1. BASIC RESEARCH www.jasn.org
The Basic Domain of HIV-Tat Transactivating Protein Is
Essential for Its Targeting to Lipid Rafts and
Regulating Fibroblast Growth Factor-2 Signaling
in Podocytes Isolated from Children with
HIV-1–Associated Nephropathy
Xuefang Xie,* Anamaris M. Colberg-Poley,*†
Jharna R. Das,* Jinliang Li,* Aiping Zhang,*
Pingtao Tang,*†
Marina Jerebtsova,*†
J. Silvio Gutkind,‡
and Patricio E. Ray*†§
*Center for Genetic Medicine Research and §
Division of Nephrology, Children’s National Medical Center,
Washington, DC; †
Department of Pediatrics, George Washington University, Washington, DC; and ‡
Oral and
Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research, National Institutes of Health,
Bethesda, Maryland
ABSTRACT
Podocyte injury has a critical role in the pathogenesis of HIV-associated nephropathy (HIVAN). The HIV-1
transactivator of transcription (Tat), combined with fibroblast growth factor-2 (FGF-2), can induce the
dedifferentiation and proliferation of cultured human podocytes. Cellular internalization of Tat requires
interactions with heparan sulfate proteoglycans and cholesterol-enriched lipid rafts (LRs). However, the
specific distribution of Tat in human podocytes and its ability to associate with LRs have not been
documented. Here, we found that Tat is preferentially recruited to LRs in podocytes isolated from children
with HIVAN. Furthermore, we identified arginines in the basic domain (RKKRRQRRR) of Tat as essential for (1)
targeting Tat to LRs, (2) Tat-mediated increases in the expression of Rho-A and matrix metalloproteinase-9 in
LRs, and (3) Tat-mediated enhancement of FGF-2 signaling in human podocytes and HIV-transgenic mouse
kidneys and the exacerbation of renal lesions in these mice. Tat carrying alanine substitutions in the basic
domain (AKKAAQAAA) remained localized in the cytosol and did not associate with LRs or enhance FGF-2
signaling in cultured podocytes. These results show the specific association of Tat with LRs in podocytes
isolated from children with HIVAN, confirm Tat as a regulator of FGF-2 signaling in LRs, and identify the key
domain of Tat responsible for promoting these effects and aggravating renal injury in HIV-transgenic mice.
Moreover, these results provide a molecular framework for developing novel therapies to improve the clinical
outcome of children with HIVAN.
J Am Soc Nephrol 25: 1800–1813, 2014. doi: 10.1681/ASN.2013070710
HIV-associated nephropathy (HIVAN) is a progres-
sive renal disease seen in HIV-infected patients from
Africanancestry.OnefeaturecharacteristicofHIVAN
isthecollapseofglomerularcapillariesassociatedwith
the dedifferentiation and proliferation of podocytes.1
These changes affect the glomerular filtration bar-
rier2 and cause heavy proteinuria and renal failure.
Previous studies suggest that podocytes can be pro-
ductively infected in vivo3 and that cells derived from
the parietal epithelium4,5 may also be affected. In
addition, circulating viral proteins and cytokines re-
leased byHIV-infectedcellscan induce renalinjury as
well.1 In this regard, the HIV-1 transactivator of tran-
scription (Tat) protein has received significant
Received July 10, 2013. Accepted December 19, 2013.
Published online ahead of print. Publication date available at
www.jasn.org.
Correspondence: Dr. Patricio E. Ray, Centers for Genetic Med-
icine Research and Division of Nephrology, Children’s National
Medical Center, 111 Michigan Avenue NW, Washington, DC
20010. Email: Pray@childrensnational.org
Copyright © 2014 by the American Society of Nephrology
1800 ISSN : 1046-6673/2508-1800 J Am Soc Nephrol 25: 1800–1813, 2014

2. attention, because it is a transcription factor that enhances viral
replication; it can also be released and taken up by noninfected
cells. In this manner, Tat can affect the function of podocytes
acting through at least two different mechanisms.6–8 A concen-
tration of Tat within the range detected in sera of HIV-infected
patients9,10 can cause glomerular permeability changes in vivo11
and induce the proliferation of cultured podocytes by stimulat-
ing the release of fibroblast growth factor-2 (FGF-2).12 Indeed,
high plasma, kidney, and urinary levels of FGF-2 are detected in
children with HIVAN,13,14 and FGF-2 is accumulated in the
kidney of HIV-Tg26 mice with renal disease.15–17 Overall, these
studies suggest that both Tat and FGF-2 may play a role in the
pathogenesis of childhood HIVAN.
Extracellular Tat and FGF-2 specifically bind and interact
with negatively charged cell-surface heparan sulfate proteo-
glycans (HSPGs).6,18–20 Tat entry into cells is facilitated by an
endocytic pathway that originates in lipid rafts (LRs) and in-
volves caveolar endocytosis21 or LR-dependent macropinocy-
tosis.22 LRs are specialized membrane domains enriched in
certain lipids, cholesterol, and proteins that serve as docking
sites for signaling proteins, including G protein–coupled re-
ceptors.23–25 They are resistant to low-temperature solubiliza-
tion by nonionic detergents, and this property allows for their
separation by differential flotation after density-gradient cen-
trifugation in low-density fractions that are called detergent-
resistant membranes (DRMs).23 Actin binding proteins bind
to polyphosphoinositides located in LRs, and these proteins
link the actin cytoskeleton with signaling molecules that are
enriched in the LRs.23 In fact, activation of G protein–coupled
receptors by HIV-Tat in brain endothelial cells results in the
stimulation of small guanosine 59‑triphosphatase of the Rho-
family, which in turn, activate Rho-kinase and the myosin
binding subunit of the myosin light chain (MLC).26,27 More-
over, activation of the Rho-A pathway in podocytes can cause
chronic renal failure in transgenic mice.28 Therefore, we car-
ried out this study to determine whether Tat, alone or com-
bined with FGF-2, can induce cytoskeletal changes in cultured
podocytes acting through an LR-mediated Rho-signaling
Figure 1. Podocytes cultured from the urine of children with HIVAN express WT-1, synaptopodin, and nestin. A–D show light mi-
croscopy images of (A and B) primary podocytes cultured from the urine of two children with HIVAN and (C and D) two cell lines
derived from the primary podocytes. (E and G) Immunohistochemistry staining identified the nuclear localization of the WT-1 antigen in
cultured podocytes (red). (F and H) No specific WT-1 staining was detected in cells incubated with nonimmune IgG. (I and K) By
immunofluorescence microsocopy, synaptopodin was detected in red in the cytoplasm of cultured podocytes, whereas cell nuclei were
counterstained in blue with diamino-2 phenylindol. (J and L) No specific synaptopodin staining was detected in podocytes incubated
with irrelevant isotypic Igs. (M and O) Nestin was detected in red in the cytoplasm of podocytes, showing both a partial filamentous and
homogenous pattern. Cell nuclei were counterstained in blue with diamino-2 phenylindol. (N and P) Nestin was not detected in
podocytes incubated with irrelevant isotypic Igs. Original magnification, 3200 in A and E–P; 3400, B.
J Am Soc Nephrol 25: 1800–1813, 2014 Lipid Raft–Associated HIV-Tat Regulates Signaling 1801
www.jasn.org BASIC RESEARCH

3. mechanism and to define the Tat binding motif regulating this
process in podocytes harvested from children with HIVAN.
RESULTS
Extracellular Tat Increases the Ability of FGF-2 to
Induce Rho-A/Phospho–Extracellular Signal-Regulated
Kinase Signaling in Cultured Primary Podocytes
Harvested from Children with HIVAN
To determine how extracellular Tat and FGF-2 modulate Rho-A
signaling inchildrenwithHIVAN,weculturedprimary podocytes
from the urine of these patients (Figure 1, Supplemental
Figure 1). We found that Tat, alone or combined with FGF-2,
induced the expression of Rho-A, phospho–extracellular signal-
regulated kinase (pERK), and phospho-MLC2 (pMLC2) in these
cells (Figure 2). These changes were partially inhibited by the
exoenzyme C3-transferase from Clostridium botulinum, which
inhibits Rho-proteins by ADP-ribosylation in the effector bind-
ing domain of the guanosine 59‑triphosphatase (Figure 2), and
did not involve other HIV-1 genes, because the cells were not
infected. Similar results were reproduced in the cell lines gener-
ated from the primary podocytes (Figure 3A), validating their
clinical relevance for the purpose of this study.
C3-Transferase Inhibits Tat+FGF-2–Induced Stress
Fiber Formation and Rho-Activation in Cultured
Podocytes
Follow-upexperimentsweredonetodeterminehowTat+FGF-
2 modulate the formation of stress fibers in the presence and
absence of C3-transferase. As shown in Figure 3B, incubation
of podocytes with Tat+FGF-2 resulted in a remarkable increase
Figure 2. Extracellular Tat increases the ability of FGF-2 to induce Rho-A/pERK signaling in primary cultured podocytes isolated from
the urine of children with HIVAN. Primary podocytes were starved overnight in serum-free media and treated with Tat (100 ng/ml) alone
or combined with FGF-2 (50 ng/ml). The Rho-A inhibitor C3-transferase (20 ng/ml) was added 4 hours before stimulation. The cells were
treated for 5 minutes as described above and then harvested to assess the phosphorylation of Rho-A, pERK, and pMLC as described in
Concise Methods. The graph shows mean6SEM corresponding to three different experiments. Results were expressed in OD units
expressed as a ratio of the total activity. Values significantly different from the corresponding control group are marked: *P,0.05;
**P,0.01.
1802 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 1800–1813, 2014
BASIC RESEARCH www.jasn.org

4. Figure 3. Extracellular Tat increases the ability of FGF-2 to induce Rho-A/pERK signaling in a podocyte cell line generated from a child
with HIVAN. (A) Cultured podocytes were starved overnight in serum-free media and treated with Tat (100 ng/ml) alone or combined
with FGF-2 (50 ng/ml). The Rho-A inhibitor C3-transferase (20 ng/ml) was added 4 hours before stimulation. The cells were treated for 5
minutes as described above and then harvested to assess the phosphorylation of Rho-A, pERK, and pMLC as described in Concise
J Am Soc Nephrol 25: 1800–1813, 2014 Lipid Raft–Associated HIV-Tat Regulates Signaling 1803
www.jasn.org BASIC RESEARCH

5. in stress fibers. These structures appeared as thick actin cables
running along the length of the cell. In contrast, control cells or
Tat+FGF-2–treated cells incubated with C3-transferase
showed a more rounded shape, exhibited F-actin in the periph-
ery of the cells, and formed fewer stress fibers on Tat+FGF-2
stimulation. The activation of pMLC2 was also inhibited by the
C3-transferase (Figure 3A). These results suggest that Rho-A
activation mediates the cytoskeletal changes induced by Tat
+FGF-2 in cultured podocytes.
Tat Preferentially Associates with LRs in Cultured
Human Podocytes
To investigate the intracellular distribution of Tat in cultured
podocytes, we generated recombinant adenoviral vectors
(rAds) carrying a cDNA fragment encoding the full-length
Tat protein and the FLAG peptide sequence. As discussed in
Concise Methods and Supplemental Figure 2, the cDNA frag-
ment encoding Tat was derived from cultured renal tubular
epithelial cells infected with HIV-1.29 This Tat variant, named
Tat-HIVAN, was conserved in the N terminus but not the
polymorphic C-terminal region downstream of the basic do-
main, and it was missing the RGD motif in the C-terminal
region because of a frameshift deletion (Supplemental Figure
2). To validate the proper function of the Tat-HIVAN, we con-
firmed its ability to translocate to the nucleus in cultured podo-
cytes and transactivate the HIV long terminal repeat in GHOST
(GFP–human osteosarcoma) cells carrying a green fluorescent
protein (GFP) reporter system30 (Supplemental Figures 3 and
4). Subsequently, using flotation sucrose gradients, we isolated
LRs from cultured podocytes transduced with either rAd-Tat-
FLAG or rAd-GFP control vectors. Using both FLAG and Tat
antibodies, we found that a significant proportion of Tat was pref-
erentially localized in fraction 4 of the DRMs, whereas additional
Tat was detected in detergent-soluble fractions (non-DRMs) (Fig-
ure 4A). Caveolin-1, a protein known to associate with LRs, was
almost exclusively detected in DRMs fraction 4, confirming that
an efficient isolation of LRs was achieved (Figure 4). In contrast,
GFP was not detected in DRMs (Figure 4B), but it was located in
the bottom of the gradient, which is composed of non-DRMs that
contain detergent-soluble cytoplasmic and nuclear components.
Similar results were also found in cultured primary podocytes
harvested from children with HIVAN (Figure 4C).
Arginines in the Tat Basic Domain Sequences Mediate
LR Association in Podocytes
The basic domain of Tat, (RKKRRQRRR)49–57 (also called
protein transduction domain), is known to mediate mem-
brane crossing for protein transduction. In addition, arginines
of the basic domain have been reported to specifically interact
with negatively charged lipids in the plasma membrane.31
Therefore, we explored whether this domain is necessary
and sufficient to mediate Tat association with LR in cultured
podocytes. As shown in Figure 4A, we observed that two dif-
ferent wild-type (WT) –Tat variants, carrying or missing the
RGD motifs, were localized in the LR domains and that the
presence or absence of the RGD motif did not affect this lo-
calization. In contrast, we found that six alanine substitutions
(AKKAAQAAA)49–57 carried by a mutant Tat, called Tat–basic
domain mutant 1 (Tat-BDM1-HIVAN), almost completely
abolished Tat association with LRs in cultured podocytes (Fig-
ure 5). Interestingly, partial substitutions of three arginines
(55–57) did not affect the recruitment of Tat (Tat-BDM2-HI-
VAN) to the LRs (Figure 5B). Alternatively, another Tat mu-
tant (Tat-BDM3-HIVAN) carrying partial substitutions of the
other three arginines (49,52,53) showed a poor association with
LRs (Figure 5B). Indeed, the OD ratio of DRM bands over
non-DRM bands for Tat-BDM3-HIVAN was 5-fold lower
than the ratio of Tat-BDM2-HIVAN or Tat-WT-HIVAN
(data not shown). These data suggest that positions of argi-
nines present in the Tat basic domain are important for its
association with LRs.
Because cholesterol is a major component of LRs, we also
explored the potential role of the consensus cholesterol
recognition/interaction amino acid consensus sequence
(CRAC). The CRAC sequence is defined as (L/V–(X)1–5–Y–
(X)1–5–R/K) and used by several proteins for binding choles-
terol in the LRs, including Caveolin-1, HIV gp41, and human
cytomegalovirus UL37 exon 1 protein.32,33 We found that ar-
ginines49,52,53 in the basic domain could form part of a poten-
tial CRAC motif (LGISYGRKKRR). Thus, because tyrosine in
the CRAC motif is an essential residue for cholesterol bind-
ing,32,33 we generated a mutant Tat with Y47A (Tat-Y47A) and
tested its association with LRs. We found that the Y47A mu-
tation did not affect the association of Tat with the LRs (Figure
5B). These findings indicate that the CRAC sequence alone is
not sufficient to warrant cholesterol binding and that other
structural factors are needed for this process.32
Tat Basic Binding Domain Modulates Rho-A Signaling
and the Expression of Matrix Metalloproteinase-9 in
LRs
Rho-A signaling and matrix metalloproteinases (MMPs)
modulate the migration of HIV-infected cells26 and facilitate
the release of FGF-2 in patients with Kaposi’s sarcoma.34,35
Children with HIVAN excrete high urinary levels of MMPs
and FGF-2, which is in correlation with the progression of
Methods. The graph shows mean6SEM corresponding to three different experiments. Results were expressed in arbitrary OD units as
a ratio of the total activity. Values significantly different from the corresponding control group are marked: *P,0.05; **P,0.01. (B) Cul-
tured podocytes were treated as in A, and 20 minutes after treatment, F-actin fibers were visualized in cells by staining with 2 mg/ml Alexa
Fluor 488–labeled phalloidin. Cell nuclei were stained with Hoechst 33342. Scale bar, 10 mm.
1804 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 1800–1813, 2014
BASIC RESEARCH www.jasn.org

6. their renal disease.14,15 Therefore, we explored the effect of
Tat-HIVAN on Rho-A signaling and MMP-9 expression. We
found that Rho-A and MMP-9 were localized in the LRs of the
podocytes and that the basic domain of Tat increased Rho-A
phosphorylation and MMP-9 expression in LRs (Figure 5C).
Tat Basic Domain Modulates FGF-2–Induced pERK,
Rho-A, and pMLC2 in Cultured Podocytes
Because FGF-2 is accumulated in the kidney of children with
HIVAN,13,14,16,17,36 we explored how the Tat basic domain
modulated FGF-2 signaling in podocytes transfected with
Tat-WT-HIVAN or Tat-BDM1-HIVAN. As shown in Figure
6, we found that Tat-WT-HIVAN, alone or combined
with FGF-2, induced a more significant activation of pERK,
Rho-A, and pMLC2 compared with Tat-BDM1-HIVAN. These
changes are consistent with the results obtained in cultured
primary podocytes using an extracellular Tat variant that
carries the RGD motif (Figure 2). In contrast, Tat-BDM1-HI-
VAN was unable to increase the activity of FGF-2 (Figure 6).
Overall, these findings confirm that the Tat basic domain
plays a critical role modulating FGF-2 signaling in cultured
podocytes and that the RGD motif is not essential for this
process.
Tat Basic Domain Modulates the Expression of pERK,
Rho-A, pMLC2, and MMP-9 in the Kidneys of Young
HIV-Tg26 Mice
To determine the role of the Tat basic domain in vivo, we used
an adenoviral gene transferring technique developed in our
laboratory37 to express Tat in the kidney of young mice (Sup-
plemental Figures 5 and 6). As shown in Figure 7, both WTand
HIV-Tg26 mice infected with Ad-Tat-WT-HIVAN showed a
significant upregulation of renal pERK, Rho-A, pMLC, and
MMP-9 compared with mice infected with Ad-Tat-BDM1-
HIVAN. These changes were more remarkable in HIV-Tg26
mice (Figure 7) and also associated with an upregulated ex-
pression of HIV-1 genes and the development of more severe
renal lesions compared with HIV-Tg26 mice injected with rAd-
Tat BDM1-HIVAN or rAd-LacZ vectors (Supplemental Fig-
ures 5 and 6).
Circulating FGF-2 Induces the Expression of pERK,
Rho-A, pMLC, and MMP-9 in the Kidney of Adult
HIV-Tg26 Mice
Because children with HIVAN show high plasma and urinary
levels of FGF-2,13,14 we used Ad-FGF-2 vectors carrying a se-
creted form of FGF-2 to determine whether circulating FGF-2
can induce similar renal signaling changes in adult WT and
HIV-Tg26 mice. In this experimental adult mouse model,38,39
only the hepatocytes are infected with the adenoviral vectors,
and FGF-2 released into the circulation is trapped in the kid-
ney bound to HSPGs.13,15,16,36,40 As shown in Figure 8, FGF-2
increased the renal expression of pERK, Rho-A, pMLC2, and
MMP-9 in both WTand HIV-Tg26 mice. These changes, how-
ever, were more remarkable in HIV-Tg26 mice (Figure 8) and
associated with the development of more severe renal lesions
and albuminuria compared with all other groups (Figure 9,
Supplemental Figure 7), Moreover, FGF-2, alone or combined
with Tat, induced the proliferation and survival of cultured
podocytes harvested from children with HIVAN acting
through similar signaling pathways (Figure 10).
DISCUSSION
This study shows that Tat is preferentially recruited to LRs in
podocytes harvested from children with HIVAN and induces
cytoskeletal changes through the stimulation of the Rho-A/
pMLC pathways. In addition, we found that alanine sub-
stitution of the six arginines in the Tat basic binding domain
preventedtheassociationofTatwithLRs,impaireditsability to
enhance FGF-2 signaling or MMP-9 expression in cultured
Figure 4. HIV-1 Tat protein is associated with LRs in human
podocytes isolated from the urine of children with HIVAN. LRs
were isolated from a cultured podocyte cell line (P2) infected with
adenovirus carrying (A) FLAG-tagged Tat (Ad-Tat-FLAG) or (B)
GFP (Ad-GFP) or (C) primary podocytes infected with Ad-Tat-
FLAG by sucrose gradient–based flotation assay. Twelve fractions
of the gradient were run by SDS-PAGE to show the distribution of
DRM and non-DRM fractions. FLAG-tagged Tat, GFP, and the LR
marker Caveolin-1 (Cav-1) were analyzed by Western blotting.
J Am Soc Nephrol 25: 1800–1813, 2014 Lipid Raft–Associated HIV-Tat Regulates Signaling 1805
www.jasn.org BASIC RESEARCH

7. podocytes, and failed to induce severe renal disease in HIV-Tg26
mice. Taken together, these findings provide compelling evi-
dence to support the notion that the Tat basic domain is essential
for the recruitment of Tat to LRs and the regulation of FGF-2
signaling in podocytes isolated from children with HIVAN.
The Tat protein is a powerful transcriptional factor encoded
by two exons. The first exon encodes the activation domain,
which interacts with cyclin T1, and the basic domain (amino
acids 49–57), which is required for the nuclear localization of
Tat,41,42 HIV-1 transcription,7 and many other functions.7,41,42
The second exon encodes the RGD motif (C-terminal amino
acids 73–86), which enhances the angiogenic activity of Tat
acting through integrin receptors.43,44 However, the Tat protein
derived from a child with HIVAN used in this study had an
incomplete RGD sequence, and our results show that this se-
quence is not essential for the association of Tat with LRs or the
regulation of FGF-2 signaling. Indeed, we found that Tat
variants carrying the RGD motif were also
recruited to LRs and induced FGF-2 signal-
ing. Thus, our findings should be relevant
for children infected with viruses carrying
different Tat variants.
IncontrasttotheRGDmotif,theTatbasic
binding domain contains a cluster of basic
residues (RKKRRQRRR) that are known to
carry proteinsandDNAmoleculesacrossthe
cell membranes and affect the activity
of extracellular Tat peptides in human
podocytes.11,12 LRs were also reported to
play a critical role modulating Tat activity
in other cell types26,45; however, these stud-
ies did not explore the specific localization
of Tat in LRs. Moreover, to date, the inter-
actions between Tat and LRs in podocytes
are unclear, and the residues responsible for
the association of Tat with LRs remain un-
defined. Here, we used purified LRs to show
that three arginine residues in the basic do-
main are essential for the stable association
of Tat with LRs and the regulation of FGF-2
signaling in cultured podocytes harvested
from children with HIVAN. It is possible
that Tat may be recruited to LRs microdo-
mains by binding to anionic lipids that are
enriched in the LRs.31 However, the basic
residues are not equally important in mem-
brane insertion or binding to polyphos-
phoinositides, because basic residues 49–51
but not arginines55–57 are critical for this
process.31 Similarly, we found that three
alanine substitutions in arginines49,52,53
but not arginines55–57 diminished Tat asso-
ciation with LRs by over 80%. These results
indicate that lack of positive charges in the
Tat-BDM1-HIVANpersecannotfullyexplain
its defective association with LRs. In that regard, there may be
conformation-specificinteractions between the basicdomainand
the LRs proteins to allow this stable association to occur.
Interesting findings of this study are the localization of MMP-9
within LRs in cultured podocytes and the ability of Tat-WT-
HIVANtoinducetheexpressionofMMP-9inthislocation.MMP-
9 belongs to a family of zinc binding endopeptidases that degrade
extracellularmatrixproteins,includingHSPGandcollagen.46 Pre-
vious studies have shown that MMP-9 was associated with LRs in
severalcancercelllines,wherethey modulateangiogenesisandcell
migration.47–49 In children with HIVAN, the urinary levels of
MMP-9 are increased in correlation with the progression of their
renal disease.14,16 Therefore, because MMP-9 facilitates the release
of FGF-2,34 our findings may provide an alternative mechanism
by which Tat can regulate the activity of FGF-2 in podocytes.
Also,Rho is a small guanosine triphosphate binding protein
that plays a central role regulating the dynamic organization of
Figure 5. Arginines located in the basic domain are essential for targeting Tat to the
LRs in cultured podocytes. (A) Several mutations were introduced in the basic domain
of the WT Tat isolated from a child with HIVAN (Tat-HIVAN) to generate different Tat
BDMs named for the purpose of this study: Tat-BDM1, Tat-BDM2, Tat-BDM3, and Tat-Y47A
(mutation introduced in the putative cholesterol recognition consensus sequence). The
Tat-101 control gene derived from the HIV-1 cDNA clone pCV1 (Supplemental Figure
2) carries the RDG motif, which is missing in Tat-HIVAN and all the other Tat BDMs. All
these sequences were aligned using the Clustal Omega multiple sequence alignment
program. Residues aligned identical are marked with an asterisk. Mutated residues are
underlined. (B) Podocytes were transiently transfected with Tat-101/pCV1, Tat-HIVAN,
Tat-HIVAN BDMs, or Tat-HIVAN-Y47A mutant. Cells were lysed with Triton X-100
and fractionated using a sucrose gradient flotation assay. FLAG-tagged Tat was
detected by Western blot using the anti-FLAG antibody. (C) Western blot analyses
showing changes in pERK, Rho-A, pMLC, and MMP-9 expression in isolated LRs and
whole-cell lysates (WCLs) extracted from cultured podocytes transfected with WT Tat
and Tat-mutated in BDM1 and the empty vector. GTP, guanosine triphosphate.
1806 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 1800–1813, 2014
BASIC RESEARCH www.jasn.org

8. contractile actin–myosin filaments and the formation of stress
fibers in mammalian cells.50 When bound to guanosine tri-
phosphate, Rho-proteins activate the Rho-kinase and other
downstream effector proteins, including the phosphorylation
of the myosin binding subunit of MLC.50 All these factors are
important to maintain the cytoskeletal structure of podocytes
and the integrity of the glomerular basement membrane.2 In
line with this notion, our data suggest that
Tat, combined with FGF-2, can induce the
crosslinking of F-actin and the formation
of stress fibers in human podocytes
through activation of Rho-A and pMLC
signaling pathways. In addition, we found
that Tat increased the FGF-2–induced
phosphorylation of pERK, a pathway leading
to cell proliferation. Podocytes are termi-
nally differentiated cells and have limited
in vivo ability to undergo nuclear division
in response to FGF-2.51 Thus, differentiated
podocytes that are forced to re-enter the cell
cycle under the influence of Tat and FGF-2
may be unable to divide and could detach or
undergo apoptosis. Considering that FGF-2
is accumulated in the circulation, glo-
meruli, and urine of children with
HIVAN,13,14,16,17,36 it is tempting to specu-
late that the podocytes carrying the genetic
risk variants that predispose to HIVAN52,53
may be more sensitive to this pathogenic
mechanism. In support of this notion, we
found that both Tat and FGF-2 can precip-
itate the development of HIVAN in HIV-
Tg26 mice. However, HIVAN is a complex
renal disease, and other viral proteins like
Nef, which inhibits Rho-A activation in
conditionally immortalized cultured mu-
rine podocytes,54 also play a key role in
this disease. Nonetheless, children may be
more sensitive to the renal accumulation of
FGF-2, because their kidneys are growing,
and they have high expressions of HSPG,
MMPs, FGF receptors, and binding pro-
teins and higher plasma and tissue levels
of FGF-2 relative to all other HIV-1 pro-
teins.13,14,16,17,36 They also develop more se-
vere immunosuppression and higher viral
loads, leading to additional secretion of Tat
and inflammatory cytokines that release
more FGF-2.6,34 Moreover, our data did
not rule out the possibility that Tat, acting
through the release of systemic cytokines
that upregulate the expression of HIV-1
genes through NF-kB activation, may play
an additional role in HIVAN as well. Both
Tat and FGF-2 are cleared from the circula-
tion and stored bound to HSPG,6,18 and they can reach high
tissue concentrations in organs with a high blood flow and
HSPG content.15,17,40
In conclusion, we found that Tat is preferentially recruited
to LRs in cultured podocytes from children with HIVAN. This
event is mediated by the Tat basic domain, because mutations
ofsixargininesinthisregionabolishedTatassociationwithLRs
Figure 6. The basic domain of Tat is essential for enhancing the FGF-2–induced
activation of pERK, Rho-A, and pMLC2 and increasing the expression of MMP-9 in
cultured podocytes. (A) Western blot analyses showing representative results in
podocytes transiently transfected Tat-WT (WT) or Tat-BDM1 (BDM1) for 44 hours.
Transfected cells were subsequently treated with FGF-2 (50 ng/ml) for 5 minutes and
processed for the signaling studies. (B) The graph shows mean6SEM corresponding
to five samples per group. Results are expressed in arbitrary OD units as a ratio of the
total activity or normalized for b-actin for the MMP-9 expression. Values significantly
different from the corresponding control group are marked: *P,0.05; **P,0.01.
J Am Soc Nephrol 25: 1800–1813, 2014 Lipid Raft–Associated HIV-Tat Regulates Signaling 1807
www.jasn.org BASIC RESEARCH

9. and impaired its ability to induce Rho-A activation, MMP-9
expression, and FGF-2 signaling both in vitro and in vivo.
These findings may provide a molecular framework to define
the role of LRs in the pathogenesis of childhood HIVAN and/
or identify new therapeutic targets to im-
prove the outcome of children with other
HIV renal diseases.
CONCISE METHODS
Collection of Human Samples
Thecollectionofhumansampleswascarriedout
inaccordancewiththeprinciplesoftheDeclaration
of Helsinki. This study was approved by the In-
stitutional Review Board of Children’s National
Medical Center, and a waiver of Documentation
of Informed Consent and Health Insurance Porta-
bilityandAccountabilityActAuthorizationwasob-
tained to allow for anonymous data and specimen
collection after a verbal agreement was obtained
from the patients or their parents.
Construction of Tat Expression
Vectors and Adenoviruses
The cDNA fragment encoding Tat was derived
from renal epithelial cells harvested from the
urine of a child with HIVAN and infected with
PBMCs isolated from the same child as pre-
viously described.29 Infected renal epithelial
cells were then lysed using TRIzol (Invitrogen)
to isolate total mRNA. The Tat gene was ampli-
fied from the subsequently synthesized cDNA
with the high-fidelity DNA polymerase Pfu (In-
vitrogen) using PCR primers flanking the open
reading frame of the full-length Tat.55 A cDNA
fragment encoding the full-length Tat protein
was cloned into the pCXN2-FLAG vector
and used to generate E1-deleted recombinant
adenoviruses as previously described.56 Both
Tat-FLAG and GFP adenoviruses were purified,
desalted, and titrated as described before.57 To
generate adenoviruses that express secreted
Tat protein, the signal peptide for secretion
was amplified by PCR from the sp-FGF4:
FGF-11–154–pMEXneo vector58 using forward
59-ATACTCGAGATGGCGGGGCCCGGGACGGC-
39 and reverse 59- GCGAAGCTTGGGCGCCAG-
CAAGGCCAGCAG-39 primers. The PCR
product of this 78-bp signal peptide was then
ligated with the PCR product of the full-length
Tat-FLAG (WT or BDM1) from the pCXN2
vector using forward 59-ACTAAGCTTGAC-
TACAAGGACGACGATGA-39 and reverse 59-
TACGGATCCCTAACTAGCTAATCGAATCG -39
primers. The resulting recombinant Tat-WT-FLAG or Tat-
BDM1-FLAG gene with the FGF4 signal peptide sequence was
cloned into the pVQAd CMV K-NpA shuttle plasmid (provided
by ViraQuest, Inc., North Liberty, IA) to generate Tat
Figure 7. The basic domain of Tat is important for inducing the activation of pERK,
Rho-A, and pMLC2 and increasing the expression of MMP-9 in the kidney of WT and
HIV-Tg26 young mice. Newborn FVB/N WT and HIV-Tg26 mice (n=3 per group) were
infected with adenoviral vectors carrying Tat-WT (Ad-Tat-WT) or Tat-BDM1 (Ad-Tat-
BDM1). Mice were euthanized after 7 days, and their kidneys were processed for the
signaling studies as described in Concise Methods. (A) The Western blots show rep-
resentative results corresponding to three mice in each group. (B) The graphs sum-
marize the results corresponding to all the kidney samples per group. Results were
expressed in arbitrary OD units as a ratio of the total activity or normalized for b-actin
for the MMP-9 expression. Values significantly different from the corresponding
control group are marked: *P,0.05; **P,0.01.
1808 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 1800–1813, 2014
BASIC RESEARCH www.jasn.org

10. adenoviruses (rAd-Tat-WT* and rAd-Tat-BDM1*) as described
previously.59
Podocyte Cultures
Primary podocytes were isolated from clean-catch urine as previously
described.29,60 Proliferating podocytes were obtained consistently
from the urine of two children with HIVAN. Primary colonies that
showed typical podocyte morphology (Figure 1, A–E), were further
characterized by immunohistochemistry or immunofluorescence
with the podocyte markers Wilms’ tumor 1 (WT-1), synaptopodin,
and nestin (Figure 1, F–P). Cells were fixed in 4% paraformaldehyde
permeabilized with 0.1% Triton X-100 (Sigma-Aldrich) and stained
using well established methods with specific antibodies against WT-1
(Dako), synaptopodin (Maine Biotechnology, Inc.), and nestin
(Chemicon Int., Inc.). Subsequently, selected colonies were trans-
duced with adenoviral vectors carrying DNA sequences encoding
the SV-40 large T antigen (provided by Janice Chou, National Insti-
tutes of Health, Bethesda, MD)61 and human telomerase (rAd-TERT;
Applied Biologic Materials, Inc.). Colonies of transformed podocytes
were characterized again by RT-PCR using specific primers for the
podocyte markers WT-1, synaptopodin, podocalyxin, nestin, podocin,
and nephrin as described in previous studies60,62 and shown in Sup-
plemental Figure 1 and Supplemental Table 1. Podocyte colonies
expressing all these markers, with the exception of podocin (which
was not detected in any of these colonies), were selected and tested
again by immunohistochemistry with WT-1, synaptopodin, and
nestin antibodies (Figure 1, G, K, and O). Two podocyte colonies,
named for the purpose of this study as P-2 and P-3 (Supplemental
Figure 1), were expanded and cultured in DMEM supplemented
with 10% FBS and 1% antibiotic–antimycotic (Invitrogen), which
contains 100 units/ml penicillin, 100 mg/ml streptomycin, and 0.25
mg/ml Fungizone (amphotericin B). Western blots were done to
confirm the expression of WT-1, synaptopodin, and nestin using
antibodies from Dako (6F-H2), Santa Cruz Biotechnology (P-19),
and Chemicon (MAb5326), respectively. Control sections were
stained omitting the first antibody and using nonimmune IgG. All
podocytes clones were screened and tested for the presence of HIV-1
genes by PCR as previously described.29
Mutagenesis
Site-specific mutations were introduced to the Tat gene using the
QuikChangeIIXL Site-Directed MutagenesisKit(Agilent Technologies,
Santa Clara, CA) following the manufacturer’s manuals. To generate
mutations in the basic domain RKKRRQRRR, forward primer
59-GGCAGGAAGAAGCGGAGACAGGCAGCAGCAGCTCCTCAA-
GACAGTCAGAC-39 and reverse primer 59-GTCTGACTGTCTT-
GAGGAGCTGCTGCTGCCTGTCTCCGCTTCTTCCTGCC-39 were
first used to mutate arginines55–57 and generate a mutant Tat
Figure 8. Circulating FGF-2 induces the expression of pERK, Rho-A, pMLC2, and MMP-9 in the kidneys of WT and HIV-Tg26 adult mice.
Adult FVB/N WT and HIV-Tg26 mice (n=3 per group) were infected with adenoviral vectors carrying the Lac-Z gene (rAd-Lac-Z) or
a secreted form of human FGF-2 (rAd-FGF-2). Mice were euthanized after 28 days, and their kidneys were processed for the signaling
studies as described in Concise Methods. (A) The Western blots show representative results corresponding to one experiment. (B) The
graphs summarize the results corresponding to six kidney samples per group. Results were expressed in arbitrary OD units as a ratio of
the total activity or normalized for b-actin for the MMP-9 expression. Values significantly different from the corresponding control group
are marked: *P,0.05; **P,0.01.
J Am Soc Nephrol 25: 1800–1813, 2014 Lipid Raft–Associated HIV-Tat Regulates Signaling 1809
www.jasn.org BASIC RESEARCH

11. (RKKRRQAAA)49–57. Forward primer 59-TTAGGCATCTCCTATGGCGC-
GAAGAAGGCGGCACAGGCAGCAGCAGCTCC-39 and reverse primer
59-GGAGCTGCTGCTGCCTGTGCCGCCTTCTTCGCGCCATAGGA-
GATGCCTAA-39 were then used to produce mutant Tat with (AKKAA-
QAAA)49–57. Forward 59-CTTAGGCATCTCCTATGGCGCGA
AGAAGGCGGCACAGCGACGAAGAGCTCCT-39 and reverse 59-AG-
GAGCTCTTCGTCGCTGTGCCGCCTTCTTCGCGCCATAGGA-
GATGCCTAAG-39 were used to generate mutant Tat with
(AKKAAQRRR)49–57. Forward primer 59-AGGCTTAGGCATCT-
CCGCTGGCAGGAAGAAGCGG-39 and reverse primer 59-CCGCT-
TCTTCCTGCCAGCGGAGATGCCTAAGCCT-39 wereusedtointroduce
the Y47A mutation in the potential CRAC sequence, LGISYGRKKRR.
Extracellular Treatments, Adenovirus Infections, and
Transient Transfection
Podocytes were exposed for 5 minutes to the control buffer, 100 ng/ml
HIV-1Tatprotein(catalognumber2222;NationalInstitutesofHealth
AIDS Reagent Program),63 or 50 ng/ml recombinant human FGF-2
(R&D Systems) alone or combined with HIV-Tat
and harvested for the signaling or immunofluores-
cence studies. Both Tat and FGF-2 preparations
were screened for endotoxin contamination
(,0.1 ng/mg protein). As indicated, C3-transferase
toxin (20 ng/ml) was added 4 hours before
stimulation to block Rho-A activity. Alterna-
tively, podocytes were infected with 2–43109
particles/ml rAd-Tat or rAd-GFP vectors
(Quantum Biotechnologies, Inc.) for 24–30
hours and then harvested for LRs isolation.
For transfection, podocytes were transiently
transfected with pCXN2-Tat-FLAG, pcDNA3.1-
TAT-1–101-FLAG64 (Addgene), which was origi-
nally derived from the HIV-1 cDNA clone
pCV1,65 or the corresponding Tat mutant or
control vectors using Lipofectamine 2000 (In-
vitrogen) and harvested 36–48 hours later for
LR isolation as described before.33 Cell prolif-
eration and survival assays were done as pre-
viously described.36
LR Isolation
LR fractions were isolated using the flotation
assay as described previously.33 In brief, podocytes
were lysed on ice, homogenized, and sonicated
using a Polytron tip sonicator. The cell lysate was
then mixed with an equal volume of 80% sucrose
dissolved in the isolation buffer and overlaid
with discontinuous layers of 35% and 5% su-
crose solutions at a volume ratio of 1:2:1 in a
4-ml ultracentrifuge tube (Beckman). The
tubes were loaded on a Beckman SW60i rotor,
and gradients were separated by centrifugation
at 187,8133g (39,000 rpm) for 16 hours at 4°C.
After centrifugation, 12 fractions (about 330 ml
each) were sequentially collected from top to
bottom, and 25 ml of each fraction were resolved by SDS-PAGE
and analyzed by Western blot.
Western Blot Analyses
Cells were lysed using RIPA lysis buffer containing protease inhibitor
and phosphatase inhibitor cocktail 2 (Sigma-Aldrich) and processed
for Western blots as described before.66 The following primary anti-
bodies were used: phospo-p44/42 mitogen-activated protein kinase
(Thr202/Tyr204), p44/42 mitogen-activated protein kinase (ERK1/
2), phospho-MLC2 (Thr18/Ser 19), and total MLC2 from Cell Sig-
naling Technology, anti–MMP-9 (Calbiochem), b-actin (AC-15;
Sigma-Aldrich), a-tubulin (DM1A; Abcam), Caveolin 1 (BD Bio-
sciences), FLAG (M2; Sigma-Aldrich), GFP (Santa Cruz Biotechnol-
ogy), and Tat Rabbit pAb (catalog number 705; National Institutes of
Health AIDS Reagent Program).67 Protein bands were detected using
Supersignal West Pico Chemiluminescent Substrate (Thermo Scien-
tific) or an ECLWestern Blot Detection Kit (GE Healthcare) following
the manufacturer’s instructions.
Figure 9. Circulating FGF-2 precipitated the development of HIVAN in adult HIV-Tg26
mice. WT and HIV-Tg26 male adult mice without preexisting renal disease were in-
fected with adenoviral viral vectors carrying a secreted form of human recombinant
FGF-2 or the Lac-Z gene (n=5 per group) as described in Concise Methods. Renal
sections were harvested 28 days after the adenoviral infection. (B and D) Both WT and
HIV-Tg26 mice infected with rAd-FGF-2 showed a significant recruitment of glomerular
and tubular epithelial cells expressing proliferating cell nuclear antigen (PCNA),
a marker of DNA synthesis, replication, and intrinsic repair activity when compared to
mice (A and C) injected with rAd-LacZ vectors. (H) HIV-Tg26 mice infected with rAd-
FGF-2 showed a decreased number of WT-1+
cells compared with all other groups (E–
G) (*P,0.01; ANOVA). (D and H) These changes were associated with the presence of
FSGS lesions, tubular casts, and microcysts. The bar graphs show the immunohisto-
chemistry staining scores corresponding to each group. Results are expressed as
percent changes in PCNA or WT-1+
cells relative to the control group (WT mice in-
fected with rAd-Lac-Z). Values significantly different from the corresponding control
group are marked: *P,0.05; **P,0.01. Original magnification, 3200 in A–D; 3400 in
E–H.
1810 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 1800–1813, 2014
BASIC RESEARCH www.jasn.org

12. Glutathione S-Transferase Pull-Down Assays
Rho-A activation was monitored by glutathione S-transferase (GST)
pull-down using GST-Rhotekin recombinant protein bound to
glutathione slurry resin using the protocol described before.66 Total
and phosphorylated Rho-A were assessed by Western blotting using
Rho-A (67B9) rabbit mAb (Cell Signaling Technology). For total Rho-
A, we used an equal amount of protein corresponding to the cell lysates
obtained before they were mixed with the GST beads.
Immunofluorescence Staining
Podocyteswereculturedoncellgrowth-promotingcoverslips(Fisher)
orcoverslipscoatedwithtypeIcollagenfor24hours.Cellsweretreated
asindicatedandthenfixedandpermeablizedasdescribedbefore.66 After
blockingwith1%BSA,cells werestained with2 mg/mlPhalloidin–Alexa
Fluor 488 (Invitrogen), and nuclei were stained with Hoechst 33342
(1:2000; Invitrogen) for 20 minutes at room temperature. After mount-
ing, the confocal imaging was performed using an Olympus FV1000
confocal microscope, and a magnification of 603 was used for imaging.
Studies in WT and HIV-Tg26 Mice
These experiments were approved by the Children’s Research Institute
Animal Care and Use Committee. WTand HIV-Tg26 FVB/N mice were
housed in a pathogen-free environment on a 12:12-hour light/dark
cycle in the animal facility at Children’s National Medical Center. All
mice had free access to water and standard food and were treated in
accordance with the NationalInstitutes ofHealth guidelines forcare and
use of research animals. Both the generation of the HIV-Tg26 mouse
colony and the adenoviral gene-transferring technique to express for-
eign genes in newborn mouse kidneys have been described in de-
tail.37,68,69 Briefly, newborn FVB/N WT and HIV-Tg26 mice (n=3–8
per group) were injected through the retro-orbital plexus with adeno-
viruses carrying the Escherichia coli LacZ gene (rAd-LacZ), Tat-WT-
FLAG, or Tat-BDM1-FLAG (13108
pfu/pup). Tat mRNA expression
was assessed by RT-PCR using the following primers: forward 59-ATG-
GAGCCAGTAGATCCTAGAC-39 and reverse 59- CTAATCGAATC-
GATCTGTCTCTGC-39. In other experiments, WTor HIV-Tg26 adult
male mice without preexisting renal disease were divided in two groups
(n=3–5 mice per group) and injected through the retro-orbital vein
plexus with adenoviral vectors carrying LacZ or a 700-bp cDNA se-
quence encoding a secreted form of human FGF-2 (rAd-FGF-2;
53108
pfu/mouse) as previously described.38,69,70 Mice were eutha-
nized 7 or 28 days after the adenoviral infection, and their kidneys
were processed for signaling or renal histologic studies as described
above. Renal injury was assessed in sections stained with period
acid–Schiff by counting the percentage of glomeruli exhibiting seg-
mental/global sclerosis and the percentage of tubular casts and mi-
crocysts. In addition, we counted the number of cells that stained
positive for proliferating cell nuclear antigen and WT-1 and assessed
the magnitude of albuminuria as previously described.38
Statistical Analyses
If not specified otherwise, the data are expressed as means6SEMs.
Multiple sets of data were compared by ANOVA with Newman–Keuls
post hoc comparisons. The significant differences between the means of
two groups were analyzed by unpaired t tests. Statistical analyses were
performed using GraphPad Prism software (version 5.00; GraphPad
Software,SanDiego,CA).Values ofP,0.05wereconsideredstatistically
significant.
Figure 10. FGF-2, alone or combined with Tat, increased the pro-
liferation and survival of cultured podocytes. (A) Proliferation assay.
Podocytes were seeded at a density of 53104
cells/well and cul-
tured in DMEM media supplemented with 1% FBS and penicil-
lin/streptomycin for 4 days. HIV-Tat, FGF-2, or both combined were
added daily at a concentration of 50 ng/ml each. On day 4, all cells
were trypsinized and counted as described in Concise Methods.
Values significantly different from controls are marked: *P,0.05. (B)
The MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bro-
mide) survival assay. Podocytes were seeded at a density of 63104
cells per well and starved overnight on DMEM serum-free media
containing antibiotics. Subsequently, all cells were treated with
FGF-2+Tat at a concentration of 10 ng/ml each (black bars) in the
presence or absence of the corresponding inhibitors. The kinase
inhibitor PD98059 (5 mM), the Rho-associated protein kinase in-
hibitor Y27632 (10 mM), and the Rho-A inhibitor C3-transferase (20
ng/ml) were added 2 hours before the FGF-2+Tat treatment. On
day 3, 10 ml MTT solution (5 mg/ml) was added to each well, in-
cubated for 3 hours at 37°C, and then, treated with 100 ml MTT
solvent (4 mM HCl and 0.1% Triton X-100 in isopropronal) as de-
scribed in Concise Methods. Results were recorded in MTT absor-
bance units and expressed as a percent of control values (open
bars) considering six independent readings. Values significantly
different from controls are marked: **P,0.01.
J Am Soc Nephrol 25: 1800–1813, 2014 Lipid Raft–Associated HIV-Tat Regulates Signaling 1811
www.jasn.org BASIC RESEARCH

13. ACKNOWLEDGMENTS
The following reagents were obtained through the National Institutes of
Health AIDS Research and Reference Reagent Program, Division of
AIDS, National Institute of Allergy and Infectious Diseases, National
Institutes of Health: Ghost(3)X4/R5 from Drs. Vineet N. Kewal Ramani
and Dan R. Littman, HIV-1 Tat from Dr. John Brady, and HIV-1 BH10
Tat antiserum from Dr. Bryan Cullen. We thank Children’s Research
Institute Intellectual and Developmental Disabilities Research Center
light microscopy and image analysis core at Children’s National Medical
Center for help with the immunofluorescence studies. We thank the
group of Dr. Valente for contributing the pcDNA3.1-TAT-1-101-FLAG
plasmid to Addgene as well as Lian Xu, Dr. Jyoti Jaiswal, and Dr. Luana
Scheffer for technical advice and helpful scientific discussions.
This study was supported, in part, by National Institutes of Health
Grants R01-HL55605, R01-HL102497, and R01-DK049419.
DISCLOSURES
None.
REFERENCES
1. Ray PE, Hu CA: Advances in our understanding of the pathogenesis of
HIV-1 associated nephropathy in children. Future Virol 6: 883–894, 2011
2. Oh J, Reiser J, Mundel P: Dynamic (re)organization of the podocyte actin
cytoskeletoninthenephroticsyndrome.PediatrNephrol19:130–137,2004
3. Bruggeman LA, Ross MD, Tanji N, Cara A, Dikman S, Gordon RE, Burns
GC, D’Agati VD, Winston JA, Klotman ME, Klotman PE: Renal epithe-
lium is a previously unrecognized site of HIV-1 infection. J Am Soc
Nephrol 11: 2079–2087, 2000
4. Smeets B, Angelotti ML, Rizzo P, Dijkman H, Lazzeri E, Mooren F, Ballerini
L, Parente E, Sagrinati C, Mazzinghi B, Ronconi E, Becherucci F, Benigni A,
Steenbergen E, Lasagni L, Remuzzi G, Wetzels J, Romagnani P: Renal
progenitor cells contribute to hyperplastic lesions of podocytopathies and
crescentic glomerulonephritis. J Am Soc Nephrol 20: 2593–2603, 2009
5. Ronconi E, Sagrinati C, Angelotti ML, Lazzeri E, Mazzinghi B, Ballerini L,
Parente E, Becherucci F, Gacci M, Carini M, Maggi E, Serio M, Vannelli GB,
Lasagni L, Romagnani S, Romagnani P: Regeneration of glomerular podo-
cytes by human renal progenitors. J Am Soc Nephrol 20: 322–332, 2009
6. Barillari G, Ensoli B: Angiogenic effects of extracellular human immuno-
deficiency virustype1 Tat protein and its roleinthe pathogenesis of AIDS-
associated Kaposi’s sarcoma. Clin Microbiol Rev 15: 310–326, 2002
7. Berkhout B, Silverman RH, Jeang KT: Tat trans-activates the human immu-
nodeficiency virus through a nascent RNA target. Cell 59: 273–282, 1989
8. Vivès E, Brodin P, Lebleu B: A truncated HIV-1 Tat protein basic domain
rapidly translocates through the plasma membrane and accumulates in
the cell nucleus. J Biol Chem 272: 16010–16017, 1997
9. Westendorp MO, Frank R, Ochsenbauer C, Stricker K, Dhein J, Walczak
H, Debatin KM, Krammer PH: Sensitization of T cells to CD95-mediated
apoptosis by HIV-1 Tat and gp120. Nature 375: 497–500, 1995
10. Xiao H, Neuveut C, Tiffany HL, Benkirane M, Rich EA, Murphy PM,
Jeang KT: Selective CXCR4 antagonism by Tat: Implications for in vivo
expansion of coreceptor use by HIV-1. Proc Natl Acad Sci U S A 97:
11466–11471, 2000
11. Doublier S, Zennaro C, Spatola T, Lupia E, Bottelli A, Deregibus MC,
Carraro M, Conaldi PG, Camussi G: HIV-1 Tat reduces nephrin in human
podocytes: A potential mechanism for enhanced glomerular perme-
ability in HIV-associated nephropathy. AIDS 21: 423–432, 2007
12. Conaldi PG, Bottelli A, Baj A, Serra C, Fiore L, Federico G, Bussolati B,
Camussi G: Human immunodeficiency virus-1 tat induces hyper-
proliferation and dysregulation of renal glomerular epithelial cells. Am
J Pathol 161: 53–61, 2002
13. Ray PE, Liu XH, Xu L, Rakusan T: Basic fibroblast growth factor in
HIV-associated hemolytic uremic syndrome. Pediatr Nephrol 13: 586–593,
1999
14. Soler-García AA, Rakhmanina NY, Mattison PC, Ray PE: A urinary bio-
marker profile for children with HIV-associated renal diseases. Kidney
Int 76: 207–214, 2009
15. Ray PE, Bruggeman LA, Weeks BS, Kopp JB, Bryant JL, Owens JW,
Notkins AL, Klotman PE: bFGF and its low affinity receptors in the
pathogenesis of HIV-associated nephropathy in transgenic mice. Kid-
ney Int 46: 759–772, 1994
16. Liu XH, Aigner A, Wellstein A, Ray PE: Up-regulation of a fibroblast
growth factor binding protein in children with renal diseases. Kidney Int
59: 1717–1728, 2001
17. Ray PE, Xu L, Rakusan T, Liu XH: A 20-year history of childhood HIV-
associated nephropathy. Pediatr Nephrol 19: 1075–1092, 2004
18. Albini A, Benelli R, Presta M, Rusnati M, Ziche M, Rubartelli A,
Paglialunga G, Bussolino F, Noonan D: HIV-tat protein is a heparin-
binding angiogenic growth factor. Oncogene 12: 289–297, 1996
19. Chu CL, Buczek-Thomas JA, Nugent MA: Heparan sulphate proteo-
glycans modulate fibroblast growth factor-2 binding through a lipid
raft-mediated mechanism. Biochem J 379: 331–341, 2004
20. Urbinati C, Nicoli S, Giacca M, David G, Fiorentini S, Caruso A, Alfano
M, Cassetta L, Presta M, Rusnati M: HIV-1 Tat and heparan sulfate
proteoglycan interaction: A novel mechanism of lymphocyte adhesion
and migration across the endothelium. Blood 114: 3335–3342, 2009
21. Fittipaldi A, Ferrari A, Zoppé M, Arcangeli C, Pellegrini V, Beltram F,
Giacca M: Cell membrane lipid rafts mediate caveolar endocytosis of
HIV-1 Tat fusion proteins. J Biol Chem 278: 34141–34149, 2003
22. Wadia JS, Stan RV, Dowdy SF: Transducible TAT-HA fusogenic peptide
enhances escape of TAT-fusion proteins after lipid raft macro-
pinocytosis. Nat Med 10: 310–315, 2004
23. Chini B, Parenti M: G-protein coupled receptors in lipid rafts and caveolae:
How, when and why do they go there? J Mol Endocrinol 32: 325–338, 2004
24. Pike LJ: The challenge of lipid rafts. J Lipid Res 50[Suppl]: S323–S328, 2009
25. Simons K, Ikonen E: Functional rafts in cell membranes. Nature 387:
569–572, 1997
26. Zhong Y, Hennig B, Toborek M: Intact lipid rafts regulate HIV-1 Tat
protein-induced activation of the Rho signaling and upregulation of
P-glycoprotein in brain endothelial cells. J Cereb Blood Flow Metab 30:
522–533, 2010
27. Zhong Y, Smart EJ, Weksler B, Couraud PO, Hennig B, Toborek M:
Caveolin-1 regulates human immunodeficiency virus-1 Tat-induced
alterations of tight junction protein expression via modulation of the
Ras signaling. J Neurosci 28: 7788–7796, 2008
28. Zhu L, Jiang R, Aoudjit L, Jones N, Takano T: Activation of Rho-A in
podocytes induces focal segmental glomerulosclerosis. J Am Soc
Nephrol 22: 1621–1630, 2011
29. Ray PE, Liu XH, Henry D, Dye L 3rd, Xu L, Orenstein JM, Schuztbank TE:
Infection of human primary renal epithelial cells with HIV-1 from children
with HIV-associated nephropathy. Kidney Int 53: 1217–1229, 1998
30. Mörner A, Björndal A, Albert J, Kewalramani VN, Littman DR, Inoue R,
Thorstensson R, Fenyö EM, Björling E: Primary human immunodeficiency
virus type 2 (HIV-2) isolates, like HIV-1 isolates, frequently use CCR5 but
show promiscuity in coreceptor usage. J Virol 73: 2343–2349, 1999
31. Rayne F, Debaisieux S, Yezid H, Lin YL, Mettling C, Konate K, Chazal N,
Arold ST, Pugnière M, Sanchez F, Bonhoure A, Briant L, Loret E, Roy C,
Beaumelle B: Phosphatidylinositol-(4,5)-bisphosphate enables efficient
secretion of HIV-1 Tat by infected T-cells. EMBO J 29: 1348–1362, 2010
32. Epand RM: Cholesterol and the interaction of proteins with membrane
domains. Prog Lipid Res 45: 279–294, 2006
1812 Journal of the American Society of Nephrology J Am Soc Nephrol 25: 1800–1813, 2014
BASIC RESEARCH www.jasn.org

14. 33. Williamson CD, Zhang A, Colberg-Poley AM: The human cytomega-
lovirus protein UL37 exon 1 associates with internal lipid rafts. J Virol 85:
2100–2111, 2011
34. Ensoli B, Gendelman R, Markham P, Fiorelli V, Colombini S, Raffeld M,
Cafaro A, Chang HK, Brady JN, Gallo RC: Synergy between basic fi-
broblast growth factor and HIV-1 Tat protein in induction of Kaposi’s
sarcoma. Nature 371: 674–680, 1994
35. Barillari G, Gendelman R, Gallo RC, Ensoli B: The Tat protein of human
immunodeficiency virus type 1, a growth factor for AIDS Kaposi sar-
coma and cytokine-activated vascular cells, induces adhesion of the
same cell types by using integrin receptors recognizing the RGD amino
acid sequence. Proc Natl Acad Sci U S A 90: 7941–7945, 1993
36. Ray PE, Tassi E, Liu XH, Wellstein A: Role of fibroblast growth factor-binding
protein in the pathogenesis of HIV-associated hemolytic uremic syndrome.
Am J Physiol Regul Integr Comp Physiol 290: R105–R113, 2006
37. Jerebtsova M, LiuXH,YeX,Ray PE:Adenovirus-mediatedgenetransferto
glomerular cells in newborn mice. Pediatr Nephrol 20: 1395–1400, 2005
38. Mattison PC, Soler-García AA, Das JR, Jerebtsova M, Perazzo S, Tang P, Ray
PE: Role of circulating fibroblast growth factor-2 in lipopolysaccharide-
induced acute kidney injury in mice. Pediatr Nephrol 27: 469–483, 2012
39. Jerebtsova M, Wong E, Przygodzki R, Tang P, Ray PE: A novel role of fi-
broblast growth factor-2 and pentosan polysulfate in the pathogenesis of
intestinal bleeding in mice. Am J Physiol Heart Circ Physiol 292: H743–
H750, 2007
40. Whalen GF, Shing Y, Folkman J: The fate of intravenously administered
bFGF and the effect of heparin. Growth Factors 1: 157–164, 1989
41. Hauber J, Malim MH, Cullen BR: Mutational analysis of the conserved
basic domain of human immunodeficiency virus tat protein. J Virol 63:
1181–1187, 1989
42. Ruben S, Perkins A, Purcell R, Joung K, Sia R, Burghoff R, Haseltine WA,
Rosen CA: Structural and functional characterization of human immu-
nodeficiency virus tat protein. J Virol 63: 1–8, 1989
43. Boykins RA, Mahieux R, Shankavaram UT, Gho YS, Lee SF, Hewlett IK,
Wahl LM, Kleinman HK, Brady JN, Yamada KM, Dhawan S: Cutting
edge: A short polypeptide domain of HIV-1-Tat protein mediates
pathogenesis. J Immunol 163: 15–20, 1999
44. Mitola S, Soldi R, Zanon I, Barra L, Gutierrez MI, Berkhout B, Giacca M,
Bussolino F: Identification of specific molecular structures of human
immunodeficiency virus type 1 Tat relevant for its biological effects on
vascular endothelial cells. J Virol 74: 344–353, 2000
45. Zhong Y, Zhang B, Eum SY, Toborek M: HIV-1 Tat triggers nuclear lo-
calization of ZO-1 via Rho signaling and cAMP response element-
binding protein activation. J Neurosci 32: 143–150, 2012
46. Page-McCaw A, Ewald AJ, Werb Z: Matrix metalloproteinases and
the regulation of tissue remodelling. Nat Rev Mol Cell Biol 8: 221–
233, 2007
47. Chetty C, Lakka SS, Bhoopathi P, Gondi CS, Veeravalli KK, Fassett D,
Klopfenstein JD, Dinh DH, Gujrati M, Rao JS: Urokinase plasminogen
activator receptor and/or matrix metalloproteinase-9 inhibition induces
apoptosis signaling through lipid rafts in glioblastoma xenograft cells.
Mol Cancer Ther 9: 2605–2617, 2010
48. Raghu H, Sodadasu PK, Malla RR, Gondi CS, Estes N, Rao JS: Localization
of uPAR and MMP-9 in lipid rafts is critical for migration, invasion and
angiogenesis in human breast cancer cells. BMC Cancer 10: 647, 2010
49. Zhang Q, Chen X, Zhou J, Zhang L, Zhao Q, Chen G, Xu J, Qian F, Chen
Z: CD147, MMP-2, MMP-9 and MVD-CD34 are significant predictors of
recurrence after liver transplantation in hepatocellular carcinoma pa-
tients. Cancer Biol Ther 5: 808–814, 2006
50. Etienne-Manneville S, Hall A: Rho GTPases in cell biology. Nature 420:
629–635, 2002
51. Sasaki T, Hatta H, Osawa G: Cytokines and podocyte injury: The
mechanism of fibroblast growth factor 2-induced podocyte injury.
Nephrol Dial Transplant 14[Suppl 1]: 33–34, 1999
52. Genovese G, Friedman DJ, Ross MD, Lecordier L, Uzureau P, Freedman
BI, Bowden DW, Langefeld CD, Oleksyk TK, Uscinski Knob AL,
Bernhardy AJ, Hicks PJ, Nelson GW, Vanhollebeke B, Winkler CA, Kopp
JB, Pays E, Pollak MR: Association of trypanolytic ApoL1 variants with
kidney disease in African Americans. Science 329: 841–845, 2010
53. Pollak MR, Genovese G, Friedman DJ: APOL1 and kidney disease. Curr
Opin Nephrol Hypertens 21: 179–182, 2012
54. Lu TC, He JC, Wang ZH, Feng X, Fukumi-Tominaga T, Chen N, Xu J,
Iyengar R, Klotman PE: HIV-1 Nef disrupts the podocyte actin cyto-
skeleton by interacting with diaphanous interacting protein. J Biol
Chem 283: 8173–8182, 2008
55. Emiliani S, Fischle W, Ott M, Van Lint C, Amella CA, Verdin E: Muta-
tions in the tat gene are responsible for human immunodeficiency virus
type 1 postintegration latency in the U1 cell line. J Virol 72: 1666–1670,
1998
56. Kozarsky K, Grossman M, Wilson JM: Adenovirus-mediated correction
of the genetic defect in hepatocytes from patients with familial hy-
percholesterolemia. Somat Cell Mol Genet 19: 449–458, 1993
57. Jerebtsova M, Ye X, Ray PE: A simple technique to establish a long-term
adenovirus mediated gene transfer to the heart of newborn mice.
Cardiovasc Hematol Disord Drug Targets 9: 136–140, 2009
58. Forough R, Xi Z, MacPhee M, Friedman S, Engleka KA, Sayers T, Wiltrout
RH, Maciag T: Differential transforming abilities of non-secreted and
secreted forms of human fibroblast growth factor-1. J Biol Chem 268:
2960–2968, 1993
59. Anderson RD, Haskell RE, Xia H, Roessler BJ, Davidson BL: A simple
method for the rapid generation of recombinant adenovirus vectors.
Gene Ther 7: 1034–1038, 2000
60. Vogelmann SU, Nelson WJ, Myers BD, Lemley KV: Urinary excretion of
viable podocytes in health and renal disease. Am J Physiol Renal
Physiol 285: F40–F48, 2003
61. Van Doren K, Gluzman Y: Efficient transformation of human fibroblasts by
adenovirus-simian virus 40 recombinants. Mol Cell Biol 4: 1653–1656, 1984
62. Sakairi T, Abe Y, Kajiyama H, Bartlett LD, Howard LV, Jat PS, Kopp JB:
Conditionally immortalized human podocyte cell lines established from
urine. Am J Physiol Renal Physiol 298: F557–F567, 2010
63. Bohan CA, Kashanchi F, Ensoli B, Buonaguro L, Boris-Lawrie KA, Brady
JN: Analysis of Tat transactivation of human immunodeficiency virus
transcription in vitro. Gene Expr 2: 391–407, 1992
64. Mousseau G, Clementz MA, Bakeman WN, Nagarsheth N, Cameron M,
Shi J, Baran P, Fromentin R, Chomont N, Valente ST: An analog of the
natural steroidal alkaloid cortistatin A potently suppresses Tat-
dependent HIV transcription. Cell Host Microbe 12: 97–108, 2012
65. Arya SK,Guo C,JosephsSF,Wong-Staal F:Trans-activator geneofhuman
T-lymphotropic virus type III (HTLV-III). Science 229: 69–73, 1985
66. Gavard J, Patel V, Gutkind JS: Angiopoietin-1 prevents VEGF-induced
endothelial permeability by sequestering Src through mDia. Dev Cell
14: 25–36, 2008
67. Hauber J, Perkins A, Heimer EP, Cullen BR: Trans-activation of human
immunodeficiency virus gene expression is mediated by nuclear
events. Proc Natl Acad Sci U S A 84: 6364–6368, 1987
68. Kopp JB, Klotman ME, Adler SH, Bruggeman LA, Dickie P, Marinos NJ,
Eckhaus M, Bryant JL, Notkins AL, Klotman PE: Progressive glomerulo-
sclerosis and enhanced renal accumulation of basement membrane
components in mice transgenic for human immunodeficiency virus type 1
genes. Proc Natl Acad Sci U S A 89: 1577–1581, 1992
69. Li Z, Jerebtsova M, Liu XH, Tang P, Ray PE: Novel cystogenic role of
basic fibroblast growth factor in developing rodent kidneys. Am J
Physiol Renal Physiol 291: F289–F296, 2006
70. Gupta AR, Dejneka NS, D’Amato RJ, Yang Z, Syed N, Maguire AM,
Bennett J: Strain-dependent anterior segment neovascularization fol-
lowing intravitreal gene transfer of basic fibroblast growth factor
(bFGF). J Gene Med 3: 252–259, 2001
This article contains supplemental material online at http://jasn.asnjournals.
org/lookup/suppl/doi:10.1681/ASN.2013070710/-/DCSupplemental.
J Am Soc Nephrol 25: 1800–1813, 2014 Lipid Raft–Associated HIV-Tat Regulates Signaling 1813
www.jasn.org BASIC RESEARCH