O slideshow foi denunciado.
Utilizamos seu perfil e dados de atividades no LinkedIn para personalizar e exibir anúncios mais relevantes. Altere suas preferências de anúncios quando desejar.

Chuyển hóa acid nucleic

20.007 visualizações

Publicada em

Chuyển hóa acid nucleic

Publicada em: Ciências
  • Login to see the comments

Chuyển hóa acid nucleic

  1. 1. Trao đổi trực tuyến tại: http://www.mientayvn.com/Y_online.html
  2. 2. CHUYEÅN HOÙA ACID NUCLEIC
  3. 3. # MUÏC TIEÂU 1. Vieát ñöôïc sô ñoà chi tieát cuûa söï thoaùi hoùa base purin 2. Neâu ñöôïc caùc böôùc trong quaù trình toång hôïp purin vaø pyrimidin nucleotid 3. Neâu ñöôïc caùc chi tieát veà beänh guùt 4. Moâ taû ñöôïc söï toång hôïp ADN hay söï nhaân ñoâi ADN 5. Moâ taû ñöôïc söï toång hôïp ARN hay söï chuyeån maõ 6. Phaân bieät ñöôïc söï khaùc bieät giöõa söï chuyeån maõ ôû teá baøo nhaân sô vaø söï chuyeån maõ ôû teá baøo nhaân thöïc.
  4. 4. # NỘI DUNG 1.THOÁI HÓA ACID NUCLEIC  Đại cương về thoái hóa acid nucleic  Thoái hóa nucleotid purin  Thoái hóa nucleotid pyrimidin 2.TỔNG HỢP ACID NUCLEIC  Tổng hợp nucleotid purin  Tổng hợp nucleotid pyrimidin  Tổng hợp DNA  Tổng hợp ARN
  5. 5. #
  6. 6. #
  7. 7. #
  8. 8. #
  9. 9. #
  10. 10. # 1. THOAÙI HOÙA ACID NUCLEIC 1.1. Sô ñoà toång quaùt Acid nucleic (ADN, ARN) H2O Nuclease Nucleotid Pvc Nucleotidase Nucleosid Nucleosidase Base N + Pentose
  11. 11. # Base N + Pentose Purin Pyrimidin Acid uric NH3 , CO2 Ureâ
  12. 12. # 1.2. Thoaùi hoùa base purin nucleosidase Xanthin oxidase 2 loại phản ứng chủ yếu: khử amin thuỷ phân và oxy hoá ADA deficiency (ADA)
  13. 13. # H Xanthin oxidase Xanthin oxidase
  14. 14. #
  15. 15. # Ngöôøi Chim Acid uric NT Moät soá boø saùt Saûn phaåm thoaùi hoùa cuoái cuøng Moät soá boø saùt khaùc Ña soá ÑV coù vuù Alantoin Nhuyeãn theå Uricase
  16. 16. # • Sản phẩm thoái hóa cuối cùng của purin khác nhau giữa các loài. • Ở đa số các loài ĐV có vú, acid uric được chuyển thành allantoin tan trong nước nhờ uricase. • Ở người, thiếu uricase nên sản phẩm cuối cùng của thoái hóa purin là acid uric.
  17. 17. # Bình thöôøng: -Acid uric/maùu  3 – 6 mg% -Acid uric /NT  500-800 mg/ 24 giôø Beänh “guùt” (goutte, gout, thoáng phong): • Acid uric/maùu : >10mg%  15-20mg% • Coù tinh theå Natri Urat ôû suïn, xöông …ñaëc bieät laø caùc khôùp  Vieâm khôùp caáp • Soûi ñöôøng tieåu.
  18. 18. #
  19. 19. # 1.3.Thoaùi hoùa base Pyrimidin Chuû yeáu ôû gan
  20. 20. #
  21. 21. #
  22. 22. # β-Aminoisobutyrate là tiền chất tạo thành Succinyl-CoA CoA
  23. 23. # 2.TOÅNG HÔÏP ACID NUCLEIC Nguyeân lieäu: H3PO4: töø thöùc aên Ribose: töø con ñöôøng HMP---->Ribose-5- P Base N: cô theå toång hôïp. Hai con đường : • Con đường tổng hợp mới (de novo pathway) : từ những tiền chất chuyển hóa (acid amin, ribose 5-P, CO2, NH3 ) • Con đường tận dụng (salvage pathway) : tái sử dụng base nitơ và nucleosid tự do giải phóng từ quá trình thoái hóa acid nucleic.
  24. 24. # 2.1.Toång hôïp Purin vaø Purin Nucleotid Purin nucleotid : AMP, IMP,GMP. Töø base Purin Qua 2 con ñöôøng Töø Ribose-5- P Deoxyribonucleotid được tạo thành từ ribonucleotid nhờ sự khử oxy
  25. 25. # Hai con đường tổng hợp purin nucleotid
  26. 26. #
  27. 27. # 3 giai đoạn: Gđ 1: Tổng hợp PRPP từ ribose-5-P Gđ 2: Trải qua nhiều pư để tạo thành IMP Gđ 3: Tạo thành AMP và GMP từ IMP TH purin nucleotid từ ribose 5-phosphat
  28. 28. # GIAI ĐOẠN 1 : Tạo thành 5-phosphoribosyl-1-pyrophosphate(PRPP) α 5-phosphoribosyl 1 Pyrophosphate
  29. 29. # GIAI ĐOẠN 2 : Tạo thành IMP từ PRPP
  30. 30. # GIAI ĐOẠN 3 : Tạo thành AMP và GMP từ IMP Adenine ribose-P Guanine ribose-P
  31. 31. # • Gồm 3 cơ chế ức chế ngược (ức chế enzym) ở 3 Gđ • Ở Gđ3 : IMP  AMP cần có GTP IMP  GMP cần có ATP  sự tổng hợp 2 nucleotid này có khuynh hướng cân bằng. 1 2 3 ĐIỀU HÒA TỔNG HỢP PURIN NUCLEOTID
  32. 32. # HGPRT TH purin nucleotid từ việc tái sử dụng base nitơ và nucleosid tự do Allopurinol allopurinol ribonucleotid bất hoạt (*) Trong HC Lesch-Nyhan: hoạt tính HGPRT giảm → (*) không xảy ra, nên allopurinol không có tác dụng. PRPP HGPRT
  33. 33. # BỆNH GÚT NGUYÊN PHÁT PRPP synthase tăng hoạt tính hoặc HGPRT khiếm khuyết:  tăng tạo purin nucleotid  tăng acid uric/máu
  34. 34. # Duøng pp ñoàng vò vôùi 14C vaø 15N  xaùc ñònh ñöôïc nguoàn goác caùc nguyeân töû trong nhaân Purin:
  35. 35. # 2.2. Toång hôïp Pyrimidin vaø Pyrimidin nucleotid 2 giai ñoaïn:
  36. 36. # dUMP dTMP
  37. 37. #
  38. 38. # d 1 2 Megaloblastic anemia:  do thiếu CTP, TMP, UTP → giảm sản xuất HC Điều trị bằng Uridin
  39. 39. # ĐIỀU HÒA TỔNG HỢP PYRIMIDIN NUCLEOTID 1 2 CTPứcchếngượcenzymaspartatetranscarbamoylase. CTP ức chế aspartate transcarbamoylase (hình bên) UMP ức chế CAP synthase TTP không có vai trò trong ức chế ngược trên sự tổng hợp pyrimidin
  40. 40. # Nhiều thuốc dùng trong điều trị (hoá trị K…) tác dụng lên enzym của quá trình tổng hợp nucleotid
  41. 41. # Nguoàn goác caùc phaân töû treân Pyrimidin:
  42. 42. #
  43. 43. # 1 3 4 6
  44. 44. # 2.3. Toång hôïp caùc deoxyribonucleotid khöû oxy ôû C2’ Ribonucleotid Deoxyribonucleotid Quaù trình khaùc nhau ôû caùc loaøi: *E.coli: NDP dNDP *Lactobacillus: NTP dNTP *Toång hôïp caùc dNTP töø dNDP: dNDP dNTP ATP ADP
  45. 45. # KHỬ RIBONUCLEOTID THÀNH DEOXYRIBONUCLEOTID • Khử nhóm 2’-hydroxyl của ribonucleotid diP • Phức hợp enzym ribonucleotid reductase
  46. 46. # Söï taïo thaønh caùc Nucleosid di vaø triphosphat: Bằng pư phosphoryl hóa
  47. 47. # 2.4. Toång hôïp ADN 2.4.1.Söï nhaân ñoâi baùn baûo toàn - Moâ hình: caáu truùc xoaén ñoâi - Watson vaø Crick: giaû thuyeát veà cô cheá baùn baûo toàn cuûa söï toång hôïp ADN.
  48. 48. #
  49. 49. # 2.4.2.Caáu truùc chaïc ba cuûa ADN (replication fork)
  50. 50. #
  51. 51. # 2.4.3.Quaù trình nhaân ñoâi ADN Ít nhaát 20 enzym vaø yeáu toá Protein tham gia heä thoáng Replicase (Replisom) hoaït ñoäng vôùi toác ñoä raát nhanh vaø raát chính xaùc: Tieàn chaát: 4 loaïi dNTP “Boä maùy nhaân ñoâi “
  52. 52. # Quaù trình nhaân ñoâi ADN, 5 giai ñoaïn: 1. Nhaän bieát ñieåm môû ñaàu vaø thaùo xoaén taùch bieät 2 sôïi ADN meï (heä thoáng Replicase) 2 loaïi protein chính tham gia quaù trình naøy: ADN helicase, taùch rôøi hai sôïi Protein gaén ADN sôïi ñôn (single strand DNA – binding protein hay SSB protein), giöõ cho 2 sôïi ADN ñôn ôû traïng thaùi rôøi nhau vaø oån ñònh
  53. 53. #
  54. 54. #
  55. 55. # 2. Taïo ARN moài nhôø primase Primase keát hôïp ADN helicase taïo primosom 3.Toång hôïp hai sôïi ADN môùi nhôø ADN polymerase (ADN Polymerase III) -sôïi daãn, -sôïi sau ñoaïn Okazaki 4. Loaïi ARN moài nhôø ADN polymerase I. Sau ñoù caùc ñoaïn ADN môùi tieáp tuïc ñöôïc keùo daøi. 5. Noái nhöõng ñoaïn ADN môùi nhôø ADN ligase
  56. 56. #
  57. 57. #
  58. 58. # 2.4.4. Söûa chöõa ADN : E.coli, tæ leä sai soùt 1/109 – 1010 nucleotid. Nhôø ADN polymerase I vaø III coù theå luøi laïi taùch vaø loaïi boû nucleotid sai, gaén nucleotid ñuùng. ARN polymerase khoâng coù taùc duïng töï söûa chöõa. Söï nhaân ñoâi ADN ôû tb nhaân thaät vaø tb nhaân sô ñeàu töông töï nhö nhau.
  59. 59. #
  60. 60. # 2.5.Toång hôïp ARN (Söï chuyeån maõ) CCCACAGCCGCCAGTTCCGCTG CGCATTTT ADN-sợi mã hóa GGGTGTCGGCGGTCAAGGCGAC GCGTAAAA ADN-sợi khuôn CCCACAGCCGCCAGUUCCGCUG CGCAUUUU ARN m
  61. 61. # 2.5.1. ÔÛ tb nhaân sô a. Giai ñoaïn khôûi ñaàu: ARN polymerase: Holoenzym: 2’. Enzym loõi (core enzyme): 2’ Tieåu ñôn vò  seõ tìm moät ñieåm coù gen khôûi ñoäng
  62. 62. #
  63. 63. # Söï toång hôïp ARN khoâng caàn moät ñoaïn moài. Ñaàu 5’ cuûa nhöõng chuoãi ARN môùi ñeàu baét ñaàu baèng pppG hoaëc pppA. Söï toång hôïp ARN xaûy ra theo chieàu 5’ 3’, gioáng söï toång hôïp ADN. b. Giai ñoaïn keùo daøi:
  64. 64. # ARN Polymerase khoâng coù hoaït tính nuclease. Möùc ñoä sai soùt cuûa söï toång hôïp ARN laø 1/104 hoaëc 1/105 c. Giai ñoaïn keát thuùc
  65. 65. # Ñieàu chænh ARN: • ARNm ñöôïc ñieàu chænh raát ít hoaëc khoâng caàn ñieàu chænh sau khi ARN ñöôïc toång hôïp. Moät soá ARN ñöôïc giaûi maõ ngay trong quaù trình chuyeån maõ. • tieàn ARNt vaø tieàn ARNr: - bò caét ñoaïn bôûi nuclease vaø ñöôïc ñieàu chænh thaønh nhöõng sôïi ARN môùi. - theâm moät soá nucleotid vaøo ñaàu ARN.Ví duï, CCA ñöôïc theâm vaøo ñaàu 3’ cuûa moät soá phaân töû ARNt naøo chöa coù saün trình töï chuoãi naøy ôû ñaàu. - thay ñoåi veà base vaø ribose cuûa ARNr. moät soá base ñöôïc methyl hoùa ; - taïo base hieám ôû ARNt
  66. 66. #
  67. 67. # 2.5.2.ÔÛ teá baøo nhaân thaät: a. Söï chuyeån maõ vaø giaûi maõ phaân caùch nhau veà khoâng gian vaøthôøi gian • Xaûy ra trong nhaân. • Taïo ra raát nhieàu ARN sau naøy seõ thaønh ARNm. • Nhöõng baûn sao tieân phaùt caàn coù moät caùi choùp ôû ñaàu 5’ vaø moät ñuoâi polyA ôû ñaàu 3’. • Haàu heát caùc tieàn ARNm ôû teá baøo coù nhaân thaät baäc cao ñeàu ñöôïc qua moät quaù trình caét noái (splicing).
  68. 68. #
  69. 69. #
  70. 70. #
  71. 71. #
  72. 72. # b. ARN ôû teá baøo coù nhaân thöïc ñöôïc toång hôïp bôûi 3 loaïi ARN polymerase Loaïi Vò trí Baûn sao I Haïch nhaân ARNr 18S, 5.8S vaø28S II Nhaân chaát tieàn ARNm vaø ARN hn III Nhaân chaát ARNt vaø ARNr 5S
  73. 73. # c. Nhöõng gen khôûi ñoäng ôû teá baøo nhaân thöïc coù chöùa moät hoäp TATA vaø coù theâm nhöõng trình töï chuoãi ngöôïc doøng -----------5’ TATAAAA 3’---------+1-------- -25 Hoäp TATA d. Coù nhöõng protein ñaëc hieäu ñöôïc goïi laø nhöõng yeáu toá chuyeån maõ (transcription factors) töông taùc vôùi nhöõng gen khôûi ñoäng ôû teá baøo coù nhaân thöïc
  74. 74. # e. Nhöõng chuoãi taêng cöôøng (enhancer sequences) coù theå kích thích söï chuyeån maõ caùch ñieåm khôûi ñaàu haøng nghìn base f. Tieàn ARNm ñöôïc gaén choùp ôû ñaàu 5’ trong quaù trình chuyeån maõ • Tieàn ARNm: - choùp 7-methylguanosin ôû ñaàu 5’ - ñuoâi polyadenylat, daøi khoaûng 250 goác A, ôû ñaàu 3’. - khi bò maát ñuoâi polyA, noù ñöôïc chuyeån ra khoûi nhaân vaø ñöôïc duøng laøm khuoân cho söï toång hôïp protein. • ARNt vaø ARNr : khoâng coù choùp.
  75. 75. # g. Nhöõng ñieåm caét noái cuûa tieàn ARNm thì ñöôïc xaùc ñònh ñaëc hieäu bôûi nhöõng trình töï chuoãi ôû cuoái intron • Caét loaïi chính xaùc intron khoûi tieàn ARNm. • Trình töï chuoãi cuûa moät intron: GU ………………………AG. • Thalassemia: - do moät söï caét noái sai gaây neân. - haäu quaû: ARNm ñöôïc taïo ra seõ chöùa moät loaït nhöõng maõ maø bình thöôøng thì khoâng thaáy hieän dieän. Ñaàu 3’ bình thöôøng cuûa intron Bình thöôøng 5’CCTATTGGTCTATTTTCCACCCTTAGGCTGCTG 3’  -thalassemia 5’CCTATTAGTCTATTTTCCACCCTTAGGCTGCTG 3’

×