SlideShare uma empresa Scribd logo
1 de 51
geneticists Association
e 2013 Dublin
Polyploidy: ancient andPolyploidy: ancient and
modern signatures inmodern signatures in
karyotypes of crops andkaryotypes of crops and
breeding materialbreeding material
Pat Heslop-Harrison
Phh4@le.ac.uk
Website: www.molcyt.com or
www.molecularcytogenetics.com
UserID/PW ‘visitor’
To download full text of papers
Recent polyploidy
◦ Revealed by cytogenetics and hybridization
Recent rearrangements or duplications
◦ Revealed by molecular cytogenetics
Ancient, evolutionary polyploidy
◦ Revealed by sequencing
Understanding polyploidy is important for
speciation, evolution and breeding
Different sequence classes evolve at
different rates and many are saltatory
rather than clocks
Consequences and applications
DasypyrumDasypyrum
breviaristatumbreviaristatum
2n=4x=282n=4x=28
Is itIs it AAAAAAAA oror AAAABB??
D. villosum (genomic
DNA green) × D.
breviaristatum (red)
Meiotic metaphase I in a
F1 hybrid showing
autotetraploid nature
Galasso et al.
Wheat evolution and hybridsWheat evolution and hybrids
Triticum uratu
2n=2x=14
AA
Einkorn
Triticum monococcum
2n=2x=14
AA
Bread wheat
Triticum
aestivum
2n=6x=42
AABBDD
Durum/Spaghetti
Triticum turgidum ssp durum
2n=4x=28
AABB
Triticum dicoccoides
2n=4x=28
AABB
Aegilops speltoides
relative
2n=2x=14
BB Triticum tauschii
(Aegilops squarrosa)
2n=2x=14
DD
Triticale
xTriticosecale
2n=6x=42
AABBRR
Rye
Secale cereale
2n=2x=14
RR
Satellite DNA probe green
Evolution of Wheats - PolyploidyEvolution of Wheats - Polyploidy
Common Ancestor
2n=2x=14
Aegilops ventricosa
2n=4x=28
DDNN
Triticum tauschii
2n=2x=14
DD
Aegilops uniaristata
2n=2x=14
NN
Triticum aestivum
2n=6x=42
AABBDD
Triticum durum
2n=4x=28
AABB
Triticum
monococcum
2n=2x=14
AA
Aegilops sp.
2n=2x=14
BB
Aegilops
2n=2x=14
Triticum
2n=2x=14
Lodging in cereals
Use of repetitiveUse of repetitive
DNA sequences asDNA sequences as
chromosomechromosome
markersmarkers
Aegilops tauschiiAegilops tauschii in Iranin Iran
Dpta1
dpTa1-
Repetitive
banding pattern
does correlate
with taxonomic
grouping
Copyright restrictions may apply.
Saeidi, H. et al. Ann Bot 2008 101:855-861; doi:10.1093/aob/mcn042
UPGMA dendrograms of the relationships based on IRAP analysis of (A) accessions of Ae.
tauschii subsp
Wild diploid bananaWild diploid banana
Cavendish : ‘Western’
banana cultivar
2n=3x=33;
AAA genomes
RetroelementsRetroelements
Sequences which amplify through an RNASequences which amplify through an RNA
intermediateintermediate
50% of all the DNA!
Alignment of two BACs shows gaps in both A and B genome
MA4_82I11
MBP_81C12
MuhAT
1
MuhAT2
a
XX TE (SINGLE)XX TE MITE
XX TE
(AGNABI)
MuhAT3 MuhAT4 MITE(MBIR
)
XX TE XX TE (MBT)
272 bp 102,190
bp
26, 410 bp 128,068 bp
DNA transposons hAT are particularly frequent
hAT (named from hobo (Drosophila), Ac-Ds (maize), and Tam3 (Antirrhinum)
transposon are characterized by an 8 bp TSD8 bp TSD, and short TIRs of 5–27 bpshort TIRs of 5–27 bp
flanking a transposase (sometimes degenerate) including a DDE site.
Non-autonomous (sometimes called MITEs, miniature inverted transposable
elements) derivatives of hAT elements are also found, with deletion of most of
the coding sequence, and may amplify to huge copy numbers.
Menzel, Schmidt, Nouroz, HH in prep 2013
RetroelementsRetroelements
Homologous BAC sequences from Calcutta
4 Homologous over the full length
except for a 5kb insert
a Ty1-copia retroelement
01/07/13 19
Sr. No. Primer Pairs Product Size
(bp)
Sequence
1. hAT18486
hAT19037
560 ACCCACCTGGCTCTTGTGTC
AGCGAATGTGTTTTGACCAC
MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs.
Musa balbisiana (MBP 81C12)
Musaacuminata(MA482I11)
Transposed Element
hAT 1
hAT 2
hAT 4
Microsatellite (AT)
hAT 3621 bp MBT
384 bp TE + 781 MITE
1676 TE
Microsatellite (AT)
4192 bp TE
01/07/13 20
Sr. No. Primer Pairs Product Size
(bp)
Sequence
1. hAT18486
hAT19037
560 ACCCACCTGGCTCTTGTGTC
AGCGAATGTGTTTTGACCAC
MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs.
Musa balbisiana (MBP 81C12)
Musaacuminata(MA482I11)
Transposed Element
hAT 1
hAT 2
hAT 4
Microsatellite (AT)
hAT 3621 bp MBT
384 bp TE + 781 MITE
1676 TE
Microsatellite (AT)
4192 bp TE
A-genome specific hAT in three
Musa hybrids (2n=3x=33)
Musa ‘Williams Cavendish’
(AAA)
Musa
(ABB)
Musa
(ABB)
01/07/13 22
Dot plot showing the complete Inverted
repeat.
01/07/13 23
HP-1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48
1KB
800
600
400
200
hAT1 insertion sites in Musa diversity collection
hAT486F and hAT037R
Top bands (560-bp) amplified hAT element and lower bands amplifying the flanking
sequences only – Menzel, Nouroz, Schmidt, Schwarzacher, Heslop-Harrison 2013/14
Retroelement Markers
Retrotransposon
LTRLTR
Retrotransposon
LTRLTR
RetrotransposonLTR LTR
Retrotransposon
LTRLTR
Insertion
IRAP – InterRetroelement PCR
Retrotransposon
LTRLTR
RetrotransposonLTR LTR
IRAP diversity in MusaIRAP diversity in Musa
Teo, Tan, Ho, Faridah, Othman, HH, Kalendar, Schulman 2005 J Plant Biol
Nair, Teo, Schwarzacher, HH 2006 Euphytica
Teo, Schwarzacher et al. in prep.
01/07/13 26Phylogenetic analysis of Musa genomes – separating species. Teo, Schwarzacher et al.
Diploid 2n=2x=22 Musa / banana metaphase probed red with transposable element
Timing of LTR Retrotransposon insertion in Musa
Red 0 to 2 Mya, yellow 2 to 4 Mya, green 4 to 6 Mya and blue older
D’Hont et al. 2012
The Banana GenomeThe Banana Genome
Seven countries + international organization
coordinated by Angelique D’Hont - France
(CIRAD, Genoscope)
523 Mb DH-Pahang genome size (flow
cytometry)
27.5 million Roche/454 single reads 16 x
coverage
2.1 million Sanger reads 4 x coverage
50.3 x of Illumina data
54 BAC sequences (1%)
A D’Hont et al. Nature 000, 1-5 (2012) doi:10.1038/nature11241
Six-way Venn diagram showing the distribution of shared gene
families (sequence clusters) among M. acuminata, P. dactylifera,
Arabidopsis thaliana, Oryza sativa, Sorghum bicolor and Brachypodium
distachyon genomes.
A D’Hont et al. Nature 000, 1-5 (2012) doi:10.1038/nature11241
Whole-genome duplication events.
A D’Hont et al. Nature 2012
doi:10.1038/nature11241
A D’Hont et al. Nature 2012
doi:10.1038/nature11241
1010 µµmm
DNA methylation is unevenly distributed onDNA methylation is unevenly distributed on
MusaMusa chromosomeschromosomes
copiacopia
elementselements
in methylatedin methylated
regions, but alsoregions, but also
in some lowin some low
methylatedmethylated
regions (arrows)regions (arrows)
5MeC
1010 µµmm
C.H Teo and Schwarzacher
5MeC
DNA methylation is unevenly distributed onDNA methylation is unevenly distributed on
MusaMusa chromosomeschromosomes
gypsygypsy
elementselements
in methylatedin methylated
regions, but alsoregions, but also
in some lowin some low
methylatedmethylated
regions (arrows)regions (arrows)
Teo &Teo &
Schwarzacher inSchwarzacher in
prep 2013prep 2013
Arachis hypogaeaArachis hypogaea - Peanut- Peanut
Tetraploid of recent origin,Tetraploid of recent origin,
ancestors separated only 3 My agoancestors separated only 3 My ago
Ana Claudia Araujo, David Bertioli, PHH et al.
Embrapa, Brasília. Annals Botany in press 2013
A2n=4x=40probed
(A.duranered)A.ipaënsis

Be
Arachis duranensis BAC probes on A.
hypogea chromosomes
Right: green BAC AD52G19;red AD79O23
Below: red AD51I17
Below right: green AD179B13;red 5S
rDNA
paradox in the evolution of genome
structure: the predominant repetitive DNA
genome fraction is in evolutionary flux,
whilst, at the same time, low copy
number DNA is conserved over
evolutionary time
Size and location of
chromosome regions
from radish (Raphanus
sativus) carrying the
fertility restorer Rfk1
gene and transfer to
spring turnip rape
(Brassica rapa)
DAPI metaphase blue
Radish genomic red
(labels 2 radish
chromosomes and 45S
rDNA)
Rfk1 carrying BAC green
labels sites on radish and
homoeologous pair in
Brassica
Tarja Niemelä,
Seppänen, Badakshi,
Rokka HH
Chromosome Research
2012
Recent polyploidy
◦ Revealed by cytogenetics and hybridization
Recent rearrangements or duplications
◦ Revealed by molecular cytogenetics
Ancient, evolutionary polyploidy
◦ Revealed by sequencing
Understanding polyploidy is important for
speciation, evolution and breeding
Different sequence classes evolve at
different rates and many are saltatory
rather than clocks
Consequences and applications
Anything special about cropAnything special about crop
genomes?genomes?
Crop Genome size 2n Ploidy Food
Rice 400 Mb 24 2 3x endosperm
Wheat 17,000 Mbp 42 6 3x endosperm
Maize 950 Mbp 10 4 (palaeo-tetraploid) 3x endosperm
Potato 900 Mbp 48 4 Modifed leaf
Sugar beet 758 Mbp 18 2 Modified root
Cassava 770 Mbp 36 2 Tuber
Peanut 2,800 Mbp 40 4 Seed cotyledon
Oil palm 3,400 Mbp 32 Fruit mesocarp
Banana 523 Mbp 2x 33 3 Fruit mesocarp
Heslop-Harrison 2012. www.tinyurl.com/domest
50 years of plant breeding50 years of plant breeding
progressprogress
Global production figuresGlobal production figures
Agronomy&
Nitrogen
Genetics
Transgenic
Bt insect-resistant maize
(& herbicide tolerant)
CytoGenomics …CytoGenomics …
The genepool has the
diversity to address these
challenges …
New methods to exploit and
characterize germplasm let
use make better and
sustainable use of the
genepool
www.molcyt.comwww.molcyt.com
phh4@le.ac.ukphh4@le.ac.uk
Recent polyploidy
◦ Revealed by cytogenetics and hybridization
Recent rearrangements or duplications
◦ Revealed by molecular cytogenetics
Ancient, evolutionary polyploidy
◦ Revealed by sequencing
Understanding polyploidy is important for
speciation, evolution and breeding
Different sequence classes evolve at
different rates and many are saltatory
rather than clocks
Consequences and applications
geneticists Association
e 2013 Dublin
Polyploidy: ancient andPolyploidy: ancient and
modern signatures inmodern signatures in
karyotypes of crops andkaryotypes of crops and
breeding materialbreeding material
Pat Heslop-Harrison
Phh4@le.ac.uk
Website: www.molcyt.com or
www.molecularcytogenetics.com
UserID/PW ‘visitor’
To download full text of papers

Mais conteúdo relacionado

Mais procurados

Triparental Mating
Triparental MatingTriparental Mating
Triparental Mating
roxanne-b
 
[Micro] bacterial genetics (12 jan)
[Micro] bacterial genetics (12 jan)[Micro] bacterial genetics (12 jan)
[Micro] bacterial genetics (12 jan)
Muhammad Ahmad
 
Cytoplasmic inheritance and Chloroplast engineering
Cytoplasmic inheritance and Chloroplast engineeringCytoplasmic inheritance and Chloroplast engineering
Cytoplasmic inheritance and Chloroplast engineering
SANJAY KUMAR SANADYA
 
Genetic markers in characterization2
Genetic markers in characterization2Genetic markers in characterization2
Genetic markers in characterization2
Bruno Mmassy
 
13 genetic engineering bw
13 genetic engineering bw13 genetic engineering bw
13 genetic engineering bw
honey444
 
Thesis Power Point Presentation
Thesis Power Point PresentationThesis Power Point Presentation
Thesis Power Point Presentation
riddhikapandya1985
 

Mais procurados (20)

Haploid production by centromere mediated genome elimination
Haploid production by centromere mediated genome eliminationHaploid production by centromere mediated genome elimination
Haploid production by centromere mediated genome elimination
 
Chloroplast genomics and biotechnology
Chloroplast genomics and biotechnologyChloroplast genomics and biotechnology
Chloroplast genomics and biotechnology
 
Transplastomics
TransplastomicsTransplastomics
Transplastomics
 
Triparental Mating
Triparental MatingTriparental Mating
Triparental Mating
 
[Micro] bacterial genetics (12 jan)
[Micro] bacterial genetics (12 jan)[Micro] bacterial genetics (12 jan)
[Micro] bacterial genetics (12 jan)
 
Transgenic animal production and its application
Transgenic animal  production and its applicationTransgenic animal  production and its application
Transgenic animal production and its application
 
Cytoplasmic inheritance and Chloroplast engineering
Cytoplasmic inheritance and Chloroplast engineeringCytoplasmic inheritance and Chloroplast engineering
Cytoplasmic inheritance and Chloroplast engineering
 
Genetic markers in characterization2
Genetic markers in characterization2Genetic markers in characterization2
Genetic markers in characterization2
 
bacteriophage.ppt
bacteriophage.pptbacteriophage.ppt
bacteriophage.ppt
 
Bacterial genetics
Bacterial geneticsBacterial genetics
Bacterial genetics
 
20081217 05邵彥春 與紅麴菌菌絲發育相關基因的克隆及序列分析
20081217 05邵彥春 與紅麴菌菌絲發育相關基因的克隆及序列分析20081217 05邵彥春 與紅麴菌菌絲發育相關基因的克隆及序列分析
20081217 05邵彥春 與紅麴菌菌絲發育相關基因的克隆及序列分析
 
cytoplasmic effect and genetic engineering of chloroplasts
cytoplasmic effect and genetic engineering of chloroplastscytoplasmic effect and genetic engineering of chloroplasts
cytoplasmic effect and genetic engineering of chloroplasts
 
13 genetic engineering bw
13 genetic engineering bw13 genetic engineering bw
13 genetic engineering bw
 
Biological method of transformation
Biological method of transformation Biological method of transformation
Biological method of transformation
 
Bacterial genetics
Bacterial geneticsBacterial genetics
Bacterial genetics
 
Thesis Power Point Presentation
Thesis Power Point PresentationThesis Power Point Presentation
Thesis Power Point Presentation
 
Bacterial genetics /certified fixed orthodontic courses by Indian dental acad...
Bacterial genetics /certified fixed orthodontic courses by Indian dental acad...Bacterial genetics /certified fixed orthodontic courses by Indian dental acad...
Bacterial genetics /certified fixed orthodontic courses by Indian dental acad...
 
Symmetric & Asymmetric Hybrid and Cybrid
Symmetric & Asymmetric Hybrid and CybridSymmetric & Asymmetric Hybrid and Cybrid
Symmetric & Asymmetric Hybrid and Cybrid
 
Genetic Analysis and Mapping in Bacteria and Bacteriophages
Genetic Analysis and Mapping in Bacteria and Bacteriophages Genetic Analysis and Mapping in Bacteria and Bacteriophages
Genetic Analysis and Mapping in Bacteria and Bacteriophages
 
Genome evolution - tales of scales DNA to crops,months to billions of years, ...
Genome evolution - tales of scales DNA to crops,months to billions of years, ...Genome evolution - tales of scales DNA to crops,months to billions of years, ...
Genome evolution - tales of scales DNA to crops,months to billions of years, ...
 

Semelhante a Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013

Cloning and sequence analysis of banana streak virus dna. harper 1998
Cloning and sequence analysis of banana streak virus dna. harper 1998Cloning and sequence analysis of banana streak virus dna. harper 1998
Cloning and sequence analysis of banana streak virus dna. harper 1998
Paloma Susan
 
2013 GRM: Improve chickpea productivity for marginal environments in sub-Sah...
2013 GRM: Improve chickpea productivity for marginal environments in  sub-Sah...2013 GRM: Improve chickpea productivity for marginal environments in  sub-Sah...
2013 GRM: Improve chickpea productivity for marginal environments in sub-Sah...
CGIAR Generation Challenge Programme
 
Validation of reference genes in leaf-cutting ant Atta sexdens rubropilosa in...
Validation of reference genes in leaf-cutting ant Atta sexdens rubropilosa in...Validation of reference genes in leaf-cutting ant Atta sexdens rubropilosa in...
Validation of reference genes in leaf-cutting ant Atta sexdens rubropilosa in...
IJEAB
 
Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...
Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...
Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...
Pat (JS) Heslop-Harrison
 

Semelhante a Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013 (20)

plastome engineering
plastome engineeringplastome engineering
plastome engineering
 
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison DelhiMolecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
 
In situ hybridization results and examples for course Trude Schwarzacher
In situ hybridization results and examples for course Trude SchwarzacherIn situ hybridization results and examples for course Trude Schwarzacher
In situ hybridization results and examples for course Trude Schwarzacher
 
Rapid Impact Assessment of Climatic and Physio-graphic Changes on Flagship G...
Rapid Impact Assessment of Climatic and Physio-graphic Changes  on Flagship G...Rapid Impact Assessment of Climatic and Physio-graphic Changes  on Flagship G...
Rapid Impact Assessment of Climatic and Physio-graphic Changes on Flagship G...
 
art%3A10.1186%2F1756-0500-6-299
art%3A10.1186%2F1756-0500-6-299art%3A10.1186%2F1756-0500-6-299
art%3A10.1186%2F1756-0500-6-299
 
chloroplast genome ppt.
chloroplast genome ppt.chloroplast genome ppt.
chloroplast genome ppt.
 
Next Generation Sequencing Technologies and Their Applications in Ornamental ...
Next Generation Sequencing Technologies and Their Applications in Ornamental ...Next Generation Sequencing Technologies and Their Applications in Ornamental ...
Next Generation Sequencing Technologies and Their Applications in Ornamental ...
 
Genome Sequencing in Finger Millet
Genome Sequencing in Finger MilletGenome Sequencing in Finger Millet
Genome Sequencing in Finger Millet
 
Pierre Taberlet - Saturday Closing Plenary
Pierre Taberlet - Saturday Closing PlenaryPierre Taberlet - Saturday Closing Plenary
Pierre Taberlet - Saturday Closing Plenary
 
21 kebere bezaweletaw 207-217
21 kebere bezaweletaw 207-21721 kebere bezaweletaw 207-217
21 kebere bezaweletaw 207-217
 
Molecular systematics.pdf
Molecular systematics.pdfMolecular systematics.pdf
Molecular systematics.pdf
 
Cloning and sequence analysis of banana streak virus dna. harper 1998
Cloning and sequence analysis of banana streak virus dna. harper 1998Cloning and sequence analysis of banana streak virus dna. harper 1998
Cloning and sequence analysis of banana streak virus dna. harper 1998
 
Models of Human Diseases Conference (2010) Tetrahymena model by Dr. R. Pearl...
Models of Human Diseases Conference (2010)  Tetrahymena model by Dr. R. Pearl...Models of Human Diseases Conference (2010)  Tetrahymena model by Dr. R. Pearl...
Models of Human Diseases Conference (2010) Tetrahymena model by Dr. R. Pearl...
 
Presentation 6: Vibrio parahaemolyticus: genome plasticity, mobile genetic el...
Presentation 6: Vibrio parahaemolyticus: genome plasticity, mobile genetic el...Presentation 6: Vibrio parahaemolyticus: genome plasticity, mobile genetic el...
Presentation 6: Vibrio parahaemolyticus: genome plasticity, mobile genetic el...
 
Chromosomes cymbidoidae
Chromosomes cymbidoidaeChromosomes cymbidoidae
Chromosomes cymbidoidae
 
2013 GRM: Improve chickpea productivity for marginal environments in sub-Sah...
2013 GRM: Improve chickpea productivity for marginal environments in  sub-Sah...2013 GRM: Improve chickpea productivity for marginal environments in  sub-Sah...
2013 GRM: Improve chickpea productivity for marginal environments in sub-Sah...
 
Ph.D. Candidate Exam Slides
Ph.D. Candidate Exam SlidesPh.D. Candidate Exam Slides
Ph.D. Candidate Exam Slides
 
Heslopharrisonassisiweb
HeslopharrisonassisiwebHeslopharrisonassisiweb
Heslopharrisonassisiweb
 
Validation of reference genes in leaf-cutting ant Atta sexdens rubropilosa in...
Validation of reference genes in leaf-cutting ant Atta sexdens rubropilosa in...Validation of reference genes in leaf-cutting ant Atta sexdens rubropilosa in...
Validation of reference genes in leaf-cutting ant Atta sexdens rubropilosa in...
 
Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...
Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...
Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...
 

Mais de Pat (JS) Heslop-Harrison

Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
Pat (JS) Heslop-Harrison
 
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
Pat (JS) Heslop-Harrison
 
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal CytogeneticsTandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
Pat (JS) Heslop-Harrison
 
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-HarrisonDomestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
Pat (JS) Heslop-Harrison
 

Mais de Pat (JS) Heslop-Harrison (18)

HeslopHarrisonDurhamFlax.pptx
HeslopHarrisonDurhamFlax.pptxHeslopHarrisonDurhamFlax.pptx
HeslopHarrisonDurhamFlax.pptx
 
Saffron Crocus Genetics and Genomics - University of California Davis Seminar
Saffron Crocus Genetics and Genomics - University of California Davis SeminarSaffron Crocus Genetics and Genomics - University of California Davis Seminar
Saffron Crocus Genetics and Genomics - University of California Davis Seminar
 
Evolution, biodiversity and the banana pangenome
Evolution, biodiversity and the banana pangenomeEvolution, biodiversity and the banana pangenome
Evolution, biodiversity and the banana pangenome
 
Biodiversity and Super Domestication Seminar Pat Heslop-Harrison
Biodiversity and Super Domestication Seminar Pat Heslop-HarrisonBiodiversity and Super Domestication Seminar Pat Heslop-Harrison
Biodiversity and Super Domestication Seminar Pat Heslop-Harrison
 
Heslop harrison dessalegnethiopiafeb2020withmeetingtitle
Heslop harrison dessalegnethiopiafeb2020withmeetingtitleHeslop harrison dessalegnethiopiafeb2020withmeetingtitle
Heslop harrison dessalegnethiopiafeb2020withmeetingtitle
 
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...
 
Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-Harrison
Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-HarrisonMolecular Cytogenetics Research Group Dec 2016 Pat Heslop-Harrison
Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-Harrison
 
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
 
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
 
In situ hybridization methods and techniques course slides Pat Heslop-Harrison
In situ hybridization methods and techniques course slides Pat Heslop-HarrisonIn situ hybridization methods and techniques course slides Pat Heslop-Harrison
In situ hybridization methods and techniques course slides Pat Heslop-Harrison
 
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal CytogeneticsTandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
 
BS1003: The transition to flowering. Pat Heslop-Harrison
BS1003: The transition to flowering. Pat Heslop-HarrisonBS1003: The transition to flowering. Pat Heslop-Harrison
BS1003: The transition to flowering. Pat Heslop-Harrison
 
BS1003 - Light and plant development lecture
BS1003 - Light and plant development lectureBS1003 - Light and plant development lecture
BS1003 - Light and plant development lecture
 
Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...
Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...
Bs2081 Heslop-Harrison Summary Lecture Ecology and Biodiversity - Agricultura...
 
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory Talk
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory TalkHeslop-Harrison Stochastic Modelling in Ecosystems - Introductory Talk
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory Talk
 
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-HarrisonDomestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
 
Heslop-Harrison Plant development and meristems BS1003
Heslop-Harrison Plant development and meristems BS1003Heslop-Harrison Plant development and meristems BS1003
Heslop-Harrison Plant development and meristems BS1003
 
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...
 

Último

1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi  6.pdf1029-Danh muc Sach Giao Khoa khoi  6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf
QucHHunhnh
 
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in DelhiRussian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
kauryashika82
 
Gardella_PRCampaignConclusion Pitch Letter
Gardella_PRCampaignConclusion Pitch LetterGardella_PRCampaignConclusion Pitch Letter
Gardella_PRCampaignConclusion Pitch Letter
MateoGardella
 

Último (20)

Unit-IV; Professional Sales Representative (PSR).pptx
Unit-IV; Professional Sales Representative (PSR).pptxUnit-IV; Professional Sales Representative (PSR).pptx
Unit-IV; Professional Sales Representative (PSR).pptx
 
Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi  6.pdf1029-Danh muc Sach Giao Khoa khoi  6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf
 
Measures of Dispersion and Variability: Range, QD, AD and SD
Measures of Dispersion and Variability: Range, QD, AD and SDMeasures of Dispersion and Variability: Range, QD, AD and SD
Measures of Dispersion and Variability: Range, QD, AD and SD
 
Web & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdfWeb & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdf
 
SECOND SEMESTER TOPIC COVERAGE SY 2023-2024 Trends, Networks, and Critical Th...
SECOND SEMESTER TOPIC COVERAGE SY 2023-2024 Trends, Networks, and Critical Th...SECOND SEMESTER TOPIC COVERAGE SY 2023-2024 Trends, Networks, and Critical Th...
SECOND SEMESTER TOPIC COVERAGE SY 2023-2024 Trends, Networks, and Critical Th...
 
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in DelhiRussian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
 
Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17
 
psychiatric nursing HISTORY COLLECTION .docx
psychiatric  nursing HISTORY  COLLECTION  .docxpsychiatric  nursing HISTORY  COLLECTION  .docx
psychiatric nursing HISTORY COLLECTION .docx
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
 
Measures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and ModeMeasures of Central Tendency: Mean, Median and Mode
Measures of Central Tendency: Mean, Median and Mode
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The Basics
 
Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...
Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...
Ecological Succession. ( ECOSYSTEM, B. Pharmacy, 1st Year, Sem-II, Environmen...
 
Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..
 
ICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptxICT Role in 21st Century Education & its Challenges.pptx
ICT Role in 21st Century Education & its Challenges.pptx
 
PROCESS RECORDING FORMAT.docx
PROCESS      RECORDING        FORMAT.docxPROCESS      RECORDING        FORMAT.docx
PROCESS RECORDING FORMAT.docx
 
Gardella_PRCampaignConclusion Pitch Letter
Gardella_PRCampaignConclusion Pitch LetterGardella_PRCampaignConclusion Pitch Letter
Gardella_PRCampaignConclusion Pitch Letter
 
Paris 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activityParis 2024 Olympic Geographies - an activity
Paris 2024 Olympic Geographies - an activity
 
Unit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxUnit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptx
 

Polyploidy and molecular cytogenetics in crops: ECA conference Dublin July 2013

  • 1. geneticists Association e 2013 Dublin Polyploidy: ancient andPolyploidy: ancient and modern signatures inmodern signatures in karyotypes of crops andkaryotypes of crops and breeding materialbreeding material Pat Heslop-Harrison Phh4@le.ac.uk Website: www.molcyt.com or www.molecularcytogenetics.com UserID/PW ‘visitor’ To download full text of papers
  • 2. Recent polyploidy ◦ Revealed by cytogenetics and hybridization Recent rearrangements or duplications ◦ Revealed by molecular cytogenetics Ancient, evolutionary polyploidy ◦ Revealed by sequencing Understanding polyploidy is important for speciation, evolution and breeding Different sequence classes evolve at different rates and many are saltatory rather than clocks Consequences and applications
  • 3. DasypyrumDasypyrum breviaristatumbreviaristatum 2n=4x=282n=4x=28 Is itIs it AAAAAAAA oror AAAABB?? D. villosum (genomic DNA green) × D. breviaristatum (red) Meiotic metaphase I in a F1 hybrid showing autotetraploid nature Galasso et al.
  • 4. Wheat evolution and hybridsWheat evolution and hybrids Triticum uratu 2n=2x=14 AA Einkorn Triticum monococcum 2n=2x=14 AA Bread wheat Triticum aestivum 2n=6x=42 AABBDD Durum/Spaghetti Triticum turgidum ssp durum 2n=4x=28 AABB Triticum dicoccoides 2n=4x=28 AABB Aegilops speltoides relative 2n=2x=14 BB Triticum tauschii (Aegilops squarrosa) 2n=2x=14 DD Triticale xTriticosecale 2n=6x=42 AABBRR Rye Secale cereale 2n=2x=14 RR
  • 6.
  • 7. Evolution of Wheats - PolyploidyEvolution of Wheats - Polyploidy Common Ancestor 2n=2x=14 Aegilops ventricosa 2n=4x=28 DDNN Triticum tauschii 2n=2x=14 DD Aegilops uniaristata 2n=2x=14 NN Triticum aestivum 2n=6x=42 AABBDD Triticum durum 2n=4x=28 AABB Triticum monococcum 2n=2x=14 AA Aegilops sp. 2n=2x=14 BB Aegilops 2n=2x=14 Triticum 2n=2x=14
  • 9. Use of repetitiveUse of repetitive DNA sequences asDNA sequences as chromosomechromosome markersmarkers
  • 10.
  • 11. Aegilops tauschiiAegilops tauschii in Iranin Iran Dpta1 dpTa1- Repetitive banding pattern does correlate with taxonomic grouping
  • 12. Copyright restrictions may apply. Saeidi, H. et al. Ann Bot 2008 101:855-861; doi:10.1093/aob/mcn042 UPGMA dendrograms of the relationships based on IRAP analysis of (A) accessions of Ae. tauschii subsp
  • 13.
  • 14. Wild diploid bananaWild diploid banana Cavendish : ‘Western’ banana cultivar 2n=3x=33; AAA genomes
  • 15.
  • 16. RetroelementsRetroelements Sequences which amplify through an RNASequences which amplify through an RNA intermediateintermediate 50% of all the DNA!
  • 17. Alignment of two BACs shows gaps in both A and B genome MA4_82I11 MBP_81C12 MuhAT 1 MuhAT2 a XX TE (SINGLE)XX TE MITE XX TE (AGNABI) MuhAT3 MuhAT4 MITE(MBIR ) XX TE XX TE (MBT) 272 bp 102,190 bp 26, 410 bp 128,068 bp DNA transposons hAT are particularly frequent hAT (named from hobo (Drosophila), Ac-Ds (maize), and Tam3 (Antirrhinum) transposon are characterized by an 8 bp TSD8 bp TSD, and short TIRs of 5–27 bpshort TIRs of 5–27 bp flanking a transposase (sometimes degenerate) including a DDE site. Non-autonomous (sometimes called MITEs, miniature inverted transposable elements) derivatives of hAT elements are also found, with deletion of most of the coding sequence, and may amplify to huge copy numbers. Menzel, Schmidt, Nouroz, HH in prep 2013
  • 18. RetroelementsRetroelements Homologous BAC sequences from Calcutta 4 Homologous over the full length except for a 5kb insert a Ty1-copia retroelement
  • 19. 01/07/13 19 Sr. No. Primer Pairs Product Size (bp) Sequence 1. hAT18486 hAT19037 560 ACCCACCTGGCTCTTGTGTC AGCGAATGTGTTTTGACCAC MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs. Musa balbisiana (MBP 81C12) Musaacuminata(MA482I11) Transposed Element hAT 1 hAT 2 hAT 4 Microsatellite (AT) hAT 3621 bp MBT 384 bp TE + 781 MITE 1676 TE Microsatellite (AT) 4192 bp TE
  • 20. 01/07/13 20 Sr. No. Primer Pairs Product Size (bp) Sequence 1. hAT18486 hAT19037 560 ACCCACCTGGCTCTTGTGTC AGCGAATGTGTTTTGACCAC MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs. Musa balbisiana (MBP 81C12) Musaacuminata(MA482I11) Transposed Element hAT 1 hAT 2 hAT 4 Microsatellite (AT) hAT 3621 bp MBT 384 bp TE + 781 MITE 1676 TE Microsatellite (AT) 4192 bp TE
  • 21. A-genome specific hAT in three Musa hybrids (2n=3x=33) Musa ‘Williams Cavendish’ (AAA) Musa (ABB) Musa (ABB)
  • 22. 01/07/13 22 Dot plot showing the complete Inverted repeat.
  • 23. 01/07/13 23 HP-1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 1KB 800 600 400 200 hAT1 insertion sites in Musa diversity collection hAT486F and hAT037R Top bands (560-bp) amplified hAT element and lower bands amplifying the flanking sequences only – Menzel, Nouroz, Schmidt, Schwarzacher, Heslop-Harrison 2013/14
  • 25. IRAP diversity in MusaIRAP diversity in Musa Teo, Tan, Ho, Faridah, Othman, HH, Kalendar, Schulman 2005 J Plant Biol Nair, Teo, Schwarzacher, HH 2006 Euphytica Teo, Schwarzacher et al. in prep.
  • 26. 01/07/13 26Phylogenetic analysis of Musa genomes – separating species. Teo, Schwarzacher et al.
  • 27. Diploid 2n=2x=22 Musa / banana metaphase probed red with transposable element
  • 28.
  • 29. Timing of LTR Retrotransposon insertion in Musa Red 0 to 2 Mya, yellow 2 to 4 Mya, green 4 to 6 Mya and blue older D’Hont et al. 2012
  • 30. The Banana GenomeThe Banana Genome Seven countries + international organization coordinated by Angelique D’Hont - France (CIRAD, Genoscope)
  • 31. 523 Mb DH-Pahang genome size (flow cytometry) 27.5 million Roche/454 single reads 16 x coverage 2.1 million Sanger reads 4 x coverage 50.3 x of Illumina data 54 BAC sequences (1%)
  • 32. A D’Hont et al. Nature 000, 1-5 (2012) doi:10.1038/nature11241 Six-way Venn diagram showing the distribution of shared gene families (sequence clusters) among M. acuminata, P. dactylifera, Arabidopsis thaliana, Oryza sativa, Sorghum bicolor and Brachypodium distachyon genomes.
  • 33.
  • 34. A D’Hont et al. Nature 000, 1-5 (2012) doi:10.1038/nature11241 Whole-genome duplication events.
  • 35. A D’Hont et al. Nature 2012 doi:10.1038/nature11241
  • 36.
  • 37. A D’Hont et al. Nature 2012 doi:10.1038/nature11241
  • 38. 1010 µµmm DNA methylation is unevenly distributed onDNA methylation is unevenly distributed on MusaMusa chromosomeschromosomes copiacopia elementselements in methylatedin methylated regions, but alsoregions, but also in some lowin some low methylatedmethylated regions (arrows)regions (arrows) 5MeC
  • 39. 1010 µµmm C.H Teo and Schwarzacher 5MeC DNA methylation is unevenly distributed onDNA methylation is unevenly distributed on MusaMusa chromosomeschromosomes gypsygypsy elementselements in methylatedin methylated regions, but alsoregions, but also in some lowin some low methylatedmethylated regions (arrows)regions (arrows) Teo &Teo & Schwarzacher inSchwarzacher in prep 2013prep 2013
  • 40. Arachis hypogaeaArachis hypogaea - Peanut- Peanut Tetraploid of recent origin,Tetraploid of recent origin, ancestors separated only 3 My agoancestors separated only 3 My ago Ana Claudia Araujo, David Bertioli, PHH et al. Embrapa, Brasília. Annals Botany in press 2013
  • 42. Arachis duranensis BAC probes on A. hypogea chromosomes Right: green BAC AD52G19;red AD79O23 Below: red AD51I17 Below right: green AD179B13;red 5S rDNA
  • 43. paradox in the evolution of genome structure: the predominant repetitive DNA genome fraction is in evolutionary flux, whilst, at the same time, low copy number DNA is conserved over evolutionary time
  • 44. Size and location of chromosome regions from radish (Raphanus sativus) carrying the fertility restorer Rfk1 gene and transfer to spring turnip rape (Brassica rapa) DAPI metaphase blue Radish genomic red (labels 2 radish chromosomes and 45S rDNA) Rfk1 carrying BAC green labels sites on radish and homoeologous pair in Brassica Tarja Niemelä, Seppänen, Badakshi, Rokka HH Chromosome Research 2012
  • 45.
  • 46. Recent polyploidy ◦ Revealed by cytogenetics and hybridization Recent rearrangements or duplications ◦ Revealed by molecular cytogenetics Ancient, evolutionary polyploidy ◦ Revealed by sequencing Understanding polyploidy is important for speciation, evolution and breeding Different sequence classes evolve at different rates and many are saltatory rather than clocks Consequences and applications
  • 47. Anything special about cropAnything special about crop genomes?genomes? Crop Genome size 2n Ploidy Food Rice 400 Mb 24 2 3x endosperm Wheat 17,000 Mbp 42 6 3x endosperm Maize 950 Mbp 10 4 (palaeo-tetraploid) 3x endosperm Potato 900 Mbp 48 4 Modifed leaf Sugar beet 758 Mbp 18 2 Modified root Cassava 770 Mbp 36 2 Tuber Peanut 2,800 Mbp 40 4 Seed cotyledon Oil palm 3,400 Mbp 32 Fruit mesocarp Banana 523 Mbp 2x 33 3 Fruit mesocarp Heslop-Harrison 2012. www.tinyurl.com/domest
  • 48. 50 years of plant breeding50 years of plant breeding progressprogress Global production figuresGlobal production figures Agronomy& Nitrogen Genetics Transgenic Bt insect-resistant maize (& herbicide tolerant)
  • 49. CytoGenomics …CytoGenomics … The genepool has the diversity to address these challenges … New methods to exploit and characterize germplasm let use make better and sustainable use of the genepool
  • 50. www.molcyt.comwww.molcyt.com phh4@le.ac.ukphh4@le.ac.uk Recent polyploidy ◦ Revealed by cytogenetics and hybridization Recent rearrangements or duplications ◦ Revealed by molecular cytogenetics Ancient, evolutionary polyploidy ◦ Revealed by sequencing Understanding polyploidy is important for speciation, evolution and breeding Different sequence classes evolve at different rates and many are saltatory rather than clocks Consequences and applications
  • 51. geneticists Association e 2013 Dublin Polyploidy: ancient andPolyploidy: ancient and modern signatures inmodern signatures in karyotypes of crops andkaryotypes of crops and breeding materialbreeding material Pat Heslop-Harrison Phh4@le.ac.uk Website: www.molcyt.com or www.molecularcytogenetics.com UserID/PW ‘visitor’ To download full text of papers

Notas do Editor

  1. Patg Heslop-Harrison www.molcyt.com
  2. Patg Heslop-Harrison www.molcyt.com
  3. Patg Heslop-Harrison www.molcyt.com
  4. Trude Schwarzacher schwarzacher.com
  5. Patg Heslop-Harrison www.molcyt.com
  6. Patg Heslop-Harrison www.molcyt.com
  7. Patg Heslop-Harrison www.molcyt.com
  8. Patg Heslop-Harrison www.molcyt.com
  9. Patg Heslop-Harrison www.molcyt.com
  10. Patg Heslop-Harrison www.molcyt.com
  11. Patg Heslop-Harrison www.molcyt.com
  12. Patg Heslop-Harrison www.molcyt.com
  13. Patg Heslop-Harrison www.molcyt.com