1. Journal of Biotechnology 189 (2014) 1–8
Contents lists available at ScienceDirect
Journal of Biotechnology
journal homepage: www.elsevier.com/locate/jbiotec
Improving the specificity and efficacy of CRISPR/CAS9 and gRNA
through target specific DNA reporter
Jian-Hua Zhanga,∗
, Mritunjay Pandeya
, John F. Kahlera
, Anna Loshakova
,
Benjamin Harrisa
, Pradeep K. Dagurb
, Yin-Yuan Moc
, William F. Simondsa
a
Metabolic Diseases Branch, Bldg. 10, Room 8C-101, National Institute of Diabetes and Digestive and Kidney Diseases, United States
b
Flow Cytometry Core Facility, Bldg. 10, Room 8C-104, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD 20892,
United States
c
Department of Pharmacology and Toxicology, Cancer Institute, The University of Mississippi Medical Center, 2500N State St., Room G651-3, Jackson,
MS 39216, United States
a r t i c l e i n f o
Article history:
Received 8 April 2014
Received in revised form 20 August 2014
Accepted 22 August 2014
Available online 2 September 2014
Keywords:
CRISPR
CAS9
gRNA
EGFP reporter
Specificity
a b s t r a c t
Genomic engineering by the guide RNA (gRNA)-directed CRISPR/CAS9 is rapidly becoming a method of
choice for various biological systems. However, pressing concerns remain regarding its off-target activi-
ties and wide variations in efficacies. While next generation sequencing (NGS) has been primarily used to
evaluate the efficacies and off-target activities of gRNAs, it only detects the imperfectly repaired double
strand DNA breaks (DSB) by the error-prone non-homologous end joining (NHEJ) mechanism and may
not faithfully represent the DSB activities because the efficiency of NHEJ-mediated repair varies depend-
ing on the local chromatin environment. Here we describe a reporter system for unbiased detection and
comparison of DSB activities that promises to improve the chance of success in genomic engineering and
to facilitate large-scale screening of CAS9 activities and gRNA libraries. Additionally, we demonstrated
that the tolerances to mismatches between a gRNA and the corresponding target DNA can occur at any
position of the gRNA, and depend on both specific gRNA sequences and CAS9 constructs used.
Published by Elsevier B.V.
1. Introduction
The target specific genomic engineering through gRNA-directed
Type II CRISPR/CAS9 complex has been successfully applied in var-
ious biological systems including human, mouse, rat, fly, worm,
zebrafish and more recently monkey (Jinek et al., 2012; Cong et al.,
2013; Mali et al., 2013; Cho et al., 2013; Chang et al., 2013; Shen
et al., 2013; Wang et al., 2013; Gratz et al., 2013; Friedland et al.,
2013; Bassett et al., 2013; Li et al., 2013; Hu et al., 2013). However,
the recognition of off-target activities and variations in efficacies
indicates that the potentials of the CRISPR/CAS9 system may not
be fully unleashed until these problems are adequately addressed
(Hsu et al., 2013; Pattanayak et al., 2013; Ran et al., 2013). Although
Abbreviations: CRISPR, clustered regularly interspaced short palindromic
repeats; CAS9, CRISPR associated protein; gRNA, guide RNA; NHEJ, none homologous
end joining; DSB, double strand DNA break; NGS, next generation sequencing.
∗ Corresponding author at: National Institutes of Health, Bldg. 10, Room 8C-205,
10 Center Dr. MSC 1752, Bethesda, MD 20892-1752, USA. Tel.: +1 301 451 1850;
fax: +1 301 402 0374.
E-mail address: jianhuaz@mail.nih.gov (J.-H. Zhang).
there are several bioinformatic tools available for gRNA design and
selection in order to increase the gRNA specificity and enhance the
DSB efficacy, the proof of the prediction accuracy is in fact has to
be after the completion of an actual experiment by the mismatch
nuclease activity assay or NGS of the entire or selected potential off-
target sites of a targeted genome. The lack of a simple method to
validate the DSB specificity and efficacy of a specific gRNA and CAS9
construct prior an actual experiment has been causing uncertain-
ties, which in many cases might be unacceptable such as in creation
of animal models and clinical applications. Additionally, the NGS
and mismatch-based nuclease activity assays rely on the indels
caused by NHEJ mechanism that varies significantly in efficiency
among different chromatin locations, therefore may not faithfully
reflect the DSB activities of either CAS9 or gRNA. Recently, GFP was
elegantly used as a reporter to evaluate DSB efficiencies of gRNAs
against a cloned fragment of target DNA by rescuing a disrupted
GFP with a functional copy of the GFP gene through homologous
recombination (Malina et al., 2013). However the DSB results might
be biased by the homologous recombination efficiencies. We have
developed a target DNA reporter system that can be used for unbi-
ased evaluation of specificities and efficacies of the gRNA guided
http://dx.doi.org/10.1016/j.jbiotec.2014.08.033
0168-1656/Published by Elsevier B.V.

2. 2 J.-H. Zhang et al. / Journal of Biotechnology 189 (2014) 1–8
CAS9 activities. Using this simple reporter system the most favor-
able combinations of a gRNA and CAS9 construct can be selected
in vivo before embarking on the actual experiments.
2. Materials and methods
2.1. Plasmids
pEGFP-C1 plasmid was purchased from Clonetech. The fol-
lowing plasmids were purchased from Addgene: hCAS9 (41815),
px330-CAS9 (42230), gRNA Cloning vector (41824), gRNA AAVS1-
T1(41817), gRNA AAVS1-T2(41818), gRNA GFP-T1 (41819) and
gRNA GFP-T2 (41820). The pW25 plasmid was a gift from Dr.
Kent Golic (University of Utah). The myc-CAS9 was created by
replacing 3xFlag with Myc tag. The gRNA Pfb was created by
inserting an exon2 specific protospacer DNA of the Parafibromin
gene, CDC73, into the gRNA cloning vector. The psAAVS1-T2 EGFP
reporter was created by inserting the target psAAVS1-T2 and a PAM
(TGG) sequence flanked by two BsaI restriction sites (CTGTATga-
gaccGGGGCCACTAGGGACAGGATTGGggtctcTGTTT) after the 568th
nt between the CMV promoter and the EGFP reporter through site
directed mutagenesis (Bioinnovatise Inc.). The two BsaI sites are
on each complementary strand of DNA so that after the BsaI diges-
tion the vector would have non-compatible sticky ends with 4 nt
overhangs (Fig. 1C). An internal BsaI site of the pEGFP-C1 vector
at positions 3750–3755 nt was removed by changing the C to T at
position 3755 in order to facilitate subcloning at the newly inserted
BsaI sites. All subsequent and mutant psDNA constructs for specific
psDNA reporters were created using this psDNA plasmid backbone
by directly ligating a double strand oligonucleotides as shown in
Fig. 1C into the BsaI linearized psDNA plasmid using the primer
pairs listed in Table 1.
forward, TGTANNNNNNNNNNNNNNNNNNNN and
reverse, AAACNNNNNNNNNNNNNNNNNNNN.
Briefly, the forward and reverse primers were mixed (5 ␮l of
10 ␮M each), heated at 95 ◦C for 5 min, and incubated at room tem-
perature for 20 min. Transfer 4 ␮l of the cooled primer mixture to a
microtube containing 10 ng of BsaI linearized psDNA EGFP reporter
plasmid and 5 ␮l of 2× T4 ligase buffer. Mix well by vortexing and
then add 1 ␮l of T4 DNA ligase (New England Biolabs) and incu-
bate at room temperature for 1 h. Mix 5 ␮l of the ligation mix with
50 ␮l of competent E. coli (Top10 Invitrogen) and incubate on ice
for 30 min. Heat the bacteria and DNA mixture at 42 ◦C for 40 s and
transfer it onto ice for 2 min. Add 250 ␮l of SOC medium (Invitro-
gen) and incubate on a 37 ◦C heating block with shaking (>700 rpm)
for 1 h. Plate the bacteria out on Kanamycin containing LB agar plate
(KD medical).
The gRNA constructs were generated by either gene
synthesis or the cloning method using the gRNA cloning
vector and the recommended protocol at Addgene: http://
www.addgene.org/static/data/93/40/adf4a4fe-5e77-11e2-9c30-
003048dd6500.pdf or by PCR using the primer pair:
forward, NNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTA-
GAAATAGCAAG and
reverse, NNNNNNNNNNNNNNNNNNNNGGTGTTTCGTC-
CTTTCCA
followed by the Cold Fusion method (SBI Inc). The full list of the
plasmids created in this study is shown in Table 1.
2.2. Mammalian cell culture and transfection
HEK293T cells (ATCC) were grown at 37 ◦C with 5% CO2 in
DMEM media (Invitrogen) supplemented with 10% heat inactiv-
ated fetal bovine serum (Germini). DNA transfection of overnight
cell cultures was conducted using the Omni UltraTransfectTM
Transfection reagent (Dbio) following the manufacturer’s protocol.
In order to minimize variations, master mixtures were prepared
for common components in any given reactions so that the tested
parameters are the only variables. A typical transfection for a
24-well plate format is described below: seeding the cells the
day before transfection at ∼6 × 104 cells/well in 500 ␮l of culture
medium above. On the day of transfection (the number of cells is
∼1.6 × 105 cells/well), for CAS9 dosage experiments, adding the fol-
lowing to a sterilized microcentrifuge tube: 50 ␮l × N + 1 of Opti
MEM medium (N = number of wells to be transfected), 5 ng × N + 1
of the psDNA EGFP reporter plasmid and 0.2 ␮g × N + 1 of the cor-
responding gRNA plasmid, mix well by vortexing for 5 second and
aliquot 50 ␮l of the mixture into N microcentrifuge tubes. Add vari-
ous amount of hCAS9 into each microcentrifuge tube and vortex for
5 s. The total amount of DNA was kept constant between different
reactions by using comparable amount of the unrelevant plasmid
pW25. Add 0.7 ␮l of Omni Ultra-TransfectTM Transfection reagent
to each microcentrifuge tube and vortex for 5 s immediately. Briefly
spin to collect the contents to the bottom and incubate at room
temperature for 15 min. Add each transfection mixture drop wise
to each well and mix by tilting (not rotating) the plate several times
at different orientations. The cells are incubated for 24–48 h before
their GFP expressing cells were measured. For gRNA dosage experi-
ments, the same process is conducted except premixing the psDNA
EGFP reporter plasmid with hCAS9 plasmid and varying the gRNA
dosage for each reaction.
2.3. Fluorescence measurement and data analysis
The GFP expressing cells were analyzed 24–48 h post transfec-
tion by one or more of the following methods.
a. Flow cytometry analysis: flow cytometry was used for the anal-
ysis of positivity and intensity of GFP expression in transfected
cells as per various experimental conditions. Cells were prepared
as follows: for 24-well plate, 100 ␮l/well of 5% Trypsin-EDTA
(Invitrogen) was added to each well and incubated at 37 ◦C for
5–10 min to ensure complete detachment of the cells from plate.
Then 200 ␮l of complete DMEM medium was added to each well
and the cells were dissociated by pipetting up and down 10 times.
The completely suspended cells were transferred to a 300 ␮l
tube and were acquired on LSRII (BD Biosciences, USA) equipped
with 407, 488, 532, and 633 LASER lines using DIVA 6.1.2 soft-
ware. Similarly, for 96-well plate, 50 ␮l/well of 5% Trypsin-EDTA
was added to each well and incubated at 37 ◦C for 5–10 min to
completely detach cells. After adding 150 ␮l/well of the com-
plete DMEM culture medium, the cells were dissociated using a
multi-Channel pipettor for 10 times. Before analyzing the sam-
ples, volume was adjusted to 250 ␮l with PBS for each well and
the plate was acquired on LSRII and high throughput sampler sys-
tem (HTS) using DIVA 6.1.2 software. From each sample 10,000
cells were acquired and % GFP positive and intensity of GFP was
calculated using DIVA 6.1.2 software.
b. Microscopy. The fluorescence intensities of transfected cells
were examined under fluorescence microscope 24–48 h after
transfection. For 24-well plate, 3 images under 10× objective
lens at each side and the center of each well along an arbitrary
middle line were taken to ensure fair representation of the well.
For 96-well plates, one image from the center of the well was
taken.
c. Cellometer® Vision (Nexcelom Bioscience Inc.). Cells used for
Cellometer analysis were all from 24-well plate. The cells were
prepared as described for 24-well plate above and counted fol-
lowing the manufacturer’s protocol.
d. Data analysis and graphing were conducted using Prism software
version 5.0c (GraphPad Software, Inc.). The percentage numbers

3. J.-H. Zhang et al. / Journal of Biotechnology 189 (2014) 1–8 3
Fig. 1. Characterization of the psDNA EGFP reporter system. (A) Schematic of the psDNA EGFP reporter design and function mechanism. The template pEGFP-C1 plasmid
was linearized at the dual BsaI sites created between the CMV promoter (open black bar) and the EGFP reporter gene (solid black bar when unexpressible and solid green bar
when expressible). A target protospacer DNA (psDNA, open red bar) with a protospacer adjacent motif (PAM, solid vertical blue bar at the right side of the psDNA) is inserted
at the BsaI sites by ligation to create the psDNA EGFP reporter (solid green bar). Co-transfection of the psDNA EGFP reporter with plasmid(s) expressing a CAS9 (blue crescent)
and the corresponding guide RNA (gRNA, green line with a wiggled tail) into a cell (dotted square) results in formation of the gRNA and CAS9 protein complex, which binds
to the target psDNA site homologous to the gRNA sequence and generates double strand DNA break (DSB). Consequently the EGFP gene expression is diminished due to the
separation of the CMV promoter from the EGFP gene (solid black bar). (B) Optimization of pEGFP-C1 dosage (ng/rx) in transfection. Right panel: percentage of fluorescent
cells transfected with various amount of pEGFP plasmid as assessed by flow cytometry. The same amounts of gRNA GFP-T2 and hCAS9 were used in all transfections. The
unrelated gRNA Pfb was used as negative gRNA control. Horizontal axis: ng pEGFP plasmid used per transfection (rx). Left panel: schematic showing the target psGFP-T2 site
of the EGFP gene. (C) Creation of the psAAVS1-T2 EGFP reporter. At the dual BasI sites created between the CMV promoter and the EGFP reporter gene (shown in solid arrows)
the double strand target psDNA of the gRNA AAVS1-T2, psAAVS1-T2 (20 nt in italics) and the PAM sequence (TGG in bold) flanked by BsaI compatible ends were inserted.
The dotted double head arrow indicates the predicated double strand DNA break (DSB) site by gRNA AAVS1-T2 guided CAS9 complex (For interpretation of the references to
colour in this figure legend, the reader is referred to the web version of this article.).
Table 1
gRNAs and primers used for generation of psDNA EGFP reportersa
Name of EGFP reporter Forward Reverse Corresponding gRNA
used
psAAVS1-T2b
CTGTATgagaccGGGGCCACTAGGGACAGGAT
TGGggtctcTGTTT
GACATActctggCCCCGGTGATCCCTGTCCTA
ACCccagagACAAA
gRNA AAVS1-T2:
GGGGCCACTAGGGACAGGAT
psPfbc
GGTTTAGTGAACCGTCAGATCCTGTATGAGACC
GCTGCACGTCGGACATAAACTGGGGTCTCTGTTTCGCTAGC
GCTACCGGTCGCCA
CCAAATCACTTGGCAGTCTAG gRNA Pfb:
GCTGCACGTCGGACATAAAC
psPfb M1-2 TGTAATTGCACGTCGGACATAAACAGG AAACCCTGTTTATGTCCGACGTGCAAT
psPfb M10-11 TGTAGCTGCACGTTAGACATAAACAGG AAACCCTGTTTATGTCTAACGTGCAGC
psPfb M19-20 TGTAGCTGCACGTCGGACATAAGTAGG AAACCCTACTTATGTCCGACGTGCAGC
psR7bp1 TGTAGCTCCTTAGCTGGAGATTTGGGG AAACCCCCAAATCTCCAGCTAAGGAGC gRNA R7bp1:
GCTCCTTAGCTGGAGATTTG
psR7bp3 TGTAGATAAGTTTCTGATAAGTGTTGG AAACCCAACACTTATCAGAAACTTATC gRNA R7bp3:
GATAAGTTTCTGATAAGTGT
psR7bp3 M1-2 TGTACTTAAGTTTCTGATAAGTGTTGG AAACCCAACACTTATCAGAAACTTAAG
psR7bp3 M10-11 TGTAGATAAGTTTGAGATAAGTGTTGG AAACCCAACACTTATCTCAAACTTATC
psR7bp3 M19-20 TGTAGATAAGTTTCTGATAAGTCATGG AAACCCATGACTTATCAGAAACTTATC
psR7bp2 TGTAGAGCTGTGTTATTGGGATGCTAGG AAACCCTAGCATCCCAATAACACAGCTC gRNA R7bp2:
GAGCTGTGTTATTGGGATGCT
psR7bp4 TGTAGATTTGTAGAGAATGTTCTGAGG AAACCCTCAGAACATTCTCTACAAATC gRNA R7bp4:
AGATTTGTAGAGAATGTTCTG
a
psDNA sequences are italicized. The BsaI sites are in lower letters. The mutated nucleotides are underlined.
b
Sequences used for site-directed insertion by Bioinnovatise Inc.
c
Primers for PCR amplification and cold fusion method.

4. 4 J.-H. Zhang et al. / Journal of Biotechnology 189 (2014) 1–8
Fig. 2. Validation of the psDNA EGFP reporter system. (A) Schematic sequence alignment of px330-CAS9, hCAS9 and myc-CAS9 plasmid constructs. The black horizontal bars
represent the common SpCAS9 sequences (not in scale). The 3xFlag for px330-CAS9 and the myc tag for myc-CAS9 constructs are in red and the nuclear localization signals
are underlined. The identical sequences at either N or C termini of px330-CAS9 and myc-cas9 are in bold black. (B) Comparison of EGFP expressing cells transfected with
equal amount of psAAVS1-T2 reporter and different combinations of gRNAs and CAS9 constructs as shown. The gRNA AAVS1-T1 with no homologies to psAAVS1-T2 reporter
served as negative control (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.).
from either flow cytometry analysis and/or Cellometer analy-
sis were used separately or in combination after standardization
to their corresponding negative controls as indicated for each
graph. For statistical analysis, one-way ANOVA were used unless
otherwise stated.
e. Protein sequence analyses were performed using the Isoelectric,
Helical wheel, Pepplot, and Pltot structure software available at
http://www.helix.nih.gov
3. Results
3.1. Construction of the target protospacer DNA reporter plasmid
The CRISPR/CAS9 system provides an efficient and powerful
tool for genomic engineering of biological systems. However the
lack of a simple platform to unbiasedly evaluate the efficacies of
a gRNA and/or CAS9 construct creates uncertainties before and
0.1
0.2
0.4
0
10
20
30
40
g/rx
hCAS9/psAAVS1-T2
Dosage of gRNA_AAVS1-T1
%psAAVS1-T2EGFPcells
A
0.1
0.2
0.4
20
25
30
35
40 gRNA_AAVS1-T1/psAAVS1-T2
g/rx
Dosage of hCAS9
%psAAVS1-T2EGFPcells
0.1
0.2
0.4
0
10
20
30
40 gRNA_AAVS1-T2/psAAVS1-T2
g/rx
Dosage of hCAS9
%psAAVS1-T2EGFPcells
0.1
0.2
0.4
0
10
20
30
40
g/rx
hCAS9/psAAVS1-T2
Dosage of gRNA_AAVS1-T2
%psAAVS1-T2EGFPcells
B
C D
Fig. 3. Dosage response profiling of DSB efficacies of hCAS9 and gRNA AAVS1-T2 against the target psAAVS1-T2 reporter. (A) and (C) used the non-homologous gRNA,
gRNA AAVS1-T1, as negative controls. Horizontal axis: ␮g plasmid DNA or gRNA used per transfection reaction (rx). The total amount of plasmid of DNAs was kept constant
by using the comparable amount of the non-relevant plasmid, pW25, to minimize variations in transfection efficiency.

5. J.-H. Zhang et al. / Journal of Biotechnology 189 (2014) 1–8 5
Fig. 4. Profiling of DSB efficacies for different combinations of gRNA and CAS9 constructs. (A) Heatmap of DSB activities displayed by different combinations of gRNA and
CAS9 constructs (as shown) against their corresponding psDNA EGFP reporters as labeled. The psAAVS1-T2 reporter was used for gRNA AAVS1-T2, gRNA GFP-T1 and T2
constructs. Non-relevant plasmid (pW25) was used as negative control to show the basal level of GFP cells without CAS9 activities. Green, yellow, and red colors represent
low, medium and high DSB activities respectively. The numbers in each colored cells represent the average percentages of GFP positive cells counted by flow cytometry
analysis from three or more independent biological experiments. (B–D) The psAAVS1-T2 EGFP reporter was used. (E–I) Other psDNA EGFP reporters used: psPfb (E), psR7bp1
(F), psR7bp2 (G), psR7bp3 (H), and psR7bp4 (I). Comparisons with statistically significant differences at p < 0.05 level were labeled with (*) and at p < 0.01 level were labeled
with (***) (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.).
impacts the trouble shooting after an actual experiment. Toward
this end, we developed an EGFP reporter based on the hypothe-
sis that insertion of a target protospacer DNA (psDNA) and PAM
(protospacer adjacent motif) sequence between a promoter and a
reporter gene might be used to directly assess the DSB activities of
a CRISPR/CAS9 and gRNA complex by measuring the reduction of
the reporter expression resulting from CAS9-mediated DNA breaks
of the target psDNA (Fig. 1A). To test this hypothesis, we first vali-
dated that the CMV-driven EGFP gene expression of the unmodified
pEGFP-C1 plasmid was effectively reduced in human 293T cells co-
transfected with hCAS9 and the gRNA GFP-T2 targeting the EGFP
gene (Fig. 1B). We then created the psAAVS1-T2 EGFP reporter plas-
mid by inserting the gRNA AAVS1-T2 target protospacer DNA (Mali
et al., 2013) between the CMV promoter and the EGFP gene (Fig. 1C
and Table 1). To facilitate other psDNA cloning, two BsaI sites were
inserted flanking the psAAVS1-T2 sequence so that it can be easily
replaced with any psDNA flanked by the compatible ends.
3.2. Validation of the target protospacer DNA reporter plasmid
In order to know if the psDNA reporter system is suitable for
distinguishing DSB activities of different gRNAs and CAS9 con-
structs, we performed comparisons of DSB efficacies among three
CAS9 and three gRNA constructs against the psAAVS1-T2 reporter
(Figs. 1C and 2A–B). To minimize the effects of variations of trans-
fection efficiency, we used one of the most transfectable human
293T cell line and the highly efficient transfection reagent, Omni
Ultra TransfectTM (Dbio Inc). In addition, for all comparisons, we
made master transfection mixes for the common components so
that the variations were only from the components in question.
Under these conditions, transfection efficiency was broadly uni-
form over a range of component concentrations (Supplemental
Fig. 1). Comparison of three CAS9 constructs revealed that both
gRNA GFP-T2 and gRNA AAVS1-T2 caused similar reduction of
EGFP expressing cells when hCAS9 construct was used, but the
former caused more significant reduction of EGFP expressing cells
than the latter when either px330-CAS9 or myc-CAS9 were used
(Fig. 2A and B). Similar results were obtained using different detec-
tion methods including flow cytometry analysis, microscopic imag-
ing, and Cellometer analysis (Supplemental Fig. S2). Dose response
studies using this reporter demonstrated that higher doses of either
hCAS9 or gRNA AAVS1-T2 increased the DSB efficacy at the target
psAAVS1-T2 site (Fig. 3B and D), but also caused dose-dependent
nonspecific reduction of EGFP positive cells in the non-homologous
gRNA AAVS1-T1(3) controls (Fig. 3A and C), consistent with a pre-
vious report (Pattanayak et al., 2013). These results illustrated that
the psDNA EGFP reporter system is sensitive to variations of gRNA
and CAS9 constructs and dosages, suggesting that the reporter

6. 6 J.-H. Zhang et al. / Journal of Biotechnology 189 (2014) 1–8
Fig. 5. Profiling of DSB specificities for different combinations of gRNA and CAS9 constructs. (A) Heatmap of the potential off-target DSB activities displayed by combinations of
either gRNA Pfb (top five rows) or gRNA R7bp3 (bottow five rows) with different CAS9 constructs and their corresponding target psDNAs as shown. The mutated nucleotides
of each psDNA are in red small letters at the positions as labeled. Non-relevant plasmid, pW25 was used in control reactions. Green, yellow, and red colors represent low,
medium and high DSB activities respectively. The numbers in each colored cells represent the average percentages of GFP positive cells counted by flow cytometry analysis
from three or more independent biological experiments. (B) Effects of psDNA mutations on DSB efficacies of gRNA Pfb and different CAS9 constructs. (C) Effects of psDNA
mutations on DSB efficacies of gRNA R7bp3 and different CAS9 constructs. The suffixes M1-2, M10-11, and M19-20 refer to the mutated nt positions of a psDNA respectively.
Comparisons with statistically significant differences at p < 0.05 level were designed as (*) and at p < 0.01 level were designed as (***) (For interpretation of the references to
colour in this figure legend, the reader is referred to the web version of this article.).
system could be used for direct comparisons of DSB activities
among different CAS9 and gRNA constructs.
3.3. DSB efficacy depends on specific combinations of the CAS9
and gRNA constructs
To demonstrate the broader applicability of the reporter sys-
tem, we systemically compared the efficacies of the three CAS9
constructs in combination with eight different gRNAs and the
corresponding psDNA EGFP reporters (Fig. 2A and Table 1). The
results revealed greater variations of DSB efficacies among dif-
ferent combinations of gRNA and CAS9 constructs (Fig. 4A).
Comparisons between combinations of three CAS9 constructs and
the three reported gRNAs (gRNA AAVS1-T2, gRNA GFP-T1 and
gRNA GFP-T2) (3) using the psAAVS1-T2 EGFP reporter revealed
that gRNA GFP-T1 was most effective with EGFP expressing cells at
0.5%, 4.3% and 4.6% for hCAS9, px330-CAS9, and myc-CAS9 respec-
tively (Fig. 4A, second row of the heat map) while hCAS9 was
most effective with EGFP expressing cells at 1.4%, 0.5%, and 1.6%
for gRNA AAVS1-T2, gRNA GFP-T1 and gRNA GFP-T2 respectively
(Fig. 4A–D). The px330-CAS9 was moderately more effective than
myc-CAS9 only when used with gRNA AAVS1-T2 (Fig. 4B) and
gRNA GFP-T2 (Fig. 4D). These results confirmed that the psAAVS1-
T2 EGFP reporter is capable of distinguishing the DSB activities of
different gRNA and CAS9 complexes. To demonstrate the appli-
cability of the EGFP reporter system to other psDNAs as well,
we tested five new psDNA EGFP reporters and the correspond-
ing gRNAs for the tumor suppressor gene, CDC73 (psPfb, gRNA Pfb)
and the neuronal RGS7 binding protein gene, R7bp (Fig. 4A). The
gRNA Pfb had lower DSB activities for all three CAS9 constructs

7. J.-H. Zhang et al. / Journal of Biotechnology 189 (2014) 1–8 7
with 8.3%, 10.0%, and 14.0% EGFP positive cells for hCAS9, px330-
CAS9, and myc-CAS9 respectively (Fig. 4A and E). Interestingly, the
gRNA R7bp1 and 2 were most effective when co-transfected with
px330-CAS9 (0.1–0.2% of EGFP expressing cells) (Fig. 4A, F and G)
while gRNA R7bp3 and 4 were most effective when co-transfected
with hCAS9 (1.3–3.2% EGFP expressing cells) (Fig. 4A, H and I). The
myc-CAS9 construct was less effective for all four gRNA R7bp con-
structs tested with EGFP expressing cells from 6.0% to 9.5%. These
results are in line with the initial observations that both gRNA
sequence and CAS9 N- and/or C-terminal modification impact their
DSB efficacies.
3.4. DSB specificity is determined by both CAS9 and gRNA
constructs
The tolerance to mismatches between gRNA and the target
psDNA has been associated with the off-target activities of the
CRISPR/CAS9 system. The PAM and its proximal upstream 11–12 nt
are considered invariable in some studies, but in others tolerance
to changes in these regions were also reported (Hsu et al., 2013;
Pattanayak et al., 2013; Fu et al., 2013; Pennisi, 2013; Nishimasu
et al., 2014). To address this discrepancy we created several mutant
psDNA EGFP reporters for psPfb (psPfb M1-2, psPfb M10-11, and
psPfb M19-20) and psR7bp3 (psR7bp3 M1-2, sR7bp3 M10-11, and
psR7bp3 M19-20) (Table 1). Comparisons of DSB activities between
different combinations of CAS9 and gRNA constructs against these
mutant psDNA EGFP reporters revealed that the DSB specificity is
primarily determined by gRNA sequences but CAS9 constructs also
played a role (Fig. 5A). The psPfb M10-11 and M19-20 completely
abolished the gRNA Pfb guided DSB activities for all three CAS9
constructs while psPfb M1-2 only diminished the DSB activity of
myc-CAS9 (Fig. 5A top 5 rows, 5B, and Supplemental Fig. S3). In
contrast, the psR7bp3 M1-2 and M10-11 completely diminished
the DSB activities of all three CAS9 constructs while psR7bp M19-
20 only reduced the DSB activities for hCAS9 and myc-CAS9, but
had no significant effect on px330-CAS9 (Fig. 5A bottom 5 rows, 5C,
and Supplemental Fig. S4). These results indicated that the tolerable
mismatches between a gRNA and the target psDNA can potentially
occur at any positions of a psDNA and are a function of both gRNA
sequence and CAS9 N- and/or C-terminal modifications.
4. Discussion
The CRISPR/CAS9 system provides an unparallel tool for genetic
modifications of living organisms. However the potential off-target
activities and unpredictable efficacies bioinformatically have been
hindering the genome engineering efforts. The described psDNA
EGFP reporter system provides a simple, yet powerful platform to
objectively evaluate and compare the DSB activities of different
CAS9 and gRNA constructs. Using this system the most favor-
able gRNA and CAS9 combinations for the target DNA of interest
can be easily selected before embarking on costly and time con-
suming experiments such as creation of gene knockout animal
models and gene therapy in clinical settings. It is foreseeable that
adaptation of this system to a high throughput format would facil-
itate the large scale screening of gRNA libraries (Nishimasu et al.,
2014). We used the psDNA EGFP reporter system to successfully
distinguish the DSB activities among different CAS9 constructs,
which might otherwise be undetectable by other methods cur-
rently available. We found that even short modifications at the
N terminus of CAS9 such as the Flag tag for px330-CAS9 and
Myc tag for myc-CAS9 could significantly alter its specificity and
efficacy, likely a result of the protein tags having different iso-
electric points (pI of 10.1 for N-terminus of myc-CAS9 versus pI
of 6.0 for px330-CAS9) and charge distributions (Pltot structure)
(Supplemental Table 1). Therefore the psDNA reporter system could
be a handy tool in the CAS9 optimization efforts through rational
design, which is likely to be further sparked by the recent resolution
of the crystal structure of SpCAS9 (Nishimasu et al., 2014).
However the psDNA EGFP reporter system should be used with
caution. Firstly the DSB activities tested were against gRNA targets
located on the extra-chromosomal plasmid that could be very dif-
ferent from against the same target in the context of chromosomal
DNA. That being said, if it is assumed that a gRNA-CAS9 complex
which is ineffective against a relatively “naked” target on plasmid
would most likely also be ineffective against the chromosomal tar-
get, then this method should allow the easy screening and weeding
out of the ineffective gRNAs and/or CAS9 constructs. This feature is
particularly suitable for testing the potential off-target activities of
gRNA/CAS9 constructs since the potential off-target activities can
be easily detected and compared using the reporter system. The
gRNA/CAS9 constructs with high DSB activities against the target
sites of choice, but no activities against the potential off-target sites
should be selected. However the flip side may not be always true. It
is recommended that two or more effective gRNA/CAS9 constructs
should be used in real experiments. Secondly, steps should be taken
to minimize transfection effects as the DSB activities were calcu-
lated based on the reduction of the GFP transfected cells. Because
the variations of transfection efficiency (up to 17%, Supplemental
Fig. S1) and the lack of normalizer, the highly transfectable cells
(such as 293T in this study) and efficient transfection reagents
should be used to minimize the transfection effects. Additionally
master mixes should be prepared for common components when-
ever possible so that only the components in question vary.
5. Conclusion
We have developed a target protospacer DNA reporter system
for testing the DSB activities of gRNA and CAS9 constructs. Using
fluorescent protein as a reporter, the DSB activities of different
gRNA and CAS9 constructs can be easily evaluated as compared
with the NGS methods mostly used currently. Additionally, adap-
tation of this system to a high throughput format would greatly
facilitate the screening of gRNA libraries and rational design of
better CAS9 constructs.
Conflict of Interest
None of the authors has a conflict of interest that might prejudice
the impartiality of the research reported here.
Acknowledgements
This research was supported by the Intramural Research Pro-
grams of the National Institute of Diabetes and Digestive and Kidney
Diseases, and the National Heart Lung and Blood Institute.
Appendix A. Supplementary data
Supplementary data associated with this article can be
found, in the online version, at http://dx.doi.org/10.1016/j.jbiotec.
2014.08.033.
References
Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., Charpentier, E., 2012.
A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial
immunity. Science 337, 816–821.
Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W.,
Marraffini, L.A., et al., 2013. Multiplex genome engineering using CRISPR/Cas
systems. Science 339, 819–823.

8. 8 J.-H. Zhang et al. / Journal of Biotechnology 189 (2014) 1–8
Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., Church,
G.M., 2013. RNA-guided human genome engineering via Cas9. Science 339,
823–826.
Cho, S.W., Kim, S., Kim, J.M., Kim, J.S., 2013. Targeted genome engineering in human
cells with the Cas9 RNA-guided endonuclease. Nat. Biotechnol. 31, 230–232.
Chang, N., Sun, C., Gao, L., Zhu, D., Xu, X., Zhu, X., Xiong, J.W., Xi, J.J., 2013. Genome
editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Res. 23,
465–472.
Shen, B., Zhang, J., Wu, H., Wang, J., Ma, K., Li, Z., Zhang, X., Zhang, P., Huang, X., 2013.
Generation of gene-modified mice via Cas9/RNA-mediated gene targeting. Cell
Res. 23, 720–723.
Wang, H., Wang, H., Yang, H., Shivalila, C.S., Dawlaty, M.M., Cheng, A.W., Zhang, F.,
Jaenisch, R., 2013. One-step generation of mice carrying mutations in multiple
genes by CRISPR/Cas-mediated genome engineering. Cell 153, 910–918.
Gratz, S.J., Cummings, A.M., Nguyen, J.N., Hamm, D.C., Donohue, L.K., Harrison, M.M.,
Wildonger, J., O’Connor-Giles, K.M., 2013. Genome engineering of Drosophila
with the CRISPR RNA-guided Cas9 nuclease. Genetics 194, 1029–1035.
Friedland, A.E., Tzur, Y.B., Esvelt, K.M., Colaiacovo, M.P., Church, G.M., Calarco, J.A.,
2013. Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat.
Methods 10, 741–743.
Bassett, A.R., Tibbit, C., Ponting, C.P., Liu, J.L., 2013. Highly efficient targeted muta-
genesis of Drosophila with the CRISPR/Cas9 system. Cell Rep. 4, 220–228.
Li, J.F., Norville, J.E., Aach, J., McCormack, M., Zhang, D., Bush, J., Church, G.M., Sheen,
J., 2013. Multiplex and homologous recombination-mediated genome editing
in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat. Bio-
technol. 31, 688–691.
Hu, X., Chang, N., Wang, X., Zhou, F., Zhou, X., Zhu, X., Xiong, J.W., 2013. Heritable
gene-targeting with gRNA/Cas9 in rats. Cell Res. 23, 1322–1325.
Hsu, P.D., Scott, D.A., Weinstein, J.A., Ran, F.A., Konermann, S., Agarwala, V., Li, Y., Fine,
E.J., Wu, X., Shalem, O., et al., 2013. DNA targeting specificity of RNA-guided Cas9
nucleases. Nat. Biotechnol. 31, 827–832.
Pattanayak, V., Lin, S., Guilinger, J.P., Ma, E., Doudna, J.A., Liu, D.R., 2013. High-
throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9
nuclease specificity. Nat. Biotechnol. 31, 839–843.
Ran, F.A., Hsu, P.D., Lin, C.Y., Gootenberg, J.S., Konermann, S., Trevino, A.E., Scott,
D.A., Inoue, A., Matoba, S., Zhang, Y., et al., 2013. Double nicking by RNA-
guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154, 1380–
1389.
Malina, A., Mills, J.R., Cencic, R., Yan, Y., Fraser, J., Schippers, L.M., Paquet, M., Dostie,
J., Pelletier, J., 2013. Repurposing CRISPR/Cas9 for in situ functional assays. Genes
Dev. 27, 2602–2614.
Fu, Y., Foden, J.A., Khayter, C., Maeder, M.L., Reyon, D., Joung, J.K., Sander, J.D.,
2013. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases
in human cells. Nat. Biotechnol. 31, 822–826.
Pennisi, E., 2013. The CRISPR craze. Science 341, 833–836.
Nishimasu, H., Ran, F.A., Hsu, P.D., Konermann, S., Shehata, S.I., Dohmae, N., Ishitani,
R., Zhang, F., Nureki, O., 2014. Crystal structure of Cas9 in complex with guide
RNA and target DNA. Cell 156, 935–949.