Thesis complete final edit gm dt480.4 p

Pharmaceutical Relevant Proteins; Studies of
RBP4 and Kvβ2.

Gavin Mooney

School of Food Science and Environmental
Health

2011

Thesis Submitted in Partial Fulfilment of
Examination Requirements Leading to the
Award

B.Sc. Pharmaceutical Technology

Dublin Institute of Technology

Supervisor: Dr. Barry Ryan
Asst. Supervisor: Ms. Alka Singh, M.Sc.

Declaration
I Certify that this thesis which I now submit for examination for the award B.Sc.
Pharmaceutical Technology is entirely my own work and has not been taken from
the work of others, save and to the extent that such work has been cited and
acknowledged within the text of my work.

This thesis was prepared according to the regulations provided by the School of
Food Science and Environmental Health, Dublin Institute of Technology and has
not been submitted in whole or in part for another award in any Institute or
University.

The Institute has permission to keep, lend or copy this thesis in whole or in part,
on condition that any such use of material of this thesis is duly acknowledged.

Signed: __________________________
Gavin Mooney

Date: __________________________

ii

Acknowledgements

iii

Abbreviations Used
µg = Microgram
µg = Micrograms
µl = Micro litre
µM = Micro molar
1o = Primary
o
2 = Secondary
3’ = Three Prime end of single strand of DNA
4-N-B-alc = 4-nitrobenzylalcohol
4-N-B-ald = 4-nitrobenzaldehyde
5’ = Five Prime end of single strand of DNA
ACN = Acetonitrile
AKR1D1 = Aldo-keto reductase 5β-reductase
Approx. = Approximate
BLAST = Basic Local Alignment Tool
BMI = Body Mass Index
Bp = Base Pair
BSA = Bovine Serum Albumen
C3G = Cyanidin 3-glucosides
C.A.S. = Chemical Abstracts Service
cDNA = Copy Deoxyribonucleic Acid
Conc. = Concentrated
CNS = Central Nervous System
CVD = Cardiovascular Disease
d.H2O = Deionised water
DM2 = Diabetes Mellitus Type 2
DMSO = Dimethyl Sulfoxide
DNA = Deoxyribonucleic Acid
dNTP = Deoxyribonucleic Triphosphate
EDTA = Ethylenediaminetetraacetic Acid
eGFR = Estimated Glomerular Function
EtBr = Ethidium Bromide

v

g = Gram
GLUT-4 = Glucose Transporter 4
HCl = Hydrochloric Acid
HPLC = High Performance Liquid Chromatography
hRBP4 = Human Retinol Binding Protein-4
hrs = Hours
IGT = Impaired Glucose Tolerance
IPTG = Isopropyl β-D-thiogalactoside
IR = Insulin Resistance
kPa = Kilo Pascal
LBA = Luria Bertani Agar
LBB = Luria Bertani Broth
M = Molar
MCS = Multiple Cloning Site
mg = Milligram
min = Minutes
ml = Millilitre
mm = Millimetres
mM = Millimolar
NaCl = Sodium Chloride
NADPH = Nictinamide adenine dinucleotide phosphate (Reduced form)
NADP = Nictinamide adenine dinucleotide phosphate
NCBI = National Centre for Biotechnology Information
nm = Nanometers
o
C = Degrees Celsius
PCR = Polymerase Chain Reaction
PPAR-γ = Peroxisome Proliferator-Activated Receptor-gama
psi = Pounds per square inch
QA = Quality Assurance
(h)RBP4 = (human) Retinol Binding Protein-4
rpm = Revolutions per minute
SC = Subcutaneuos
SDR = Short-chain Dehydrogenase Reductases
SDW = Sterile Deionised Water

vi

TAE = Tris-Acetate-EDTA
TM = Melting Temperature
TZD = Thiazolidinedione
o
TC = Temperature in Degrees Celsius
UN = United Nations
UV = Ultra Violet
UVB = Ultraviolet-B
V = Volts
v/v = Volume per volume
w/v = Weight per volume

vii

Table of Contents
Declaration ...............................................................................................................ii
Acknowledgements................................................................................................ iii
Abstract ...................................................................................................................iv
Abbreviations Used..................................................................................................v
Table of Contents ................................................................................................. viii
List of Figures: .........................................................................................................x
List of Tables: ........................................................................................................xii
1.0 Introduction........................................................................................................2
1.1 Retinol Binding Protein 4 ..................................................................................2
1.2 Kvβ2: The Subunit of Kv1 Potassium Channels ...............................................6
1.3 The Phenols: Rutin, Resveratrol and Quercitin .................................................9
1.3.1 Quercitin and Rutin...................................................................................9
1.3.2 Resveratrol..............................................................................................10
1.4 Aldo-Keto Reductases .....................................................................................11
2.0 Materials and Methods.....................................................................................15
2.1 Materials ....................................................................................................15
2.1.1 Instruments..............................................................................................16
2.1.2 E.coli strain.............................................................................................17
2.1.3 Plasmids..................................................................................................17
2.2 Cloning Primer Design ....................................................................................18
2.3 Agar and Broth Preparation .............................................................................20
2.4 Sterilization ......................................................................................................20
2.5 Isolation of Plasmid Vector from E.Coli .........................................................20
2.6 DNA and Primer Preparation...........................................................................21
2.7 Agarose Gel Preparation ..................................................................................21
2.8 Polymerase Chain Reaction (PCR)..................................................................22
2.8.1-1 PCR Reaction Mixture 1......................................................................23
2.8.1-2 PCR Condition Set 1............................................................................24

viii

2.8.5-2 PCR Condition Set 5.1.........................................................................28
2.8.5-2 PCR Condition Set 5.2.........................................................................28
2.9 Preparation of TAE Buffer...............................................................................29
2.10 Purification and Expression of Kvβ2.............................................................29
2.11 Dialysis of Kvβ2 ............................................................................................30
2.11.1 Preparation of Dialysis Tubing ............................................................30
2.11.2 Dialysis of Kvβ2...................................................................................30
2.12 HPLC assay to measure the inhibition of Kvβ2 mediated reduction of 4-
nitrobenzaldehyde ..................................................................................................30
2.12.1 Method for Gradient HPLC Assay (Rutin & Resveratrol) .........................31
2.13 Bradford Method for Protein Concentration Determination..........................32
2.14 Flouresence Measurement of inhibitor - Kvβ2 binding..................................32
3.0 Results..............................................................................................................34
3.1 PCR Results .....................................................................................................34
3.2 Expression and Purification of Kvβ2...............................................................37
3.3 HPLC Chromtatograms for the Inhibition of Kvβ2 Mediated Reduction of 4-
nitrobenzaldehyde ..................................................................................................38
3.3.1 Chromatogram Results for Rutin Experiment.........................................38
3.3.2 Chromatogram Results for Quercitin Experiment..................................40
3.3.3 Chromatogram Results for Resveratrol Experiment...............................42

3.4 Percentage Inhibition Results for Rutin, Quercitin and Resveratrol................44
3.5 Flouresence Spectra .........................................................................................45
3.5 Bradford Method Standard Curve....................................................................47

ix

List of Figures:

Fig.1.1 3-D Protein representation of the RBP4 structure.

Fig.1.2 Schematic of aldehyde-dismutation in Kvβ2

Fig.1.3 Structural features of Kvβ

Fig.1.4 Chemical structure of Rutin

Fig.1.5 Chemical structure of Resveratrol

Fig.1.6 Chemical structure of Quercitin

Fig.2.1 Gradient elution method employed for the HPLC Analysis of

Resveratrol and Rutin

Fig.3.1 PCR UV Photograph of PCR #1





Fig.3.6 Elution profile of purified Kvβ2

Fig.3.7 Chromatogram showing a control reaction for Rutin experiment

Fig.3.8 Chromatogram showing a control reaction for Rutin experiment

Fig.3.9 Concentration dependant inhibition of Kvβ2 by Rutin

Fig.3.10 Chromatogram showing a control reaction for Quercitin experiment

Fig.3.11 Chromatogram showing a control reaction for Quercitin experiment

Fig.3.12 Concentration dependant inhibition of Kvβ2 by Quercitin

Fig.3.13 Chromatogram showing a control reaction for Resveratrol experiment

Fig.3.14 Chromatogram showing a control reaction for Resveratrol experiment

Fig.3.15 Concentration dependant inhibition of Kvβ2 by Resveratrol

Fig.3.16 Concentration dependant percentage inhibition of Kvβ2 by Rutin

x

Fig.3.17 Concentration dependant percentage inhibition of Kvβ2 by Quercitin

Fig.3.18 Concentration dependant percentage inhibition of Kvβ2 by Resveratrol

Fig.3.19 Flourometric data showing the binding of Rutin to Kvβ2

Fig.3.20 Flourometric data showing the binding of Quercitin to Kvβ2

Fig.3.21 Flourometric data showing the binding of Resveratrol to Kvβ2

Fig.3.22 BSA standard curve

xi

List of Tables:
Table 1. Description of Plasmids

Table 2. Details of Primers Used

Table 3. Comparison of Agarose Volumes Used

Table 4. Details of Primer concentration and cDNA volumes used in PCR 1

Table 5. Temperature gradient and tube layout for PCR 2.

Table 6. Temperature gradient and tube layout for PCR 5.1. (Machine 1)

Table 7. Temperature gradient and tube layout for PCR 5.2. (Machine 2)

Table 8. Outline of reaction mixtures for Bradford Method

xii

Chapter 1:

Introduction

1

1.0 Introduction
The aim of this project is to study the hRBP4 protein through cloning,
expressing and purifying of the protein in order to perform a selection of tests on
the protein for stability and characteristics. As will be seen throughout this report,
the optimisation process for the PCR of hRBP4 was recurrently unsuccessful and
as a result, it was decided to focus on the standardization of an experiment being
carried out by a PhD student on a new protein, Kvβ2. This protein, a subunit of the
Kv1 protein, is involved in the regulation of the Shaker potassium channels of the
body. In this study, three compounds; Rutin, Quercitin and Resveratrol have been
identified as inhibitors of the kinetic mechanism for aldehyde dismutation that has
been proposed for Kvβ2. For this study, the Kvβ2 was expressed and purified for
HPLC analysis of the inhibitory studies.

1.1 Retinol Binding Protein 4
It has been reported that protein human Retinol Binding Protein-4 (hRBP4) is
linked with insulin resistance when serums levels are elevated (Graham, Yang,
Blüher, et al., 2006). As such, this protein has a casual function in Diabetes
Mellitus Type 2 (DM2). The RBP4 protein is secreted from hepatocytes and
adipocytes. Studies have been conducted on RBP4 regarding its role in the
reduced expression of the glucose transporter-4; GLUT4, an adipocyte which is
responsible for the post-digestive function of glucose uptake through the insulin-
mediated conscription of the GLUT4 transporter to the cell (Graham, et al., 2006).
RBP4, in serum, is now recognised as an adipokine linked with diminishing
hepatic and peripheral insulin sensitivity and therefore increased hepatic
gluconeogenesis (Craig, Chu and Elbein, 2006). It has been identified that the
RBP4 gene is located close to a region linked with type 2 diabetes (DM2) and as
such may be the reason for increased susceptibility to DM2 and the reduction in
insulin sensitivity (Craig, et al., 2006). An in vivo study by Craig, et al. (2006)
aimed at knocking out the adipose-specific GLUT4 in which mice acquired
muscle and hepatic insulin resistance and as such also showed an elevated serum
concentration of RBP4. Elevated RBP4 levels were noted in a population study of
subjects with impaired glucose tolerance and these serum levels dropped in
individuals with exercise-mediated improved insulin sensitivity, as well as the

2

serum levels showing an inverse relationship to insulin sensitivity in individuals
with a family history of DM2 (Graham, et al. 2006). The elevated serum
concentration of RBP4 was also reported by Craig et al. (2006) in individuals with
diabetes relative to euglycemic therapy. While insulin resistance is a vital
accomplice to DM, it can also provide a risk of cardiovascular disease (CVD) and
artherosclerosis indirectly via a pathophysiologic link and thus elevated serum
RBP4 is associated with CVD risk factors and metabolic syndrome; giving the
potential for RBP4 to be used as a predictor to DM2 (Suh, Kim, Cho, Choi, Han
and Geun, 2009). Reports have shown that RBP4 serum concentrations correlated
with diastolic blood pressure, fasting glucose levels and age; all factors associated
with DM (Suh, et al. 2009). Suh, et al. also reported the implications this may
have for lipid metabolism and insulin action. In this same study, it was reported
that serum RBP4 levels may correlate to age-induced insulin resistance (IR) as
well as independently being associated with fasting glucose levels. Women over
50 years of age consistently possessed higher serum RBP4 levels in the study by
Suh, et al; attributed to the reduced levels of Oestrogen during menopause which
leads to changes in the fat amounts in the body and visceral fat increases, thus
causing lipid metabolism changes and increasing RBP4 serum concentrations. The
link between RBP4 levels and fasting glucose concentrations can possibly be
explained through the mechanism which causes the induced expression of the
gluconeogenic enzyme
phosphoenolpyruvate carboxykinase by RBP4 via the liver which leads to RBP4-
induced IR in the liver (Suh, et al. 2009).

Fig.1.1: 3D representation of Retinol Binding Protein-4.

3

Serum RBP4 is reported as being preferentially being expressed in visceral fat
as opposed to expression in subcutaneous fat (Klöting, Graham, Berndt, et al.
2007). RBP4’s correlation with Transthyretin, which stabilizes circulating RBP4
and prevents it from being removed from plasma by glomerular filtration, was
used as an indicator to show the increase in visceral RBP4 in obese subjects, with
DM2 and impaired glucose tolerance (IGT), and was reported to be 35% over the
normal serum concentrations and therefore linking visceral adiposity and visceral
fat to RBP4 concentrations in the serum (Klöting, et al. 2007). Studies have
shown that RBP4 can be a clinical biomarker of IR in patients who present with a
range of clinical presentations, however it has also been reported that no evidence
has been found to back up this correlation and as such Chen, Wu, Chang and Tsai,
et al reported in 2009 the correlation between renal function rather than DM2.
Their study concluded that there was an expected inverse correlation between
RBP4 and uric acid, excreted by the kidneys due to the proven link between RBP4
levels and estimated glomerular function (eGFR), hence the relationship between
RBP4 and renal function in patients with DM2 (Chen, et al 2009). This may be an
indirect biomarker of IR and DM2 for RBP4 levels.
However, using a large study cohort, Lewis, Shand, Elder and Scott reported
in 2008 that RBP4 in the plasma may not be a functional biomarker of IR. In their
study of 285 fasting patients, some of whom had diabetes and some with no
diabetes but with varying levels of IR, the data observed did not provide any
relationship between RBP4 levels and IR and even body mass index (BMI),
percentage body fat and waist circumference as RBP4 levels were not
significantly higher in individuals with DM compared to those without. Thus also
putting into question; the correlation between lipid metabolism and plasma RBP4
levels. As already stated glomerular dysfunction can increase the levels of
circulating RBP4 and it has been noted that RBP4 levels in DM2 patients have
been affected by early nephropathy (Lewis, et al. 2008). RBP4 in this instance
may still be used as a biochemical marker of IR and there is still no evidence on
the contrary that GLUT4 levels reduce with a positive inverse in RBP4 expression
and secretion into serum. As such this is an analytical approach that may be used
to identify IR through RBP4 plasma concentration.

4

The standard treatment, according to the British National Formulary 2010, in
DM2 to reduce peripheral IR is the administration of Pioglitazone or
Rosiglitazone; both of which are Thiazolidinedione (TZD)-classed medications.
These drugs are typically prescribed in combination with Metformin or a
Sulphonylurea in order to reduce IR, as stated, by targeting the regulation of
adipocyte function from which RBP4 levels can be managed. TZD act on the
adipocyte function through adipocyte differentiation and adipocyte gene activation
as they are a synthetic peroxisome proliferator-activated receptor-gama (PPAR-γ)
ligands (Sasaki, Nishimura and Hoshino, et al 2007). TZDs are broadly used to
reduce hyperglycaemia and have been reported to increase serum adiponectin
significantly better than Sulphonylureas (Lin, et al. 2008). Due to the minimal
selectivity of the PPAR-γ modulator, these TZD drugs can provide a undesired
side effects such as gastrointestinal disruption, obesity and oedema and there for
more attention has been focused on food based compounds such as Anthocyanins
like Cyanidin 3-glucosides (C3G) for a more effective management of DM2 and
metabolic syndrome through their efficacy in the modulation of the GLUT4 –
RBP4 system as well as inflammatory adipocytokines which result in the
improvement of hyperglycaemia and insulin sensitivity of patients with DM2
(Sasaki, et al 2007). Anthocyanins are water-soluble, plant based chemicals as due
to their abundance in the plant kingdom it is suggested that high amounts of
Anthocyanins are ingested through plant-based diets, hence the ingestion of
C3G’s which Sasaki et al has reported to be a suppressor of RBP4 expression in
white adipose tissue with a reported 47% reduction in serum RBP4 of the study’s
group compared to the control group of diabetic mice. The treatment of these
diabetic mice with C3G also showed an increase in the expression of GLUT4
transporters, likely to be due to the reduced expression of RBP4, leading to better
insulin sensitivity. Dietary C3G treatment also proved to increase insulin
sensitivity but with no significant affect on the expression of adiponectin and its
receptors; leading to observations that polyphenols may inhibit α-glucosidase
activity although the amelioration of IR by C3G is not due to inhibition of α-
glucosidase activity (Sasaki et al 2007). This suggests a new class of drug and
dietary treatment for DM2 and metabolic syndrome in respect of the management
of IR.

5

1.2 Kvβ2: The Subunit of Kv1 Potassium Channels
Kvβ2 is a cytosolic protein; a subunit of Kv1 potassium (K+) channels which
are belong to the voltage-dependant ‘Shaker family’ of potassium channels.
Potassium channels are known to be widely dispersed ion channels within the
body, particularly in the Central Nervous System (CNS) and these are present in a
large number of living species (Kelly, 2010). The high abundance of Kvβ in the
nervous system may attribute to channel regulation in the myocardial cell and
impact on the action potential of same. The channels also provide a vital function
of establishing resting membrane potential and regulation of frequency during
action potential (Hille, et al. 1991). Such electrical activity is vital for the
functioning of process in excitable cells such as neurons and muscle (Long, et al.
2005). The Kvα subunit, Kvβ associates with the cytoplasmic aspect of the Kvα
protein and these do not contribute to ion conductivity however they do regulate
channel activity; the Kv channels have been shown to be responsible for the
regulation of K+ flow through cell membranes upon changes in the potential of the
membrane (Weng, et al 2006). These channels form transmembrane pores which
can be found in a variety of cell types in which they regulate the electrical
function and signalling processes among other physiological processes (Di
Costanzo, et al. 2009).

Fig.1.2: A mechanism for aldehyde dismutation in Kvβ2 as proposed by Alka, et al. 2010. RCHO is
an aldehyde, RCH(OH)2 is its corresponding hydrate, RCOOH and RCH2OH are the corresponding
alcohol and carboxylic acid respectively. The dismutation of aldehyde substrate consists of two
coupled half reactions. In the first half (the upper pathway), hydrated aldehyde is oxidised
irreversibly to the corresponding carboxylic acid forming ENADPH. In the second half reaction (lower
pathway), another molecule free aldehyde binds to the ENADPH complex and is reduced reversibly to
corresponding alcohol. Hence, aldehyde is dismutated into equimolar concentration of corresponding
alcohol and carboxylic acid in a redox silent reaction with no observable change in A340. Ψ denotes
the cofactor exchange step. The steps denoted by Ψ are insignificant during dismutation as cofactor
remains enzyme bound throughout alternate oxidation and reduction (Alka, et al. 2010).

6

The Shaker family of Kv potassium channels has an modifications that have
not been reported to exist in Kv channels of prokaryotes and these adaptations
allow the Kv channel to perform functions that are unique to eukaryotic cells
(Long, et al. 2005). Long, et al. (2005) also reported that the β subunit had large
portals on the side of the structure, between the pore and cytoplasm, with
electrophysical properties which have a consistent result in similar studies on
electrophysiological inactivation gating and research postulates the potential of K+
channel regulation by the β subunit (Long, et al. 2005). Upon structural study of
the Kvβ2, it was reported that the subunit contains a similar sequence homology to
that of an aldo-keto reductase (AKR). This AKR fold allows the β subunit to
catalyse a redox reduction. The structural analysis also found that Kvβ2 has a
tightly bound nicotinamide cofactor; NAPDH. This bond is non covalent and the
region also contains an aldehyde binding site (Alka, K. et al. 2010; Weng, et al.
2006).
Crystal structure analysis of the ternary complex Kvβ2-NADPH-cortisone also
identified a binding site for cortisone on the proteins surface; supplementing the
binding site at the enzyme active site (Di Costanzo, et al. 2009). The AKR fold
previously mentioned, catalyses a redox reduction in this instance by reducing an
aldehyde to an alcohol via oxidation of the NADPH cofactor (Weng et al 2006).
Fig 1.2 shows the reaction as proposed by Alka, K., et al in 2010. A similar
scheme proposed by Weng, et al. (2006) also shows an AKR and enzyme binding
in sequence to an NADPH to form an Enzyme-NADPH-aldehyde complex. The
enzyme in this complex transfers a hydride from the NADPH cofactor to the
aldehyde thus producing an alcohol product which is followed suit by NADP+.
This is facilitated by AKRs having a higher affinity for NADPH over NADH
(Weng et al. 2006). The process in Fig.1.2 is reversible which allows the alcohol
to be oxidised to form an aldehyde and NADP+ to be converted to NADPH as
reported by Weng, et al in 2006. The rate of cofactor exchange in the above
process is however, slow thus indicating Kvβ is a slow enzyme. Weng, et al. also
shows in the 2006 publication that even though NADPH was oxidised over a two-
week period, there was still a presence of NADP+ in Kvβ; showing a tight
association which is to an extent due to a flexible loop which stretches over
NADPH and it’s binding site. It is this loop that possibly decelerates the
dissociation of the cofactor to a more prolonged period as reported. The reduction

7

of substrates such as 4-nitrobenzaldehyde (4-N-B-ald) is known to be catalysed by
Kvβ2 and the slow aldehyde-substrate dismutation has been shown through a
HPLC assay (Alka,, et al. 2010).

Fig.1.3: Structural features of Kvβ: A, structure of Kv1.2 (blue) in complex with Kvβ2 (red)
in ribbon representation (Protein Data Bank code 2A79 (3)). The cell membrane is indicated by the
straight lines.B, ribbon representation of Kvβ2 showing its structural fold (Protein Data Bank code
1QRQ (10)). The bound cofactor (cyan) and the conserved active site residues, Asp85, Tyr90, Lys118,
and Asn158, are shown in stick representation. Residues Asp85 and Lys118 are labelled. A flexible
loop that straddles the cofactor binding site is shown in yellow (Gulbis et al., 1999).

A potassium channel modulation function was reported as the bound cofactor,
NADPH, is oxidised. The regulation of channel activity, however questionable as
the adequate production of relative aldehydes may not be sufficient enough for the
channel regulation due to both enzymatic and non-enzymatic processes leading to
oxidative stress (Alka, et al. 2010). However, as noted above, this can be a slow
process but it is suspected that this redox reaction of the cofactor may be faster in
the presence of more specific physiological substrate which is yet to be elucidated
(Alka, et al. 2010). The rate of aldehyde reduction is linearly dependant on the
concentration of Kvβ2 and can be observed as a decrease in the peak area at the
450nm fluorescence peak (Alka, et al. 2010). Reports have shown that cortisone
promotes dissociation of the Kvβ2 from the K+ channel as it binds in two sites; at
the bound cofactor and the boundary of the Kvβ subunits and is known to not be a
substrate of the Kvβ2 protein, thus presenting the possibility of it being an

8

inhibitor (Alka, et al. 2010). This study looks at the inhibitory effect three pre-
identified potential inhibitors; Rutin, Quercitin and Resveratrol have on the
dismutation of aldehyde to form an alcohol product; 4-nitrobenzylalcohol (4-N-B-
alc). Cortisone is a steroid hormone and the three compounds mentioned
previously have been shown to have anti-inflammatory effects similar to those of
cortisone.

1.3 The Phenols: Rutin, Resveratrol and Quercitin
Rutin, Resveratrol and Quercitin are the three potential inhibitory compounds
of interest in this study. Fig.1.4 – 1.6 shows the phenolic structures of each
compound.

1.3.1 Quercitin and Rutin
Rutin is a primary flavanoid which can be found in a number of plants such as
Buckwheat. It is for this reason that there is high dietary consumption of Rutin as
buckwheat is used in the manufacture of noodles and rice (Koda, et al. 2008).
Rutin is a glycoside form of Quercitin of whose glycosides have free radical
scavenging activities (Andlauer, et al. 2001). As can be seen in Fig.1.4 and
Fig.1.6, Quercitin and Rutin are very similar in structure, therefore they have
similar mechanisms of action and biological affects. Rutin is a larger molecule
and has been shown to be less potent than Quercitin. This is possibly due to the
glycosylation adding a sterically-hindering group for inhibitory binding which
may impact, in the context of this study, at the interface binding site of the β
subunit in the Kvβ2-NADPH complex. Rutin is known to have an antioxidant
effect among various other biological effects which have a positive impact on
human health such as anti-inflammatory and a gastro protective effect due to its
augmentation of the antioxidant activity on the activity of glutathione peroxidase;
a selenoprotein that is recently being studied to link changes or abnormalities in
the protein with the etiology of some cancers, CVD, autoimmune disease and
diabetes (Lei, et al. 2007). The 2008 study by Koda, et al. investigated the
therapeutic effect of Rutin in reducing brain damage if administered per-orally in
rats. Koda, et al. showed that dietary supplementation of Rutin over a prolonged
period reversed the induced spatial memory impairment by trimethyltin. Other
health benefits such as chemopreventive activity was proposed by Andlauer, et al.

9

with a requirement that intestinal absorptive-uptake must be carried out for this
link to be true contravening studies suggesting that Quercitin glycosides were
excreted rather than absorbed in human intestinal (Caco-2) cells (Andlauer, et al.
2001).

1.3.2 Resveratrol
Resveratrol is a phytoalexin that can be derived from the skin of fruits and I in
particular, red grapes among 70 other plant species. This attributes to high
concentrations of Resveratrol in red wine; approximately 50-100µg per gram of
grape skin (Athar, et al 2007). Like Rutin, Resveratrol is reported to have
antioxidant effects, potent anti-inflammatory and inhibition of the growth of
various cancer cells. Resveratrol is a compound that has helped spark an interest
in naturally occurring compounds being used as chemopreventives in human
cancers as it has been shown to have an effect on the tumour initiation, promotion
and progression stages of carcinogenisis (Athar, et al. 2007). Athar has also
reported that it is thought that Resveratrol can induce apoptosis of cells and
modulate cell growth pathways through its antioxidant activity.
Resveratrol, like other polyphenols can undergo glycosylation which has a
protective effect on Resveratrol by preventing it being degraded by oxidation thus
making it more stable and soluble and more soluble which is advantageous in the
gastrointestinal tract. It is this attribute that makes Resveratrol absorb more
efficiently than other polyphenols like Quercitin (Athar, et al. 2007). A review by
Athar, et al. in 2007 has shown that various administration routes have shown
positive outcomes when Resveratrol has been used in vivo against various
inhibited cancers in mice. Topical Resveratrol was tested in vivo for anti-
carcinogenisis activity on subcutaneous (SC) in the respect of non-melanoma skin
cancer and was proved to significantly reduced the prevalence of ultraviolet-B
(UVB)-mediated photo-toxicity at a topical dosage of 25µmol in SKH-1 hairless
mice and Soleas et al. identified in a 2002 a 60% reduction in papillomas when
Resveratrol was applied topically (Athar, et al. 2007). Modulation by the proteins
that regulate cell cycle have been associated to the anti-proliferative affects of
Resveratrol in such instances (Regan –Shaw, et al. 2004).
A comparison of red wine-consumers against other beverages showed that
there was a lower incidence of lung cancer among the subjects who consumed red

10

wine; associated with the high concentration of Resveratrol in red wine. Berge et
al. (2004) reported that Resveratrol inhibits the production of diol-epoxides;
compounds that have the potential to form covalent adducts with DNA and cause
structural alterations with mutations (Berge, et al. 2004). Studies on a number of
cancer types have shown Resveratrol to induce apoptosis in the carcinogenic cells,
also inhibit cell growth and significantly reduce the incidence of tumours while
also delaying the onset of tumourigenisis, in multiple targets and in a non-toxic
dose (Athar, et al. 2007). However, the dose which Resveratrol presents itself in
with red wine suggests that for health benefit to be observed by its administration
it may require synergistic combinations with compounds such as Quercitin and
ellagic acid; synergistic combinations which have been shown to induce apoptosis
in vitro and in vivo (Athar, et al. 2007). Resveratrol has been reported to have a
number of positive cardiogenic effects such as the reduction in incidences of
CVD. Its cardiogenic effects have been shown in the lowering of hyper / hypo-
tension clinical issues. This is thought to be due to Resveratrol inducing the
expression of endothelial nitric oxide synthase which is the enzyme responsible
for producing the vaso-dilating nitric oxides and decreasing the expression of the
endothelin-1; a vasoconstrictor (Das, et al. 2010). The endothelial cell is also
responsible for regulating the balance of endothelin-1 and nitric oxide which are
both important vasoconstrictors and vasodilators respectively; a function that
provides thromboresistance is shown to preclude atherogenesis (Das, et al. 2010).
Pharmacological intervention in cardiovascular medicine may be entering a new
age due to the range of health affects potentiated by Resveratrol such as cardiac
regeneration and the generation of autophagy (Das, et al. 2010).

1.4 Aldo-Keto Reductases
Aldo-keto reductases (AKR) form a large part of the cytosolic monomeric
NADPH-dependant carbonyl oxidoreductases along side another type of
oxidoreductase; short-chain dehydrogenase reductases (SDR) (Di Costanzo, et al.
2009). The AKR6A subfamily is associated with the Kvβ1-3 proteins which form
an (α/β)8-Barrell fold which links it structurally with AKRs, albeit with having a
low amino acid sequence similarity with other affiliates of the AKR group (Di
Costanzo, et al. 2009). The AKR family are known to reduce aldehydes and
ketones to their corresponding 1o and 2o alcohols and can be found in both

11

eukaryotes and prokaryotes (Penning and Drury, 2007). AKRs have also been
shown by Penning and Drury (2007) to reduce liophilic substrates such as
ketosteroids and retinals, thus regulating ligand access to nuclear receptors.
Substrate specificity of the AKR1 enzyme has been shown by Tipparaju et al.
(2008) to favour aromatic aldehydes, which contain electron withdrawing groups
in the para position of the aromatic ring or compounds that contain carbonyl
groups that are polarised by α,β- un-saturation, over cortisone which has shown
no activity. AKR also functions as an aldehyde reductase may have activity in
glucose metabolism and electron transport (Hyndman, et al. 2003). As mentioned
previously, cortisone binding sites were identified on the surface of the Kvβ-
NADPH-cortisone ternary complex, at which the cortisone binds backwards
compared to its binding profile within the active site of AKR1D1; a 5β-reductase,
which gives productive binding of progesterone as well as cortisone (Di Costanzo,
et al. 2009). Similar assessment of this structure has uncovered the link between
the binding of cortisone, in this fashion, to the surface of the protein and the
dissociation of β subunits from the Shaker potassium channel (Pan, et al. 2008).
AKRs are known to catalyse a number of reductions. In the bisequential
mechanism, in which reduction occurs in a central complex, binding of the
cofactor, NAPDH, supersedes the binding of a carbonyl substrate and is followed
by a release of the alcohol product and NADP+ in this respective order (Penning
and Drury, 2007). Penning and Drury (2007) also note that the AKRs rate
determining step can vary due to enzyme variation, i.e. most AKR reaction will
depend on the enzyme and rate of cofactor release. This is poignant in the regard
of Kvβ2 which has previously been noted by the author as being a slow reactive
protein thus having a slow rate of cofactor hydride transfer.
A link has been publicized about the implication of AKR in human diseases
such as diabetes. Catalysis of glucose conversion into sorbitol has been reported
as a role of aldose redcuatse; a prototypic member of the AKR family. This
conversion is the first step in the polyol pathway; a pathway which can occur in
the presence of chronic hyperglycaemia thus leading to diabetic complications
such as cataracts, retinopathy and nephropathy (Chang, et al. 2007).

12

Fig.1.4: Structure of Rutin (2-(3,4-dihydroxyphenyl)-4,5-dihydroxy-3[3,4,5-trihydoxy-6-[(3,4,5-
trihydroxy-6methyl-oxan-2-yl)oxymethyl]oxan-2-yl]oxy-chromen-7-one)

Fig.1.5: Structure of Resveratrol (trans-3,4’,5-trihydroxystilbene

Fig.1.6: Chemical Structure of Quercitin

13

Chapter 2:

Materials & Methods

14

2.0 Materials and Methods

2.1 Materials
Materials are listed per company used for their respective acquisition.
Promega Corporation Damastown, Mulhuddart, Dublin 15, Ireland
100bp DNA Ladder Marker
6X Blue / Orange Loading Dye Cat # G190A
Agarose, LE Analytical Grade C.A.S. #9012-36-6
dNTP Mix Cat # U1511
100bp Ladder Cat # G2101
Ethidium Bromide Cat # H5041
GoTAQ® DNA Polymerase Cat # M3171
GoTAQ® Green Master Mix Cat # M7122
PureYieldTM Plasmid-
Miniprep System A1221
Sigma – Aldrich, Airton Road, Tallaght, Dublin 24, Ireland
4-Nitrobenzaldehyde 98% C.A.S. # 555-16-8
4-Nitrobenzylalcohol 99% C.A.S. # 619-73-8
Bradford Reagent
Dialysis Tubing, High Retention Seamless Cellulose Tubing (23mm x 15mm)
Hydrochoric Acid 37% C.A.S. # 7647-01-0
Imidazole
Isopropyl β-D-thiogalactoside (IPTG)
Primers (detailed further on in Table.2)
Quercitin (Anhydrous) C.A.S. # 117-39-5
Rutin Hydrate (min 95%) C.A.S. # 207671-50-9
Sulphuric Acid (Conc.) C.A.S. # 7664-93-9
Triflouroacetic Acid 99%
(Spectrophotometric Grade) C.A.S. # 76-05-1
β-Nictinamide adenine-
dinucleotide phosphate-
reduced tetrasodium salt C.A.S. # 2646-71-1
Luria Bertani (LB) Broth # L3022-250G

15

Luria Bertani (LB) Agar # L2897-1KG
Lab Scan Analytical Sciences Stillorgan Industrial Park, Stillorgan, Dublin,
Ireland
Acetonitrile (HPLC Grade) C.A.S. # 75-05-8
VWR Northwest Business Park, Ballycoolin, Dublin 15, Ireland
HiPerSolv Chromaorm
for HPLC grade Methanol UN1230
Fisher Chemical / Fisher Scientific Ireland Blanchardstown Corporate Park 2,
Ballycoolin, Dublin 15, Ireland
Di-potassium hydrogen-
orthophosphate (Anhydrous) C.A.S. # 7758-11-4
Methanol (HPLC Grade) C.A.S. # 67-56-1
Potassium dihygrogen-
orthodphosphate C.A.S. # 7778-77-0
Sodium Chloride C.A.S. # 7647-14-5
Tris Base C.A.S. # 77-86-1
cDNA
From U937 Human Leukemic Monocyte Lymphoma Cell line. Donated by Dr.
Sinead Loughran, Dublin City University.
Qiagen Fleming Way, Crawley , West Sussex , RH10 9NQ
pQE-60

2.1.1 Instruments
AGB 1000 Hot Plate & Stirrer
Alpha Imager Mini Software
Alpha Innotech UV Camera
Branson 5510 Sonicator
Consort E865 Electrophoresis power supply
Empower HPLC Computer Software
Gilson Diamond pipette tips (for P2µl to P1000µl pipettes)
Gilson Pipetteman P2µl to P1000µl pipettes
Grant GD100 & W14 Water Baths
G-Storm PCR Machine
Metter Toledo AG285 Weighing Scales

16

Millipore Simplicity 185 Water Filter
Milton Roy Spectonic 1201 spectrophotometer
Perkin Elmer Fluorescence Spectrometer LS50B
Prism Data Processing Software
Revco Elite Plus Freezer
Sartoius BP310S Weighing Scales
Sigma 2K15 Centrifuge
Sonics Vibracell Amplifier and Sonicator
Startedt Sterilins
Stuart Orbital Incubator S1500
Thermo Scientific Heraeus Incubator
Thermo Scientific Orion Star 2 pH meter
Thermo Scientific Pico-21 Centrifuge
Tomy SX-5003 High Pressure Steam Steriliser
Unicam UV2 UV/Vis Spectrophotometer
Waters 2998 Photodiode Array Detector
Waters e2695 HPLC with Empower Operation software
Zanussi Fridge and Freezer Unit

2.1.2 E.coli strain
BL21 F- dcm ompT hsdS(rB- mB-) gal [malB+]K-12(λS) sourced from
Novagen was used in this study.

2.1.3 Plasmids

Plasmid Information Source
pET-15b Carries an N-Terminus His-tag and Novagen
contains a T7 promoter. Also
contains a thrombin site and three
cloning sites.
pQE-60 3.4kb. High copy number Qiagen
expression vector. Ampicillin
resistant. T5 promotor/lac operon.
6xHis sequence at 3’ end of MCS
Table 1: Description of Plasmids used.

17

2.2 Cloning Primer Design

All primers acquired from Sigma-Aldrich. Both primers 1 and 2, as listed in
Table 2, were used directly from Thomas, et al. (1993) as published in Gene and
are denoted with ‘G’ in front of their respective prime number. Primers designed
by the author are numbered 3 and 4. Primers 5 and 6 are the forward and reverse
primers for the Alu gene respectively.
No. Name 5’ - 3’ QA
Details
1 hRBP4 TTTGAATTCATATGGAGCGCGACTGCCGAGTG TM =
G-5’ AG 81.5oC
GC% = 50
2 hRBP4 TTTGGATCCCTACAAAAGGTTTCTTTC TM =
G-3’ 67.4oC
GC% = 37
3 hRBP4 CGGGATCCATGAAGTGGGTGTGGGCGCTCTT TM =
5’ 84.6oC
GC%=
61.2
4 hRBP4 CAGATCAGAAAGAAACCTTTTGAGATCTTC TM =
3’ 67.6oC
GC% =
36.6
5 Alu 5’ GTAAGAGTTCCGTAACAGGACAGCT TM =
65°C
GC% = 48
6 Alu 3’ CCCCACCCTAGGAGAACTTCTCTTT TM =
68°C
GC% = 52

Table 2: Details of Primers used in this study.
Primers were designed using the step-by-step methodology outlined below. This
method was used for hRBP4 5’ and hRBP4 3’ as listed in Table 2.

18

Step 1.
The gene sequence being sought was acquired by performing a BLAST search
using the NCBI website, http://blast.ncbi.nlm.nih.gov. RBP4 Sequence plasma
(RBP4), mRNA included below is 606bp long.
atgaagtggg tgtgggcgct cttgctgttg gcggcgctgg gcagcggccg
cgcggagcgc gactgccgag tgagcagctt ccgagtcaag gagaacttcg
acaaggctcg cttctctggg acctggtacg ccatggccaa gaaggacccc
gagggcctct ttctgcagga caacatcgtc gcggagttct ccgtggacga
gaccggccag atgagcgcca cagccaaggg ccgagtccgt cttttgaata
actgggacgt gtgcgcagac atggtgggca ccttcacaga caccgaggac
cctgccaagt tcaagatgaa gtactggggc gtagcctcct ttctccagaa
aggaaatgat gaccactgga tcgtcgacac agactacgac acgtatgccg
tgcagtactc ctgccgcctc ctgaacctcg atggcacctg tgctgacagc
tactccttcg tgttttcccg ggaccccaac ggcctgcccc cagaagcgca
gaagattgta aggcagcggc aggaggagct gtgcctggcc aggcagtaca
ggctgatcgt ccacaacggt tactgcgatg gcagatcaga aagaaacctt
ttgtag

Step 2.
Using the online software, Webcutter 2.0, the gene sequence was entered to
analyze which restriction endonucleases do not cut the RBP4 gene. The list of
endonucleases produced (which do not cut the gene) was scanned for the
endonucleases which may be used at the multiple cloning site (MCS) of the pQE-
60 vector. BamHI and BglII were identified as the optimum restriction
endonucleases to be used as the endonucleases NcoI cuts at c/catgg and therefore
couldn’t be used.

Step 3.

The forward primer, hRBP4 5’, was designed by taking the first 23bp of the
RBP4 gene and adding the restriction site for BamHI. The reverse primer, hRBP4
3’, was designed by taking the last 22bp of the sequence and rearranging it to its
reverse complement and adding of the restriction site for BglII. The addition of
these restriction sites is shown in the primer sequences outlined in Table 2 and are

19

highlighted in red. The base pair sequence was chosen by also factoring in an
optimum GC content of ~60%. The 23bp sequence selected for the forward primer
already contained the start codon ATG (highlighted blue in Table 2) and therefore
did not require the addition of a start codon. The sequence selected for the reverse
primer did not contain a stop codon, however the restriction site for BglII
contained the stop codon GAT (the reverse compliment of TAG) and therefore did
not require a stop codon addition.

The restriction sites for each of the endonucleases were obtained from the New
England Biloabs Inc. website (www.neb.com).

Step 4.

In order to achieve high efficacy in binding for the primers a restriction
enzyme base pair clamp was added to the primer. The addition of these clamps is
shown in the primer sequences outlined in Table 2 and are highlighted in green.

2.3 Agar and Broth Preparation
LB Agar (LBA) was made to 1 litre stock using 35g of LBA powder and
then sterilized. LB Broth (LBB) was made to 1 litre stock using 20g of LBB
powder and then sterilized. Both LBA and LBB were then supplemented with
100µg/ml of Ampicllin once cooled down to room temperature.

2.4 Sterilization
All sterilization was carried out using the Tomy SX-5003 High Pressure
Steam Steriliser with the parameters set at 121oC for 15mins at 103kPa (15psi).

2.5 Isolation of Plasmid Vector from E.Coli
LBA was inoculated with E.coli containing pQE-60 and placed on static
incubation for 24hrs at 37oC in the Thermo Scientific Heraeus Incubator. LBB
was aliquoted into three test tubes and 1 for a positive-growth control, one as a
negative-growth control and one for the working sample. One colony from the
LBA plates was inoculated into the working sample and positive-control test tubes
for 24hrs incubation at 37oC and 220rpm in the Stuart Orbital Incubator S1500.

20

Protocol, as outlined below were carried out according to the PureYieldTM
Plasmid Miniprep System using the provided isolation kit.
100µl of Cell Lysis buffer was added to 1.5ml of the LBB culture in a
microcentrifuge tube and mixed by inversion of the tube. 350µl of Neutralization
buffer (at 4oC) was added to the mix and thoroughly mixed by inverting the tube.
The mixture was then centrifuged at 14,000g in the Thermo Scientific Pico-21
Centrifuge. The supernatant was transferred to a minicolumn using a pipette in
order to not disturb the cell debris pellet. The minicolumn was centrifuged at
14,000g for 15 seconds. All follow-through from the minicolumn was discarded
and the minicolumn was placed into a collection tube and washed by adding 200µl
of Endotoxin Removal Wash to the minicolumn. The contents were centrifuged
for 15 seconds at 14,000g before adding 400µl of Column Wash Solution and
centrifuging again at 14,000g for 30 seconds. 30µl of Elution Buffer was finally
added and let stand at RT for 1 minute. The minicolumn was then centrifuged at
14,000g for 15 seconds to elute the plasmid DNA. Following final centrifugation
the eluted plasmid was transferred to a sterile ependorf and stored at -20oC.

2.6 DNA and Primer Preparation
cDNA was prepared for use from a stock of cDNA from U937 Human
Leukemic Monocyte Lymphoma Cell line donated by Dr. Sinead Loughran,
Dublin City University, by diluting to 1:50 by adding 1µl of cDNA stock in 50µl
of sterile de-ionized water (SDW). This was also further-diluted to 1:500 in order
to allow for a higher concentration of primers than template cDNA in the PCR
mix during the optimization process. Each primer was reconstituted as per the
manufacturer’s instructions on the Quality Assurance document.
hRBP4 G-5’ was diluted to a final 100µM working concentration using
389µl of SDW. hRBP4 G-3’ was diluted to a final 100µM working concentration
using 389µl of SDW. Both primers where then diluted to several concentrations
(102 to 10-5µM).

2.7 Agarose Gel Preparation
Varying concentrations of Agarose gel were used throughout this research.
The method for a 1% Agarose gel is described below. To make a different

21

percentage concentration the amount of Agarose stock power was changed
accordingly as per Table 3 below.
% Required g/100ml g/200ml
0.7% 0.7g 1.4g
0.8% 0.8g 1.6g
1% 1g 2g
Table 3: Comparison of Agarose volume used in this study.

1g Agarose was added to 200ml TAE buffer and boiled for 2.5 minutes
using a household microwave to ensure the Agarose had fully dissolved. When the
solution had cooled down to approximately 60oC, 8µl (4µl/100ml) of Ethidium
Bromide (EtBr) was added and manually stirred with a glass rod for 1 minute to
ensure complete dissolution of the EtBr. 100ml of Agarose gel was poured into
the gel plate for each PCR experiment.
All wells in the gel were formed in the gel using a 12-well comb placed into
the grooves of the gel plate. In order to prevent spillage of the molten gel,
autoclave tape was firmly placed at either end of the gel plate. The wells were
loaded with 6µl of PCR product and 100bp base pair markers when running the
gel. The PCR product was prepared in a 5:1 (product : 6X loading dye) mix as
this would give a 1X loading dye concentration. GoTAQ® Master Mix already
contained loading dye and was at a final concentration of 1X when in the PCR
reaction mix thus only the 100bp required the addition of 6X loading dye in the
fashion mentioned above.

2.8 Polymerase Chain Reaction (PCR)
A total of 6 PCR conditions were performed using a G-Storm PCR Machine
for each. Pre-prescribed settings, as listed in the GoTAQ® product sheet, were
used for the first run and then adjusting either the annealing or elongation times as
new reactions were carried out. The results are outlined further on in chapter 3.
All PCR cycle settings in this study were carried out with a Heated Lid of 110oC.
All Annealing temperatures were calculated using the calculation
TAnneal = TM – 5oC

22

This was facilitated by calculating the TM using the calculation below. This
calculation is based on the content of A, T, G and C bases in each primer.
TM = [2(A+T) + 4(G+C)] oC

2.8.1-1 PCR Reaction Mixture 1
A total of 4 reaction tubes were prepared using primer concentrations of
10µM and 20µM and varied cDNA volumes. Tube contents are detailed in Table
4. Each reaction tube contained the mix as outlined below. The PCR product was
ran on a 0.7% Agarose gel using a Consort E865 Electrophoresis power supply set
at 100V for 1.5 hours and shown in Fig.3.1. The annealing temperature used was
guided on the approximation of annealing at one minute for each kilo basepair in
the gene, thus the annealing temperature was estimated at 45 seconds as the the
number of basepairs in the gene is 606bp.

Reaction Mix 1
GoTAQ® Master Mix 5µl
hRBP4 G-5’ 1µl
hRBP4 G-3’ 1µl
cDNA (1:50) as per Table 4.
SDW to 25µl

Tube No. Primer Concentration cDNA Volume
1 10ìM 6ìl
2 20ìM 6ìl
3 10ìM 3ìl
4 20ìM 3ìl
Table 4: Details of Primer concentration and cDNA volumes used in PCR 1.

23

2.8.1-2 PCR Condition Set 1

Step Temperature Time
Initial Denaturation 94oC 4min
PCR Cycle at 35 Cycles
Denaturation 94 oC 1min
Annealing 58 oC 45secs
Elongation 72 oC 45secs
Finish Cycle
Final Elongation 72 oC 10min

A total of 6 reaction tubes numbered 2 to 7 were prepared using primer
concentrations of 1µM to 10-4µM in each tube respectively using a cDNA volume
of 6µl. Each reaction tube contained the mix as outlined below. A gradient
annealing temperature method was employed for this PCR cycle. The temperature
gradient was based on the average TM of primers 1 and 2 using the following
calculation:
TM (Av) = (TM1 – TM2) = (81.5 + 67.4)/2 = 74.45 oC
TAnneal(Average) = TM (Av) – 5oC = 74.45 oC – 5oC = 69.45oC

The temperature range based on TAnneal(Average) ±3-5oC (appox) and layout of PCR
product tubes in the G-Storm PCR Instrument is outlined in Table 5. The PCR
product was ran on a 0.7% Agarose gel using a Consort E865 Electrophoresis
power supply set at 100V for 1 hour and shown in Fig.3.2

Reaction Mix 2
GoTAQ® Master Mix 5µl
hRBP4 G-5’ 1µl
hRBP4 G-3’ 1µl
cDNA (1:50) 6µl
SDW to 25µl

24

Lane 1 2 3 4 5 6 7 8 9 10 11 12

ToC 60.1 60.4 61.1 62.2 63.6 65.1 66.7 68.3 70.1 71.2 71.8 72.2

Tube - 2 - 3 - 4 - 5 - 6 - 7

Table 5: ToC gradient and tube layout for PCR 2.


Finish Cycle

concentrations of 10-5µM, 10-3µM and 10-1µM in each tube respectively using a
cDNA (1:500) volume of 4µl. Each reaction tube contained the mix as outlined
below. The PCR product was ran on a 1% Agarose gel using a Consort E865
Electrophoresis power supply set at 100V for 1.5 hours and shown in Fig.3.3.

Reaction Mix 3
GoTAQ® Master Mix 12.5µl
hRBP4 G-5’ 1µl
hRBP4 G-3’ 1µl
cDNA (1:500) 4µl
SDW to 25µl

25


Finish Cycle

concentrations of 10-5µM, and 10µM in each tube respectively using a cDNA
(1:500) volume of 3µl. Alu gene at a 10-5µM concentration was used as a positive
control for the reaction set used. Each reaction tube contained the mix as outlined
below. The PCR product was ran on a 1% Agarose gel using a Consort E865
Electrophoresis power supply set at 120V for 1hr-10mins and shown in Fig.3.4.

Reaction Mix 4
GoTAQ® Master Mix 12.5µl
hRBP4 G-5’ / Alu 5’ 1µl
hRBP4 G-3’ / Alu 5’ 1µl
cDNA (1:500) 3µl
SDW to 25µl

26


Elongation 72 oC 1min
Finish Cycle

A total of 8 reaction tubes numbered 2 to 5 and 7 to 10 were prepared using
primer concentrations of 10-5µM, 10µM and 1µM in each tube respectively using
a cDNA (1:500) volume of 3µl. Alu gene at a 10-5µM concentration was used as a
positive control for the reaction sets used. Each reaction tube contained the mix as
outlined below. The PCR product was ran on a 1% Agarose gel using a Consort
E865 Electrophoresis power supply set at 110V for 1hr-15mins and shown in
Fig.3.5. Two reactions were run simultaneously for this experiment using two
PCR machines which allowed for faster analysis on the new primers using two
different PCR condition sets. This was carried out in Machine 1 and Machine 2
which were in labs M4.06 and M4.02 respectively. Reaction mix 5.1 and 5.2 were
placed in Machine 1 and Machine 2 respectively. The PCR Condition sets below
are numbered also in this fashion. A gradient annealing temperature method was
employed for this PCR cycle. The temperature range of TAnneal(Average) ±3-5oC
(appox) and layout of PCR product tubes is outlined in Table 6 and Table 7.
Reaction Mix 5.1 Reaction Mix 5.2
GoTAQ® Master Mix 12.5µl GoTAQ® Master Mix 12.5µl
hRBP4 -5’ / Alu 5’ 1µl hRBP4 -5’ / Alu 5’ 1µl
hRBP4 -3’ / Alu 5’ 1µl hRBP4 -3’ / Alu 5’ 1µl
cDNA (1:500) 3µl cDNA (1:500) 3µl
SDW to 25µl SDW to 25µl

27

2.8.5-2 PCR Condition Set 5.1

Annealing 57 - 62 oC 55secs
Finish Cycle

2.8.5-2 PCR Condition Set 5.2

Annealing 63 - 67 oC 55secs
Finish Cycle

Lane 1 2 3 4 5 6 7 8 9 10 11 12
No.

ToC 57 57.2 57.5 57.9 58.3 59.1 59.8 60.5 61.2 61.7 61.9 62

Tube 2 5 - - 3 - - - 4 - - -

Table 6: ToC gradient and tube layout for PCR 5.1. (Machine 1)

28

Lane 1 2 3 4 5 6 7 8 9 10 11 12
No.

ToC 60.1 60.4 61.1 61.2 63.6 65.1 66.7 68.3 70.1 71.2 71.8 72.2

Tube

Table 7: ToC gradient and tube layout for PCR 5.2. (Machine 2)

2.9 Preparation of TAE Buffer
A 50X stock solution of TAE buffer at pH ~8.5 was prepared by
measuring out the following components in separate beakers and finally mixing in
a Duran Bottle. 242g of Tris base, 57.1ml of glacial acetic acid, 37.2g
Ethylenediaminetetraacetic Acid, Disodium Salt, Dihydrate (Na2EDTA.2H2O)
and then dH2O was added to a final volume of 1litre. A 1X TAE buffer was
prepared by measuring 20ml of 50X TAE and adding d.H2O to 1litre.

2.10 Purification and Expression of Kvβ2
Kvβ2 gene obtained from rat brain was cloned with an N-terminus His-tag.
The E. coli BL21 (DE3, plysS) stock was transformed with pET15b-Kvβ2 vector-
construct by culturing at 37°C in LB medium containing 50µg/ml ampicillin.
Absorbance was measured at 600nm (A600 nm), thus when the A600 nm of the culture
reached ~ 0.8, the expression of Kvβ2 protein was induced for 14hr by the
addition of IPTG to a final concentration of 1mM, by incubating at 25°C and
280rpm. Cells were resuspended in lysis buffer (20mM Tris-HCl, pH 7.9, 5mM
imidazole, 200mM NaCl) and lysed by sonication for 130 seconds while being on
ice, as protein is extremely sensitive to fluctuation in temperature. Cell debris was
collected by centrifugation at 39000g and the supernatant was run through the
nickel-charged iminodiacetic acid column pre-equilibrated with lysis
buffer/binding buffer. The Ni+ column was washed with 2.5 litres of the binding
buffer/lysis buffer to remove the unbound proteins. Elution was carried out with
20mM Tris-HCl, pH 7.9, 200mM NaCl, and 300mM imidazole. Fifteen fractions
of the post elution Kvβ2 were taken and absorbance (A280nm) of each tube was

29

measured and plotted as described in Fig.3.6 to obtain the elution profile of the
protein.

2.11 Dialysis of Kvβ2

2.11.1 Preparation of Dialysis Tubing
The dialysis tube was boiled in water containing 1mM EDTA for 30 minutes
as this will initiate the removal of glycerol, prepare the pores of the tubing and
chelate any ions present. Removal of sulphur compounds was carried out by
treating the tubing with a 0.3% (w/v) solution of sodium sulphide at 80oC for 1
minute followed by washing with hot water at 60oC for 2 minutes, followed by
acidification with a 0.2% (v/v) solution of sulphuric acid, then rinsed with hot
water to remove the acid.

2.11.2 Dialysis of Kvβ2
The dialysis of Kvβ2 was then carried out in 6 litres of pre-chilled 0.15M
potassium phosphate buffer, pH 7.5 for 36 hours with one change

2.12 HPLC assay to measure the inhibition of Kvβ2 mediated reduction of 4-
nitrobenzaldehyde
All inhibition studies were carried out in duplicate in 0.2M potassium
phosphate buffer, pH 7.5 containing 0.2mM NADPH at 22°C in the presence of
~0.5mg of Kvβ2 appropriate concentration of inhibitor and 500µM of 4-
nitrobenzaldehyde as substrate (final volume of 0.5ml).The inhibitor was
incubated with the protein for 15 minutes before the addition of substrate, which
was added last, and the reaction was further incubated for 40 minutes at 37°C. The
reaction was quenched by adding an equal volume of the HPLC mobile phase
(methanol/trifluroacetic acid/water, 60: 0.1: 39.9). Aliquots, (10µl), of the
resultant mixture were analysed on a Nucleosil C18 (3.9 x 150 mm) HPLC
column with monitoring by a Millipore Waters (Mississauga, Canada) liquid
chromatography UV detector at 274 nm. Controls with no enzyme were
incorporated in every reaction to monitor any background reaction of the inhibitor
with the substrate 4-nitrobenzaldehyde. This method was carried out for all three
inhibitory compounds Mobile phases; Solvents A, B and C, were prepared and

30

used for both the isocratic and gradient methods. The contents of Solvent A, B and
C are outlined in the Appendices. An isocratic method was used for Quercitin.
The isocratic method used 100% Solvent B.

2.12.1 Method for Gradient HPLC Assay (Rutin & Resveratrol)
All samples were prepared using the same protocol as outlined above for the
Isocratic HPLC Assay. A gradient assay was set up using Empower software. A
linear gradient setting of Solvent A and B was set up with a runtime of 20mins at
a flow rate of 0.9ml/min. The gradient breaks down as follows: 80% to 20%
Solvent A and 20% to 80% Solvent B over 15mins, 100% Solvent B, 0% Solvent
A for 5mins then back to original conditions of 80% Solvent A, 20% Solvent B.
Fig.2.1 below illustrates this gradient.

120 Gradient Profile Isocratic Profile Solvent A
Solvent B
100

80
Solvent, %

60
Return to
Normal Conditions
40

20

0
0 4 8 12 16 20 24 28 32
Run Time, minutes

Fig.2.1. Diagram representing the Gradient elution method employed for the HPLC Analysis of
Resveratrol and Rutin

31

2.13 Bradford Method for Protein Concentration Determination
The protein concentration of Kvβ2 enzyme was determined using Bradford
reagent and by employing the Bradford method. Analysis was carried on out on
three preparations as outlined in Table 8. A Bovine Serum Albumen (BSA)
calibration standard curve was plotted by diluting 1mg/ml stock to yield the
concentrations 0-100 µg/ml of protein. This is seen in Fig.3.22. Bradford reagent
was added to each tube as described below and incubated for 5 minutes. The
absorbance (A595nm) reading was measured using Milton Roy Spectonic 1201
spectrophotometer.

Tube No. Protein d.H2O Bradford
Reagent
1 10ìl 70ìl 0.9ml
2 20ìl 80ìl 0.9ml
3 30ìl 70ìl 0.9ml
Table 8: Outline of reaction mixtures for Bradford Method

2.14 Flouresence Measurement of inhibitor - Kvβ2 binding
Flourometirc analysis of the bound NADPH cofactor to Kvβ2 was taking
using Perkin Elmer fluorescence spectrometer LS50B at 22°C. A 2.0µM sample
of Kvβ2 bound NADPH was carried out in 0.2M potassium phosphate buffer at a
pH 7.5 and all inhibitor solutions were made in DMSO prior to dilution in 0.2M
potassium phosphate buffer while maintaining a DMSO concentration ≤ 1% v/v.
An excitation wavelength of 360nm and a slit size of 15nm were used an emission
spectra were analyzed from 300nm to 600nm. Spectra were recorded as noted in
Chapter 3. 10µl of inhibitor was then added to the Kvβ2 solution and inverted
several times to mix. Using the same conditions, a spectrum was recorded at zero
minutes (T0min) and at set intervals thereafter; T5min, T10min and T15min.

32

Chapter 3:

Results

33

3.0 Results

3.1 PCR Results
Primer concentrations are listed below each PCR image as the concentration of
sample used. Fig.3.1 to Fig.3.5 below outlines the amplification results from PCR
experiments one to five.

1 2 3 4 5

Fig.3.1: PCR UV Photograph of PCR #1 on a 0.7% Agarose Gel taken at 302nm. Lane 1: 10µM:
Lane 2: 20µM Sample. Lane 3: 10µM sample. Lane 4: 20µM Sample. Lane 5: 100bp Marker.

34

1 2 3 4 5 6 7 8 9

1500bp

500bp

100bp

Fig 3.2: PCR UV Photograph of PCR #2 on a 0.7% Agarose Gel taken at 302nm. Lane 1: 100bp
Marker (sample leaked out of the well when loading, this there is streaks of DNA). Lane 2: 1µM
Sample. Lane 3: 10-1µM sample. Lane 4: 10-2µM Sample. Lane 5: 10-3µM Sample. Lane 6&7: 10-
4
µM Sample. Lane 8: No sample. Lane 9: 100bp Marker.

35

1 2 3 4 5 6 7 8 9 10 11 12

1500bp

500bp

100bp

Fig.3.3: PCR UV Photograph of PCR #3 on a 1% Agarose Gel taken at 302nm. Lane 1: 100bp
marker. Lane 2: 10-5µM Sample. Lane 3: 10-3µM Sample. Lane 4: 10-1µM Sample. Lanes 5-11: No
Sample. Lane 12: 100bp marker.

1 2 3 4 5

1500bp

500bp

100bp

marker. Lane 2: 10-5µM Alu Gene (Positive control). Lane 3: 10µM Sample. Lane 4: 10-5µM
Sample. Lanes 5: 100bp marker

36

1 2 3 4 5 6 7 8 9 10 11 12

1500bp

500bp

100bp

marker. Lane 2: 10µM Sample. Lane 3: 1µM Sample. Lane 4: 10-5µM Sample. Lanes 5: 10-5µM
Alu Gene (Positive control). Lane 6: 100bp Marker. Lane 7: 10-5µM Alu Gene (Positive control).
Lane 8: 10µM Sample. Lane 9: 1µM Sample. Lane 10: 10-5µM Sample. Lane 11: No Sample.
Lane 12: 100bp marker

3.2 Expression and Purification of Kvβ2

1
0.9
0.8
0.7
Absorbance (280nm)

0.6
0.5
0.4
0.3
0.2
0.1
0
-0.1 0 2 4 6 8 10 12 14 16

Protein Volume (ml)

Fig. 3.6: Elution profile of purified Kvβ2 after being placed in a Ni+ column. The Phosphate buffer
used during elution was measured as a blank and the protein was eluted as a single peak.

37

3.3 HPLC Chromtatograms for the Inhibition of Kvβ2 Mediated Reduction
of 4-nitrobenzaldehyde
3.3.1 Chromatogram Results for Rutin Experiment

0.10

9.036
NADPH 4-N-B-ald
1.702

0.08

0.06
AU

7.588
0.04

0.02 4-N-B-alc

0.00
0.00 2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00
Minutes

Fig.3.7: Chromatogram showing a control reaction for Rutin experiment containing 0.5mM 4-
nitrobenzaldehyde, 0.2M phosphate buffer, ~10µM Kvβ2 and 0.2mM NADPH. This clearly shows
the enzymatic reaction taking place with the production of 4-nitrobenzylaclohol (a product of the
Kvβ2 mediated reduction of 4-nitrobenzaldehyde)

2.00
12.033

1.50
4-N-B-ald
AU

1.00
9.023
1.704

0.50

NADPH 4-N-B-alc
0.00
0.00 2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00
Minutes

Fig.3.8: Chromatogram showing a control reaction for Rutin experiment containing 0.5mM 4-
nitrobenzaldehyde, 0.2M phosphate buffer and 0.2mM NADPH in a 10µl injection. The
comparatively small peak intensity of the NADPH is due to the lack of the NADPH bound
cofactor present with the inclusion of Kvβ2.

38

0.030

0.028

0.026

0.024

0.022 No Rutin
0.020

0.018
100µM
0.016 300µM
AU

0.014 500µM

0.012
700µM
0.010

0.008

0.006

0.004

0.002

0.000
7.12 7.14 7.16 7.18 7.20 7.22 7.24 7.26 7.28 7.30 7.32 7.34 7.36 7.38 7.40 7.42 7.44 7.46 7.48 7.50 7.52 7.54 7.56 7.58 7.60
Minutes

Fig.3.9: Concentration dependant inhibition of Kvβ2 by Rutin. The chromatogram shows the
decrease in peak area of the 4-nitrobenzylalcohol on the HPLC as a result of the increasing
concentration of Rutin (100µΜ, 300µΜ, 500µΜ and 700µΜ) in a mixture containing ~10 µΜ
Κvβ2, 0.2M potassium phosphate buffer, 500µΜ 4-nitrobenzaldehyde (substrate), 200µM NADPH
and various concentrations of Rutin, after the addition of Rutin to Κvβ2 containing NADPH.

39

3.3.2 Chromatogram Results for Quercitin Experiment

0.20
4-N-B-alc

3.387
4-N-B-ald
0.15
NADPH
1.914
AU

0.10
3.056

0.05

0.00
0.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 11.00 12.00 13.00 14.00 15.00
Minutes

Fig.3.10: Chromatogram showing a control reaction for Quercitin experiment containing 0.5mM
4-nitrobenzaldehyde, 0.2M phosphate buffer, ~10µM Kvβ2 and 0.2mM NADPH. This clearly
shows the enzymatic reaction taking place with the production of 4-nitrobenzylaclohol (a product
of the Kvβ2 mediated reduction of 4-nitrobenzaldehyde)

0.20
3.403

4-N-B-alc
0.15

NADPH
AU

0.10
4.802
1.908

0.05
4-N-B-ald

0.00
0.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 11.00 12.00 13.00 14.00 15.00
Minutes

Fig. 3.11: Chromatogram showing a control reaction for Quercitin experiment containing 0.5mM
4-nitrobenzaldehyde, 0.2M phosphate buffer and 0.2mM NADPH in a 10µl injection. The
comparatively small peak intensity of the NADPH is due to the lack of the NADPH bound
cofactor present with the inclusion of Kvβ2.

40

0.050

0.045 No Quercetin

0.040

0.035

0.030

50µM
AU

0.025
100µM
0.020 300µM

0.015
500µM

0.010

0.005

0.000
2.96 2.98 3.00 3.02 3.04 3.06 3.08 3.10 3.12 3.14 3.16 3.18 3.20
Minutes

Fig.3.12: Concentration dependant inhibition of Kvβ2 by Quercitin . The chromatogram shows the
decrease in peak area of the 4-nitrobenzylalcohol on the HPLC as a result of the increasing
concentration of Quercitin (100µΜ, 300µΜ, 500µΜ and 700µΜ) in a mixture containing ~10 µΜ
Κvβ2, 0.2M potassium phosphate buffer, 500µΜ 4-nitrobenzaldehyde (substrate), 200µM NADPH
and various concentrations of Quercitin, after the addition of Quercitin to Κvβ2 containing
NADPH.

41

3.3.3 Chromatogram Results for Resveratrol Experiment

1.699

8.881
0.08 4-N-B-ald
NADPH
0.06

7.433
AU

4-N-B-alc
0.04

0.02

0.00
0.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 11.00 12.00 13.00 14.00
Minutes

Fig.3.13: Chromatogram showing a control reaction for Resveratrol experiment containing 0.5mM
4-nitrobenzaldehyde, 0.2M phosphate buffer, ~10µM Kvβ2 and 0.2mM NADPH. This clearly
shows the enzymatic reaction taking place with the production of 4-nitrobenzylaclohol (a product
of the Kvβ2 mediated reduction of 4-nitrobenzaldehyde)

0.40
1 1 .7 2 0
1 .7 0 0

8 .8 0 9

0.30 4-N-B-alc 4-N-B-ald
AU

0.20 NADPH

0.10

0.00
0.00 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 9.00 10.00 11.00 12.00 13.00 14.00 15.00 16.00 17.00 18.00 19.00 20.00
Minutes

Fig.3.14: Chromatogram showing a control reaction for Resveratrol experiment containing 0.5mM 4-
nitrobenzaldehyde, 0.2M phosphate buffer and 0.2mM NADPH in a 10µl injection. The comparatively
small peak intensity of the NADPH is due to the lack of the NADPH bound cofactor present with the
inclusion of Kvβ2.

42

0.018
No Resveratrol
0.016

100µM
0.014

300µM
0.012

500µM
0.010
AU

0.008

0.006

0.004

0.002

0.000
7.30 7.35 7.40 7.45 7.50 7.55 7.60 7.65 7.70 7.75 7.80 7.85 7.90 7.95 8.00
Minutes

Fig.3.15. Concentration dependant inhibition of Kvβ2 by Resveratrol. The chromatogram shows
the decrease in peak area of the 4-nitrobenzylalcohol on the HPLC as a result of the increasing
concentration of Resveratrol (100µΜ, 300µΜ, 500µΜ and 700µΜ) in a mixture containing ~10
µΜ Κvβ2, 0.2M potassium phosphate buffer, 500µΜ 4-nitrobenzaldehyde (substrate), 200µM
NADPH and various concentrations of Resveratrol, after the addition of Resveratrol to Κvβ2
containing NADPH.

43

3.4 Percentage Inhibition Results for Rutin, Quercitin and Resveratrol

Fig.3.16: Concentration dependant inhibition of Kvβ2 by Rutin. The graph shows the percentage-
inhibition of the Kvβ2 activity as a result of increasing concentrations of Rutin (0-2000µM) in a
mixture containing ~10 µΜ Κvβ2, 0.2M potassium phosphate buffer, 500µΜ 4-nitrobenzaldehyde
(substrate), 200µM NADPH and various concentrations of Rutin, after the addition of Rutin to
Κvβ2 containing NADPH and 4-nitrobenzaldehyde.

Fig.3.17: Concentration dependant inhibition of Kvβ2 by Quercitin. The graph shows the
percentage-inhibition of the Kvβ2 activity as a result of increasing concentrations of Quercitin (0-
2000µM) in a mixture containing ~10 µΜ Κvβ2, 0.2M potassium phosphate buffer, 500µΜ 4-
nitrobenzaldehyde (substrate), 200µM NADPH and various concentrations of Quercitin, after the
addition of Rutin to Κvβ2 containing NADPH and 4-nitrobenzaldehyde.

44

Fig.3.18: Concentration dependant inhibition of Kvβ2 by Resveratrol. The graph shows the
percentage-inhibition of the Kvβ2 activity as a result of increasing concentrations of Resveratrol
(0-2000µM) in a mixture containing ~10 µΜ Κvβ2, 0.2M potassium phosphate buffer, 500µΜ 4-
nitrobenzaldehyde (substrate), 200µM NADPH and various concentrations of Resveratrol, after the
addition of Rutin to Κvβ2 containing NADPH and 4-nitrobenzaldehyde.

3.5 Flouresence Spectra

Fig,3.19: Flourometric data showing the binding of Rutin to Kvβ2 in a 2µM Kvβ2 + 50µM
phosphate buffer mixture which is leading to a 64% reduction in Flouresence emission of the peak
at 460nm representing the bound cofactor.

45

Fig.3.20: Flourometric data showing the binding of Quercitin to Kvβ2 in a 2µM Kvβ2 + 50µM

Fig.3.21: Flourometric data showing the binding of Resveratrol to Kvβ2 in a 2µM Kvβ2 + 50µM

46

3.5 Bradford Method Standard Curve

0.5

0.4
Absorbance at 595 nm

0.3

0.2

0.1

0
0 10 20 30 40 50 60 70 80 90 100

[BSA] (µg/ml)

Fig.3.22: Data shown represents BSA standard curve for the estimation of protein concentration
using the Bradford Method.

47

Chapter 4:

Discussion

48

Thesis complete final edit gm dt480.4 p

Recomendados

Recomendados

Mais conteúdo relacionado

Destaque

Destaque (8)

Semelhante a Thesis complete final edit gm dt480.4 p

Semelhante a Thesis complete final edit gm dt480.4 p (20)

Thesis complete final edit gm dt480.4 p