This document summarizes molecular approaches for breeding anthracnose and powdery mildew resistance in chili peppers. It discusses conventional breeding approaches for anthracnose resistance and then focuses on molecular approaches. For anthracnose, it covers identifying resistant sources from other Capsicum species, inheritance studies of resistance, identifying QTL, developing markers linked to resistance genes. For powdery mildew, it discusses inheritance of resistance, developing markers linked to the PMR1 resistance gene through mapping populations, and comparing genetic and physical maps to identify the PMR1 locus. The objective is to utilize molecular markers to more efficiently breed for resistance to these important diseases in chili.

1. Molecular Approaches for Anthracnose
and Powdery mildew Resistance
Breeding in chilli
MANOJ N.S
PG19AGR11055
Dept. of Genetics and plant breeding
UAS, Raichur
Seminar II

2. 1 Introduction
2 Conventional breeding Approaches for Anthracnose.
3 Molecular approaches for Anthracnose.
4 Molecular approaches for Powdery mildew.
5 Case Studies
6 Conclusion
SEQUENCE OF PRESENTATION

3. Capsicum (2n=24,26) (Capsicum annuum)
 Originated from Mexico and South America.
 One of most important commercial crop.
 Pungencies in chilli is due to alkoloid capscaisin and red
colour of chilli is due to capscanthin pigment.
 India is the world's largest producer, and exporter of chillies
in the world. China is at 2nd position in production.
 Major chilli producing states in India are Andhra Pradesh,
Telangana, Madhya Pradesh, and Karnataka.

4.  Capsicum genus contains about 31 species of which five are domesticated,
1. Capsicum annuum L.
2. Capsicum frutescens L.
3. Capsicum chinense Jacq.
4. Capsicum baccatum L.
5. Capsicum pubescens R.
Pickersgill 1997

5.  Non avilability of resistant sources in most popular C. annuum species.
 Anthracnose resistance has been identified in few genotypes of C. baccatum
and C.chinense.
 Presence of incompatablity between C. annuum and C. baccatum.
 Wide hybridization is required.
Constraints to anthracnose resistance breeding
Mongkolporn et al., 2018

6. Crossability barriers in capsicum species
Martins et al., 2014
NPF- Number of pollinated flowers NFWS- No of fruits with seed NAP-Number of adult plants

7. Capsicum annuum
Capsicum chinense
Capsicum baccatum
Widely cultivated spps.
Anthracnose resistance source Anthracnose resistance source
C.annuum x C.bacctum = Incompatible
C.annuum x C.chinense= Compatible
C.chinense x c.baccatum= Compatible

8. Chilli Anthracnose
 Chilli Anthracnose is a serious disease caused by species of the genus
Colletotrichum and may damage upto 50%.
Species:
1. Colletotrichum truncatum
2. Colletotrichum gloeosporioides
3. Colletotrichum acutatum
4. Colletotrichum coccodes

9. Setae in acervulus
Anthracnose on fruit
Ridzuan et al., 2018

10. Disease cycle
Mongkolporn et al., 2014

11. Factors favouring chilli anthracnose disease.
Capsicum
species
• Host
genotype
Time
• Fruiting and
ripening
stage
Climate
• Environment
Colletotrichum
complex
• Pathogen type
Ridzuan et al., 2018

12. Inheritance of Anthracnose Resistance
Species Pattern Reference
C.capsci Partially dominant (Park et al., 1990)
C.capsci Single dominant gene (Lin et al., 2002)
C.gleosporides Partially dominant or
over dominant
(Park et al., 1990)
C.capsci Single recessive gene (Pakdeevaporn et al., 2005)
C.spps Polygenic genes (Voorips et al., 2004)
C.acutatum Single recessive gene (Yoon et al., 2015)
Kim et al., 2008

13. Identified resistant lines for anthracnose resistance
Resistant lines Reference
AVPP1102-B, AVPP0513, AVPP0719, AVPP0207 and
AVPP1004-B
Hasyim et al., 2004
Lembang-1 and Tanjung-2 Setiawati et al., 2008
LLS, PBC932 (VI047018), Breck-2, PBC80 (VI046804),
Breck-1, Jaun, and PBC81 (VI046805)
Garg et al., 2013
Chowdhary et al., 2020

14. Anthracnose resistant germplasm against C. truncatum and C. gleopsporides
Genotypes C. truncatum C. gloeosporioides
PDI Disease
index
Disease
response
PDI Disease
index
Disease
response
Bhut jolokia 1.2 1 R 1.9 1 R
Kashi anmol 4.4 3 MR 4.3 3 MR
Pant C-1 1.8 1 R 1.4 1 R
BS 35 1.3 1 R 1.8 1 R
CM 334 4.3 3 MR 1.7 3 MR
Punjab lal 1.1 1 R 1.7 1 R
Acchar lanka 1.6 1 R 1.4 1 R
CA-4 1.3 1 R 1.5 1 R
Agnirekha 4.3 3 MR 4.1 3 MR

15. Fungal isolates
DNA extraction
from mycelium
DNA extraction
from spores
Species specific
primer designing
Identification of chilli anthracnose species
Abdelrazig et al., 2020

16. Morphological colony appearance
C. gleosporoides C.scovelli C.truncatum

17. Primers for detection of Colletotrichum species
Species Primer
name
Sequence 5′-3’ GC% Tm
(°C)
Product size
(bp)
Annealing temperature
and time
C. scovillei CCs-R
s-F
GGATCATTACTGAGTTACACGCTCTAT
GAAGAGACGTCGTGTAA
40.7
47.1
56
48.2
168 56 °C for 20s
C. gloeosporioides species
complex
Cg-F
Cg-R
CTGAGTTTACGCTCTATAACCC
GAGACCCTACCCGCCGAA
45.5
66.7
52.6
59.3
66 56 °C for 20s
C. truncatum Ct-F
Ct-R
CTCTACGGTTGACGTA
GGTTTTACGGCTAGAGT
50 47.2 112 51 ° C for 20s

18. a) C. scovillei b) C. gloeosporides c) C. truncatum

19. a) C.scovillei
b) C.gloeosporiodes
c) C.truncatum

20. Anthracnose related markers
Chowdhary et al., 2020

21. Chowdhary et al., 2020

22. Genes conferring anthracnose resistance
Chowdhary et al., 2020

23. Objective:
To construct SNP maps to identify QTL for anthracnose resistance

24. • Capsicum annuum (Bangchang ) × Capsicum chinense PBC 932
( Interspecific population)
1. 12 linkage groups
2. 214 SNPs
3. 824cM coverage
• Capsicum baccatum (PBC 80) × Capsicum baccatum CA1316
( Intraspecific population)
1. 12 Linkage group
2. 403 SNPs
3. 1270cM coverage
 Map distances were calculated using kosambi function.
 QTL analysis for anthracnose disease scores was performed using MapQTL 4.0 with interval
mapping.
 Linkages were analysed using Joinmap 3.0.
Materials and methods

25. Phenotypic data of Intraspecific capsicum baccatum species PBC 80 x CA1316
Microinjection
High pressure spray

26. QTLs of PBC932 in LG2
populations Fruit
stages
pathotypes Genetic
studies
QTL name LG Flanking markers position Interval LOD % E A
Bangchang x pbc 932
( Interspecific cross)
Green 158 ci/MI Co 1 RA932g 2 CAP_T39318_0_1_104
2
CAP_T22290_0_1_429
56.9 13.7 3.25 19.5 0.52
Ripe 158 ci/MI Co 2 RA932r 2 CAP_T39318_0_1_104
2
CAP_T22290_0_1_429
56.9 13.7 4.21 18.2 1.68
% E = phenotypic variation
A= additive effect

27. 3 major QTLs of PBC80 in LG4
populations Fruit
stages
pathotypes Genetic
studies
QTL name LG Flanking markers position Interval LOD % E A
PBC80 x CA1316
( Intraspecific cross)
Ripe PCA2/MI Co 5 RA80rP2 4 BACSNP-4-63
BACSNP-4-60
0 17.4 39.08 88.8 67.72
Ripe PCA2/MI Co 5 RA80rP3.1 4 BACSNP-4-63
BACSNP-4-60
0 17.4 36.05 85.7 68.80
Ripe PCA3/HP RA80rHP1 4 BACSNP-4-63
BACSNP-4-60
0 17.4 35.17 86.1 -68.4
% E = phenotypic variation
A= additive effect

28. Minor Qtl for PBC 80 on LG 12 and LG 9
populations Fruit
stages
pathotypes Gene
tic
studi
es
QTL name LG Flanking markers positi
on
Interval LOD % E A
PBC80 x CA1316
( Intraspecific
cross)
ripe PCa3/MI - RA80rP3.2 12 BACSNP-12-61
BACSNP-12-58
104.
5
6 3.42 13.8 15.54
ripe Pca3/HP RA80rHP2 9 BACSNP-3-84
BACSNP-3-87
72.5 2.6 3.41 11.3 14.65
% E = phenotypic variation
A= additive effect

29. Objective:
To identify the responses of chili progressive lines using molecular markers associated with anthracnose
resistance in chilli.

30. Materials and methods:

31. 101 = C. annuum progressive line derived from PBC932
201–234 = C. annuum progressive lines derived from PBC80
301–303 = C. annuum susceptible checks
401–403 = C. chinense (401) and C. baccatum (402–403) resistant checks
Chili genotypes used for phenotypic and genotypic analysis with anthracnose resistance-associated markers

32. Results and discussion
Genotypic and phenotypic respones
Marker validation

33. • DNA fingerprints of 2 SSR primers
(HpmsE032, HpmsE143)
• 1 SCAR primer (Indel)
M: 50 bp Molecular base ladder
SSR and Scar markers used for study

34. Bademiyya and Ashtaputre, 2019
 Powdery mildew of chilli incited by Leveillula taurica found to be one of the devastating
disease of chilli.
 Powdery mildew causes yield loss of 42.82 per cent due to severe defoliation and
reduction in size and number of fruits per plant.
 Yield loss of about 50 per cent is noticed due to powdery mildew in the unsprayed
control.
Chilli Powdery Mildew

35. Powdery mildew of Chilli
Causal agent Leveillula taurica (Lev.) Arn.
• Kingdom : Fungi
• Phylum : Ascomycota
• Class : Leotiomycetes
• Subclass : Leotiomycetidae
• Order : Erysiphales
• Family : Erysiphaceae
• Genus : Leveillula
• Species : L. taurica
(Alexopolus and Mims, 1996)
(Glawe, 2006)

36. Symptoms

37. Inheritance of powdery mildew resistance
Heredity studies of C. annuum showed that resistance to powdery mildew is controlled
by three pairs of genes with additive as well as epistatic effects (Daubeze et al., 1995)
The resistance was dominant and polygenic and showed allelism differences among
the resistant parents. (Murthy et al., 1997),

38. Objective :
 To develop molecular markers linked to PMR1 in Capsicum
 To conduct fine mapping of the PMR1 gene
 To investigate the origin of the PMR1 gene

39. Materials and methods
Plant materials
• Resistant parent C. annuum VK-515 R
• Susceptible patent C. annuum VK-515 S
• Resistant control is the commercial cultivar C. annuum PM Singang
• Susceptible control is the commercial cultivar C. annuum ‘Bukang
• ‘VK515’ 102 F2:3 families were derived from a ‘VK515 R’ × ‘VK515 S’ cross
Inoculum preparation and disease infection
• Infected ‘Bukang’ and ‘VK515 S’ plants were kept around F2:3 plants grown in plastic
trays(50 cell trays) at one-tray intervals.
• Presence or absence of white fungal hyphae observed on infected leaves 60 days after
sowing was used as a measure of disease infection.

40. Chromosomal localization
• Genotyping was performed with the Fluidigm® EP1 TM system (Fluidigm, USA), (Kang et
al., 2014)
Genotyping-by-sequencing (GBS)
• Disestion: PstI and MseI
• Sequencing: Illumina Hiseq 2000
• CLC genomics
workbench Genetic mapping of PMR1 locus
• CarthaGene Software and MapChart 2.3 software
Comparative map analysis of the PMR1 locus using GBS derived SNP markers
• Genome: C. annuum L_Zunla-1, C. chinense v.1.2, C. baccatum v.1.2
Phygenetic analysis
• DARwin 6.0.9

41. Results and discussion
Phenotypic analysis of powdery mildew
Segregation analysis of powdery mildew resistance in ‘VK515’ families

42. Molecular markers linked to the powdery resistance gene PMR1.

43. (A) Genetic map of C. annuum reported by Kang et al. (2014).
(B) Seven markers linked to the PMR1 locus based on the ‘VK515’ F2:3 mapping population are shown.
(c) Physical locations of SNP markers on ‘L_Zunla-1’ chromosome 4.
Linkage map of the pepper PMR1 locus map of the pepper PMR1 locus.

44. Comparative genetic linkage and physical maps of the powdery mildew resistance
gene PMR1.

45. Sequence analysis of PMR 1 locus

46. Objective:
To identify molecular markers linked to the resistance genetic factors for
powdery mildew to promote marker-assisted breeding programs

47. Material and methods
• H3 is a powdery mildew resistant genotype, C. annuum inbred line and Vania is a
susceptible bell-pepper inbred line.
• A total of 101 doubled haploid lines (HV population) were obtained from the (H3 Vania)
F1 hybrid using the androgenesis method.
• A molecular map was obtained from this population including 553 molecular markers with
a minimum LOD score of 5.0 and a maximum recombination fraction of 0.3 as thresholds
for linkage detection.
• A set of 134 well distributed markers (1 phenotypic, 32 RFLP, 27 RAPD and 74 AFLP
markers) constituted the framework map.

48. Results and Discussion
QTLs for powdery mildew resistance detected in the HV progeny

49. Map location of powdery mildew resistance QTLs on the HV map

50. The effect of interaction between two markers on the powdery mildew resistance components

51. Objective:
To identify SCAR markers linked to powdery mildew gene that would help
breeders in indirect selection for the trait in efficient and fast manner.

52. Materials and methods
 Odisha Local is highly resistant and 9907-9611 susceptible to powdery mildew were
selected.
 F1 plants were derived from a cross between them and again selfed to produce F2 .
 199 F2 plant populations along with parental lines for L. taurica disease resistance
and observations were taken till 180 days of planting using 0-9 disease scale.

53. Phenotypic scoring
Genotypic and phenotypic scores in F2 population

54. Comparison of Phenotypic and Genotypic scores

55. PCR products amplified by the SCAR primers OPA15- SFP, OPA15-RFP and OPA15-CRP.

56. CONCLUSION