sids
12, Sids 13 and Gemmiza 11) were used for this
study. Ten seeds of each cultivar were sown in each
plastic pot (7cm diam.) in a formalin sterilized soil
mixture (5:2:1 v/v/v) of clay, sand and peat moss.
Pots were placed in trays covered with plastic lids to
ensure high humidity during germination and then
moved to spore-proof greenhouse cabins. An artificial
light of 50–100 μEm-2
s-1
was applied when daylight
was less than 10 000 lux. Alternating periods of 16
hours light (17o
C) and 8 hours darkness (12o
C) were
used before and after inoculation.
Fungal inoculation
Spores were harvested from infected seedlings of
the susceptible Moroccan cultivar which was shaken
48 hours prior to spore harvesting. Fresh spores were
mixed 1:5 (w/w) with talcum and immediately used
to inoculate the second green leaf of 16- days- old
seedlings. Spores were applied to the leaf by using a
camel hair brush size 1. This method resulted in a
colony density sufficient to give an appropriate
number of non-overlapping infection sites at the early
infection stages which allowed robust estimates of the
observed parameters. Five replicate pots of seedlings
were inoculated for each cultivar. After inoculation,
plants were placed in trays, sprayed with water and
covered to keep 100% fresh during incubation at 10o
C
for 22 hours. After incubation, pots were transferred
to the greenhouse and randomized in a spore-proof
cabin with light and temperature conditions as
described before (Chris, 2012).
Disease severity
Infection types were scored at approximately two
weeks after inoculation. The infection types were the
same as described by McNeal et al. (1971). Plants
with infection types 0, 1, 2, 3, 4 and 5 are considered
resistant (R) or having low infection type, while
infection types 6, 7, 8 and 9 are considered
susceptible (S) or highly infection type (Table 1).
Activities of antioxidant enzymes
For enzyme assays in plants, 0.5 g fresh treated
wheat leaf material was homogenized at 0-4˚C in 3
ml of 50 mM TRIS buffer (pH 7.8), containing 1 mM
EDTA-Na2 and 7.5% polyvinylpyrrolidone. The
homogenates were centrifuged (12,000 rpm, 20 min,
4˚C) and the total soluble enzyme activities were
measured spectrophotometrically in the supernatant.
All measurements were carried out at 25°C, using the
model UV-160A spectrophotometer (Shimadzu,
Japan). Activity of CAT was determined according to
Aebi (1984). Polyphenol oxidase (PPO) activity was
determined according to Malik and Singh (1980).
Peroxidase (POX) activity was directly determined
according to a typical procedure proposed by
Hammerschmidt et al. (1982).
Detection of O2
·-
and H2O2
O2
·-
and H2O2 were visualized as a purple coloration
of nitro blue tetrazolium (NBT) and a reddish-brown
coloration of 3,3-diaminobenzidine (DAB), respectively.
Wheat leaves were vacuum infiltrated with 10 mM
potassium salicylate buffer (pH 7.8) containing 0.1 w/v
% NBT (Sigma-Aldrich, Steinheim, Germany) or 0.1
w/v % DAB (Fluka, Buchs, Switzerland). NBT- and
DAB-treated samples were incubated under daylight for
20 min and 2 hours, respectively and subsequently
cleared in 0.15 w/v % trichloroacetic acid in
ethanol:chloroform 4:1 v/v for 1 day (Hückelhoven et
al., 1999). Cleared samples were washed with water and
placed in 50% glycerol prior to be ready for evaluation.
Discoloration of leaves could be quantified using
nicked eyes or a ChemiImager 4000 digital imaging
system (Alpha Innotech Corp., San Leandro, USA).
Electrolyte leakage
Twenty leaf discs (1 cm2
) of wheat leaves were
placed individually into flasks each contained 25 mL
deionized water (Milli-Q 50, Millipore, Bedford,
Mass., USA). Flasks were shaken for 20 hr at ambient
temperature to facilitate electrolyte leakage from
injured tissues. Initial electrical conductivity
measurements were recorded for each vial using an
Acromet AR20 electrical conductivity meter (Fisher
Scientific, Chicago, IL). Flasks were then immersed
in a hot water bath (Fisher Isotemp, Indiana, PA) at
80°C (176°F) for 1 hr to induce cell rupture. The vials
were again placed on the Innova 2100 platform
shaker for 20 hr at 21°C (70°F). Final conductivity
Table (1): Infection types and classes of stripe rust reaction according to McNeal et al. (1971)
Infection type Infection type Disease symptoms Symbol
0 Immune No visible infection O
1 Highly Resistant Necrotic/ chlorotic flecks, without sporulation HR
2 Resistant Necrotic/chlorotic stripes, without sporulation R
3 Moderately Resistant Trace sporulation, necrotic/chlorotic stripes MR
4 Light Moderately Light sporulation necrotic/chlorotic stripes LM
5 Moderate Inter mediate sporulation, necrotic/chlorotic stripes M
6 High Moderately Moderate sporulation, necrotic/chlorotic stripes HM
7 Moderately Susceptible Abundant sporulation, necrotic/chlorotic stripes MS
8 Susceptible Abundant sporulation, with chlorotic S
9 Very Susceptible Abundant sporulation, without chlorotic VS

3. 423
was measured for each flask. Electrolyte leakage
Percentage for each bud was calculated as: initial
conductivity/final conductivity × 100 M according to
Szalai et al. (1996).
Chlorophyll a and b
Chlorophyll (Chl.) concentration as mg/g fresh
weight of one gram fresh leaves was extracted with 5
ml dimethyl-formamid for overnight at 5°C, then
estimated chlorophyll a and chlorophyll b
spectrophotometerically at 663 and 647 nm as
described by Moran and Porath (1982). The
concentrations were calculated using the following
equations:
Chl. a = 12.76 A663 – 2.79 A647 (mg/l), Chl. b
= 20.76 A647 – 4.62 A663 (mg/l).
Histological examination
Anatomical structure of infected and protected
wheat leaves was studied with scanning Electron
Microscope (SEM) and Transmission Electron
Microscope (TEM). For SEM examination, wheat
leaves were taken (4mm²) from susceptible and
resistant leaves and immediately fixed in
glutraldhyde (2.5%) for 24 hrs at 4°C, then post-fixed
in osmium tetraoxide (1% OS04) for one hour at
room temperature (Harley and Fergusen, 1990).
Samples were dehydrated with passing through
ascending concentrations of acetone (30-100%).
Samples were dried till the critical point finally, leaf
was sputter coated with gold. The examination and
photographing were done through a Jeol Scanning
Electron Microscopy (T.330 A). For TEM
examination, leaf tissues were cut to small pieces (1-
2mm), fixed in 4% glutaraldehyde in phosphate
buffer (0.1 M, pH 7.2), rinsed thoroughly with the
same buffer and fixed in 1% osmium tetroxide. After
thorough rinsing with phosphate buffer, the samples
were dehydrated in a graded acetone series to 100%,
and embedded in Epon 812. Ultrathin sections were
cut with a diamond knife, mounted on uncoated
copper grids, stained with 2% aqueous uranyl acetate
and lead citrate, then examined with a JEOL JEM-
200EX Transmission Electron Microscope according
to Ma and Shang (2009).
DNA extraction
Total DNA of wheat seedlings was extracted from
60 mg of fresh leaves which initially were mashed in
liquid nitrogen with a mortar and pestle using
Invisorb® Spin Plant Mini Kit (STRATEC
Molecular, Germany) according to manufacturer’s
instructions.
Condition and amplification of PCR
Amplification of yr18 regions were conducted in
an automated thermal cycler (C1000TM
Thermal
Cycler, Bio-RAD) using the primer Sequences of
Yr18 gene(L34DINT9-R11), primers are listed
as follows as mentioned by LagudahHYPERLINK
"http://maswheat.ucdavis.edu/protocols/FunctionalMa
rkers/FM_disease.htm" et al.,
2009. (F5’TTGATGAAACCAGTTTTTTTTCTA3’
and R5’GCCATTTAACATAATCATGATGGA 3’).
with one cycle pre-denaturation at 94 ºC for 3 min.
Amplification step: (30 cycles ): 940
C, 300sec
for denaturation., 48 0
C, 60 sec for annealing, 720
C,
60 sec for extension & final extension at 720
C,
5min.
PCR mixture for Yr genes detection
Each PCR mixture (25 µl) was prepared as follows,
(1 µl) of 25 ng nucleic acid, 1 µl of each primer (10
pmol), (12.5 µl) of GoTag®Colorless Master Mix
(Promega Corporation, USA) and 9.5 µl of Nuclease
free water (Promega). 15 µl of all PCR products were
analyzed by electrophoresis through a 1.5% agarose
gel, stained with ethidium bromide, and DNA bands
were visualized using a UV transilluminator.
Statistical analysis
Three experiments were conducted in a complete
randomized design with three replicates for each
treatment. Data represented by the mean±SD.
Student’s t-test was used to determine whether
significant difference (P<0.05) existed among mean
values according to O'Mahony (1986).
RESULTS AND DISCUSSION
Infection type, disease severity and disease
symptoms on inoculated wheat cultivars
Obtained results indicated that the infection types
of stripe rust wheat on cultivars, inoculated with
P. striiforms, showed great variations among all
cultivars. Moroccan and Giza 160 cultivars showed
infection types of susceptibility (S). Giza 168 and Sids
12 cultivars were moderately susceptible (MS) against
P. striiforms. Giza 171, Sakha 93, Sakha 94, Sids
13 and Gemmiza 11 cultivars were moderately
resistance (MR). Misr 1 and Misr 2 cultivars showed
the infection type of resistance (R) in the seedling stage
(Table 2). Interestingly, similar infection types were
obtained in the adult stage (Table 2).
Table (2): Infection types of stripe rust on eleven wheat cultivars in seedling and adult stage
Growth stage Morocco G. 160 G. 168 G. 171 S. 93 S. 94 Misr 1 Misr 2 Sids 12 Sids 13 Gem. 11
Seedling stage 9 8 7 6 7 7 4 4 6 2 2
Adult stage 100 S 80 S 10 MS 10 MR 10 MR Tr MR R Tr R 10 MS 10 MR Tr MR

4. 424
Fig. (1): Disease severity percentage (%) in
susceptible and resistant wheat cultivars
inoculated with P. striiformis. Moroccan:
susceptible cultivars (cv), G.160: Giza160
susceptible cv, G.168: Giza168 moderately
susceptible cv, G.171: Giza171 moderately
resistant cv, S.93: Sakha93 moderately resistant,
S.94: sakha 94 moderately resistant, Misr.1:
resistant, Misr.2: resistant, Sids.12: moderately
susceptible cv, Sids.13: moderately resistant cv
and Gem.11: Gemmiza 11 moderately resistant cv.
Disease severity percentage significantly decreased
in all cultivars as compared with Moroccan and Giza
160 cultivars which showed susceptibility reactions
to P. striiforms (Fig. 1). Similarly, disease symptoms
were suppressed significantly on all cultivars, except
the susceptible Moroccan and Giza 160 cultivars
(Fig. 2).
Levels of reactive oxygen species (ROS) and
activity of antioxidant enzymes
Levels of ROS, mainly hydrogen peroxide (H2O2)
and superoxide (O2
·-
) increased significantly in all of
wheat cultivars inoculated with P. striiformis, except
the two susceptible Moroccan and Giza 160 cultivars
(Fig. 3). During photosynthesis, ROS appeared
continuously in the chloroplasts by partial reduction of
O2 molecules or energy transfer to them. Production of
ROS is an inevitable consequence of aerobic
respiration. When the terminal oxidases-cytochrome
oxidase and the alternative oxidase react with O2, four
electrons are transferred and H2O is released. It was
noted that O2
·-
was usually the first ROS to be
generated. In plant tissues, about 1-2% of O2
consumption led to the generation of O2
·-
. It has been
well established that excess of H2O2 in plant cells leads
to the occurrence of oxidative stress (Hafez et al., 2012
and 2014). These results showed elevated levels of
H2O2 and O2
·-
in resistant wheat cultivars resulted in
less damage in the cells. Levels of ROS increased when
antioxidants decreased. Similarly, in resistant Egyptian
and other wheat cultivars inoculated with leaf rust (P.
triticina), H2O2 has a key role in resistance (Hafez et
al., 2009). Interestingly enough that the antioxidant
enzymes activities catalase, peroxidase and polyphenol
oxidase increased as a result of inoculation in all
cultivars however, these activities were a little bit
higher in susceptible and in even moderately
susceptible cultivars as compared to other moderately
resistant and resistant ones in which they were
significantly decreased (Fig. 4).
Results of this research showed that activity of
antioxidant enzymes were increased significantly in all
the tested wheat cultivars as a result of fungal
inoculation. The first response following oxidative
burst was the activation of ROS scavenging enzymes.
Similar results were obtained by Anahid et al. (2013).
Components of antioxidant defense system are
enzymatic and non-enzymatic antioxidants. Enzymatic
antioxidants include superoxide dismutase (SOD),
catalase (CAT), ascorbate peroxidase (APX),
peroxidase (POX) and polyphenol oxidase (PPO) and
non-enzymatic antioxidants are glutathione (GSH),
carotenoids and tocopherols. The up-regulation of
CAT, POX and PPO plays vital role during elevated
the ROS levels thereby, protected resistant wheat
cultivars from pathogen attack. Similarly, tobacco
plants were protected against viral, bacterial and fungal
infections (Hafez et al., 2012 and 2014).
Electrolyte leakage and concentration of
chlorophyll a and b
Electrolyte leakage (EL) constitutes as an indicator
of the membrane permeability. All wheat cultivars
inoculated with P. striiformis showed highest
significant reduction in electrolyte leakage, except
Moroccan and Giza 160 cultivars which showed
significant increase of the membrane permeability
(Fig. 5). Chemical compounds and biotic or abiotic
stresses could alter the resistance or susceptibility of
plants to infection through their effects on membrane
permeability (Hafez et al., 2014). It is known that
ethylene affects membrane permeability (Goodman et
al., 1986). Similarly, high temperature stress could
induce susceptibility in maize through its effect on
membrane permeability as measured by increased
electrolyte leakage (Garraway et al., 1989). This might
result in the loss of host cells' constituents which may
be used by the invading pathogen as a source of
nutrients. These results indicated that resistance of
some wheat (cultivars cvs) protected cell membranes
during the pathogen attack, while the cell membrane of
the susceptible cultivars was affected by the pathogen
inoculation and lost its constituents. The present results
are in agreement with those obtained by (Houimli et
al., 2010 and Hafez et al., 2014).
In all treatments either inoculated only or
pretreated before inoculation, chlorophyll a and b
concentrations were increased in all cultivars, except
the susceptible Moroccan and Giza 160 cultivars.
However, in pre-treated wheat with fungicide (Tilt)
before inoculation, chlorophyll a and b concentrations
0
20
40
60
80
100
120
%ofDiseaseseverity

5. 425
Fig. (2): Disease symptoms on susceptible and resistant wheat cultivars inoculated with wheat stripe rust P.
striiformis.
Fig. (3): Accumulation of reactive oxygen species (ROS). Purple discoloration of superoxide (upper row) and
brown discoloration of hydrogen peroxide (lower row) in susceptible and resistant wheat cultivars
inoculated with wheat stripe rust fungus P. striiformis.
Morocco G.160 G.168 G.171 S. 93 S.94 Misr 1 Misr 2 Sids 12 Sids 13 Gem.11

6. 426
Fig. (4): Activities of catalase (CAT), peroxidase (POX) and polyphenol oxidase (PPO) enzymes in susceptible
and resistant wheat cultivars inoculated with wheat stripe rust P. striiformis.
Fig. (5): Electrolyte leakage and concentration of chlorophyll a and chlorophyll b in susceptible and resistant
wheat cultivars inoculated with wheat stripe rust fungus P. striiformis. Infected: leaves inoculated with the
pathogen only. Protected: leaves pre-treated with fungicides and inoculated with the pathogen.

7. 427
Susceptible Resistant Susceptible Resistant
Fig. (6): Fungal development and host cell responses by SEM in susceptible and resistant wheat cultivars
(Morocco and Misr2) inoculated with wheat stripe rust fungus P. striiformis. A. Spores of P. striiformis in
susceptible wheat leaves cv. Morocco. Bar = 10 μm., B. Spores (small and shranked) of P. striiformis in
resistant wheat leaves cv. Misr2. Bar = 10 μm., C. Many sori contain large amount of spores in susceptible
wheat leaves cv. Morocco. Bar = 100 μm., D. One sorus contains little amount of spores in resistant wheat
leaves cv. Misr2. Bar = 50 μm. S: spores; So: sorus.
Susceptible
Resistant
Fig. (7): Fungal development and host cell responses by TEM in susceptible and resistant wheat cultivars
(Morocco and Misr2) inoculated with wheat stripe rust, P. striiformis. A. Intercellular hypha. Bar = 2 μ.,
B. Haustorial mother cell vacuolated. Bar = 2 μ., C. Haustorial mother cell. Bar = 2 μ, D. Chloroplast has
normal shape in resistant wheat leaf. Bar = 500 nm., E. Chloroplast has abnormal shape in susceptible wheat
leaf. Bar = 500 nm., F. The organelles disintegrated into vesicles around the haustoria and chloroplast has
normal shape. Bar = 2 μ., IH: intercellular hypha; HMC: haustorial mother cell; Ch: chloroplast; H:
haustorium; CW: cell wall.
Fig. (8): Accumulation of Yr18 resistant gene in susceptible and resistant wheat cultivars inoculated with wheat
stripe rust fungus P. striiformis. M.: 100 bp size lader. YR18: monogenic line.

8. 428
were increased significantly as compared to the same
cultivars which were inoculated only (Fig. 5).
Infection with P. striiformis led to a loss of
chlorophyll, thereby, leaves became yellow
(chlorotic). Similar results were recorded by
Moriondo et al. (2005) and Lindenthal et al. (2005)
in infected squash plants by downy mildew. Spread
of the pathogen hypha and its penetration in host cells
by haustoria were thought to destabilize the structural
integrity, which reduced chlorophyll pigments
(Lindenthal et al. 2005). The reduction of chlorophyll
concentrations was due to the decrease in the number
and abnormal form of chloroplasts in the mesophyll
tissue. Chlorophyll concentration was decreased
gradually with the increase in disease severity
(Mandal et al. 2009).
Histological changes
Inoculated leaves of the susceptible wheat cultivar
such as the Moroccan was colonized extensively by
P. striiformis, the cause of stripe rust, producing
many sori, large amounts of spores (Fig. 6 a and c),
as well as intercellular hyphae and haustoria, the wall
of the haustoria was smooth(Fig. 7a and c). The
haustoria penetrate mesophyll cells causing
plasmolysis. After haustoria formation, the host
organelles such as chloroplasts showed abnormal
shape and often collected next to the haustoria (Fig.
7e). On the other hand, in the mesophyll cells of the
resistant cultivars such as Misr 2 were colonized only
to a limited extent, producing a very little number of
sori contained small shranked spores in the infection
sites (Fig. 6b and d), the cell wall was thickened,
fungal development was markedly restricted for only
a very limited number of abnormal hyphae and
haustoria. Similarly, in resistant wheat cultivars, the
hyphal wall appeared thickened, haustorial mother
cells were vacuolated, the host organelles were
disintegrated into vesicles around the haustoria and
chloroplast was of normal shape (Fig. 7b, d and f) as
described by Ma and Shang (2009).
Accumulation of yr18 gene in wheat cultivars
In resistant wheat cultivars inoculated with P.
striiformis, yr18 gene was significantly accumulated
compared with the susceptible cultivars (Fig. 8).
Wheat plants have six chromosomal (A, B, D) in
which perhaps play partial role in increasing the DNA
amount, therefore increasing Yr18 cops in the
resistant genome. The Yr18/Lr34/Pm38 locus confers
partial and durable APR against leaf rust, stripe rust
and powdery mildew of wheat (Lagudah et al., 2009).
Yr18 resistant gene over accumulated in resistant
cultivars resulted in a much greater of ROS mainly
O2
·-
and H2O2 accumulation and lower CAT, POX and
PPO activities together. Similar results were obtained
by Feng et al., 2014.
It can be concluded that the disease severity and
symptoms were suppressed in the resistant wheat
cultivars because of the Yr18 resistant gene and ROS
accumulation which perhaps decreased the enzyme
activities and electrolyte leakage compared with
susceptible cultivars.
ACKNOWLEDGMENTS
This research was conducted and funded by Plant
Pathology and Biotechnology Lab., (under
accreditation of ISO/17025) and EPCRS Excellence
Centre, Dept. of Agric. Botany, Fac. of Agric., Kafr-
Elsheikh University, Kafr-Elsheikh, Egypt. The
EPCRS Excellence Centre Project funded by
Management Supporting Excellence (MSE),
Development Projects Management Unit, Ministry of
Higher Education, Egypt (16.02.2014 - 16.02.2016).
REFERENCES
Aebi, H. 1984. Catalase in vitro. Methods Enzymol.
105: 121-126.
Anahid, F., M. Zaeifizadeh, H. Shahbazi and M.
Ghasemi 2013. Interaction between wheat
cultivars and stripe rust strain on the screening of
different defense strategies, Int. J. Agric. Plant
Prod. 4 (10): 2598-2605.
Apel, K. and H. Hirt 2004. Reactive oxygen species:
metabolism, oxidative stress and signal
transduction. Annu. Rev. Plant Biol. 55, 373–399.
Chen, X., A. S. Marcelo, Y. Guiping, S. Jun and J.
Dubcovsky 2003. Development of Sequence
Tagged Site and Cleaved Amplified Polymorphic
Sequence Markers for Wheat Stripe Rust
Resistance Gene Yr5. Crop Sci. 43: 2058-2064.
Chen, W. Q., L. R. Wu, T.G. Liu, S. C. Xu, S. L. Jin,
Y. L. Peng and B. T. Wang 2009. Race dynamics,
diversity, and virulence evolution in Puccinia
striiformis f. sp. tritici, the causal agent of wheat
stripe rust in China from 2003 to 2007. Plant Dis.
93:1093-1101
Chris, K. S. 2012. Infection biology and
aggressiveness of Puccinia striiformis on
Resistant and Susceptible Wheat. Ph D Thesis,
Fac. Science and Technology, Aarhus Univ., 139
pp.
Feng, H., X. Wang, Q. Zhang, Y. Fu, C. Feng,
B. Wang, L. Huang and Z. Kang 2014.
Monodehydroascorbate reductase gene, regulated
by the wheat PN-2013 miRNA, contributes to
adult wheat plant resistance to stripe rust through
ROS metabolism. Biochim. Biophys. Acta. 1839
(1):1-12.
Garraway, M. O. M. Akhtar and E. C. W. Wokoma
1989. Effect of high temperature stress on
peroxidase activity and electrolyte leakage in
relation to sporulation of Bipolaris maydis race T.
Phytopathol., 79: 800-805.
Gechev, T., I. Gadjev, F. Van Breusegem, D. Inzé, S.
Dukiandjiev, V. Toneva, and I. Minkov 2002.

9. 429
Hydrogen peroxide protects tobacco from oxidative
stress by inducing a set of antioxidant enzymes.
Cell. Mol. Life Sci. 59:708–714.
Goodman, R. N., Z. Kiraly and K. R. Wood 1986. The
Biochemistry and Physiology of Plant Disease.
University of Missouri Press, Columbia, MO. Pp.
433.
Hafez Y. M., Z. Király and K. Manninger 2009.
Hydrogen peroxide has a key role in resistance to
leaf rust (Puccinia triticina) in several Egyptian
and other wheat cultivars. Cereal Res. Commun.,
37: 161-164.
Hafez, Y. M., R. Bacso, Z. Király. A. Kunstler and L.
Király 2012. Up-regulation of antioxidants in
tobacco by low concentrations of H2O2 suppresses
necrotic disease symptoms. Phytopathol.,
102:848-856.
Hafez, Y. M. 2013. A pivotal role of reactive oxygen
species and antioxidants to attenuate Tobacco
Mosaic Virus. Egypt. J. Biol. Pest Cont., 23(2):
277-285.
Hafez, Y. M. and N. A. El-Baghdady 2013. Role of
reactive oxygen species in suppression of barley
powdery mildew fungus, Blumeria graminis f.sp.
hordei with benzothiadiazole and riboflavin.
Egypt. J. Biol. Pest Cont., 23(1): 125-132.
Hafez, Y. M., N. K. Soliman, M. M. Saber, I. A.
Imbabi and A. S. Abd-Elaziz 2014. Induced
resistance against Puccinia triticina the causal
agent of wheat leaf rust by chemical inducers.
Egypt. J. Biol. Pest Cont., 24(1): 173-181.
Hammerschmidt, R., E. M. Nuckles and J. Kuć 1982.
Association of enhanced peroxidase activity with
induced systemic resistance of cucumber to
Colletotrichum lagenarium. Physiol. Plant Pathol,
20(1):73-82.
Harley, M. M. and I. K. Ferguson 1990. The role of
the SEM in pollen morphology and plant
systematics. In: Claugher, D. (ed.) Scanning
Electron Microscopy in Taxonomy and Functional
Morphology. Sys. Assoc. Spe., pp. 45-68,
Clarendon Press, Oxford.
Heath, M. 2000. Hypersensitive response related
death. Plant Mole Biol.44: 321‐ 334.
Houimli, S. M., M. Denden and B. D. Mouhandes
2010. Effects of 24-epibrassinolide on growth,
chlorophyll, electrolyte leakage and proline by
pepper plants under NaCl-stress. Eur. Asia. J. Bio.
Sci., 4: 96-104.
Hückelhoven, R., J. Fodor, C. Preis and K. H. Kogel
1999. Hypersensitive cell death and papilla
formation in barley attacked by the powdery
mildew fungus are associated with hydrogen
peroxide but not with salicylic acid accumulation.
Plant Physiol., 119: 1251-1260.
Lagudah, E. S., S. G. Krattinger, S. Herrera-Foessel,
R. P. Singh, J. Huerta- Espino, W. Spielmeyer. G.
Brown-Guedira, L. L. Selter and B. Keller 2009.
Gene-specific markers for the wheat gene
Lr34/Yr18/ Pm38 which confers resistance to
multiple fungal pathogens. Theor. Appl. Genet.,
119:889–898.
Line, R. F. and X. M. Chen 1995. Successes in
breeding for and managing durable resistance to
wheat rusts. Plant Dis. 79: 1254-1255.
Lindenthal, M., U. Steiner, H. W. Dehne and E. C.
Oerke 2005. Effect of downy mildew
development on transpiration of cucumber leaves
visualized by digital infrared thermography.
Phytopathol. 95: 233-240.
Ma, Q. and H. S. Shang 2009. Ultrastructure of stripe
rust (Puccinia striiformis f. sp. tritici) interacting
with slow-rusting, highly resistant, and
susceptible wheat cultivars. J. Plant Pathol. 91:
597-606.
Mallard, S., D. Gaudet, A. Aldeia, C. Abelard, A.L.
Besnard, P. Sourdille and F. Dedryver 2005.
Genetic analysis of durable resistance to yellow
rust in bread wheat. Theor. Appl. Genet. 110(8):
1401-1409.
Malik, C. P. and M. B. Singh 1980. In: Plant
Emynology and Histoenzymology. Kalyani
Publishers. Indian and Printed in Navin.
Shanndara. Delhi PP. 54-56.
Mandal, K., R. Saravanan, S. Maiti and I. L. Kothari
2009. Effect of downy mildew disease on
photosynthesis and chlorophyll fluorescence in
Plantago ovata Forsk. J. Plant Dis. Prot., 116 (4):
164-168.
Mc Neal, F. H., C.S. Konzak, E. P. Smith. W. S. Tate
and T. S Russel 1971. A uniform system for
recording and processing cereal data. USDA ARS
34-121.
Moran, R. and D. Porath 1982 Chlorophyll
determination in intact tissues using N,N-
Dimethyl formamide. Plant Physiol., 69: 1370-
1381.
Moriondo, M., S. Orlandini, A. Giuntoli and M. Bindi
2005. The effect of downy and powdery mildew
on grapevine (Vitis vinifera L.) leaf gas exchange.
J. Phytopathol. 153, 350-357.
O'Mahony, M. 1986. Sensory Evaluation of Food:
Statistical Methods and Procedures. CRC Press, p.
487.
Szalai, G., T. Janda, E. Pa ldi and Z. Szigeti 1996.
Role of light in post-chilling symptoms in maize.
J. Plant Physiol., 148: 378-383.
Wang, L. F., J. X. Ma, R. H. Zhou, X. M. Wang and
J. Z. Jia 2002. Molecular tagging of the yellow rust
resistance gene Yr10 in common wheat, P.I.17838
(Triticum aestivum L.). Euphytica 124: 71-73.
Wang, X., W. Liu, X. Chen, C. Tang, Y. Dong, J. Ma,
X. Huang, G. Wei, Q. Han, L. Huang and Z. Kang
2010. Differential gene expression in
incompatible interaction between wheat and stripe
rust fungus revealed by cDNA-AFLP and
comparison to compatible interaction. BMC Plant
Biol. 10:9-15