O slideshow foi denunciado.
Utilizamos seu perfil e dados de atividades no LinkedIn para personalizar e exibir anúncios mais relevantes. Altere suas preferências de anúncios quando desejar.
GENOME SEQUENCING
BY :-
ANITHA.Y
14KUST4002
WHAT IS GENOMICS ?
GENOMICS AS A SUB DISCPLINARY
BRANCH
• MAPPING
• FUNCTIONAL
ANALYSIS OF GENOME
• SEQUENCING
DIFFERENCE B/W GENETICS
AND GENOMICS
looks at a single
gene where as
examines
all the genes of entire
system in a broader
...
TYPES OF
GENOMICS
STRUCTURAL
FUNCTIONAL
COMPARATIVE
STRUCTURAL-
Determination of complete
sequence and gene map.
FUNCTIONA...
GENOME
 IS DEFINEDAS
.
OR
INA E/K , DNA OR RNA OR
VIRUSES.
 IT IS DENOTEDAS ‘X’.NUMBEROF PLOIDYOF AN ORGANISM.
 EXAMPLE...
TYPES OF GENOME
PROKARYOTIC GENOME
EUKARYOTIC GENOME
• NUCLEAR GENOME
• MITOCHONDRIAL GENOME
• CHLOROPLAST GENOME
 Is a technique that allows researchers to read
the genetic information found in the DNA of
anything from bacteria to pla...
WHY SEQUENCE GENOME ? ? ?
IMPROVE
HUMAN HEALTH
HARNESS
NATURAL
ENERGY
CONSERVE
ENVIRONMENT
ENSURE FOOD
SAFETY
CLEAN UP
ENV...
WHY SEQUENCE GENOME ? ? ?
 DISTINGUISH B/W GENOMES OF FLORA AND FAUNA ,
ANDTHEN GROUPTHEMTOWHICH FIELDTHEY
BELONG.
 SERV...
MILESTONES
 1977- FIRST SEQUENCEDΦx 174 BACTERIOPHAGE GENOME
(F.SANGER) (5,375bp)
 1995- HAEMOPHILUS INFLUENZAE (1,830,1...
SEQUENCING OF OTHER ORGANISM
 The sequence of many organisms have been carried
out at a rapid pace
 There are many medic...
DETERMINING THE SEQUENCE OF DNA
 METHODS :-
 MAXAM & GILBERT CHEMICAL DEGRADATION METHOD
 FREDRICK SANGERS CHAINTERMINA...
AUTOMATED SEQUENCER
• First automated sequence was
invented by Llyod. M.Smith.
• It uses the Sangers sequence
method and f...
AUTOMATED SEQUENCER
• It is basically radio active
sequencing approach.
• The electrophoretic bands gets
activated by scan...
FLUORESCENCE
SEQUENCER• Since it was radio active in
nature there were disposable
problems and health risks
• Hence fluore...
As of september 2007, complete
sequence was known :
1879 viruses
577 bacterial species
Approx 23 E/K species (mostly half ...
REFERENCES:-
 Brown B,Aoran M (2001)The rise of modern
genomics,3rd ednWiley,NewYork,p234-295
 C.A Graham and A.J.M Hill...
Genome sequencing
Genome sequencing
Próximos SlideShares
Carregando em…5
×

Genome sequencing

Genomic sequencing a sub-disciplinary branch of genetics and difference between the two sequencers used to sequence the genome basically automated sequencer and fluorescence sequencers and its applications.

  • Entre para ver os comentários

Genome sequencing

  1. 1. GENOME SEQUENCING BY :- ANITHA.Y 14KUST4002
  2. 2. WHAT IS GENOMICS ?
  3. 3. GENOMICS AS A SUB DISCPLINARY BRANCH • MAPPING • FUNCTIONAL ANALYSIS OF GENOME • SEQUENCING
  4. 4. DIFFERENCE B/W GENETICS AND GENOMICS looks at a single gene where as examines all the genes of entire system in a broader manner. • It deals with the Study of functional and structural aspects of genome aiding in .
  5. 5. TYPES OF GENOMICS STRUCTURAL FUNCTIONAL COMPARATIVE STRUCTURAL- Determination of complete sequence and gene map. FUNCTIONAL- Functioning and regulation of gene expression ; metabolic pathway etc COMPARATIVE- Compares genes from different genomes to relate functional and “evolutionary relationships”.
  6. 6. GENOME  IS DEFINEDAS . OR INA E/K , DNA OR RNA OR VIRUSES.  IT IS DENOTEDAS ‘X’.NUMBEROF PLOIDYOF AN ORGANISM.  EXAMPLE :- DROSOPHILA MELANOGASTER (2n=2X=8)GENOME :- X=4  TRITICUMAESTIVUM (6n=6X=42)GENOME :- X=7  THETERM WAS TO DENOTE COMPLETE SET OF CHROMOSOMALAND EXTRACHROMOSOMALGENES IN ALL ORGANISM INCLUDING VIRUS.
  7. 7. TYPES OF GENOME PROKARYOTIC GENOME EUKARYOTIC GENOME • NUCLEAR GENOME • MITOCHONDRIAL GENOME • CHLOROPLAST GENOME
  8. 8.  Is a technique that allows researchers to read the genetic information found in the DNA of anything from bacteria to plant to animals.  It basically involves “determination of order of bases ”. AGCTTAACCCTGGTACCAAAGGGTCACTT  Position of every gene along the chromosome, regulatory gene that flank each gene, the coding sequence that determines the protein produce by each gene.
  9. 9. WHY SEQUENCE GENOME ? ? ? IMPROVE HUMAN HEALTH HARNESS NATURAL ENERGY CONSERVE ENVIRONMENT ENSURE FOOD SAFETY CLEAN UP ENVIRONMENT
  10. 10. WHY SEQUENCE GENOME ? ? ?  DISTINGUISH B/W GENOMES OF FLORA AND FAUNA , ANDTHEN GROUPTHEMTOWHICH FIELDTHEY BELONG.  SERVES AS A MEANS OF CROP IMPROVEMENT AND DEVELOP CONVENTIONAL BREEDING PRACTICESTO DEVELOP AGRICULTURAL PRACTICES.  IT CAN ALSO BE USEDTO PRODUCE SUFFICIENT AMOUNT OF SAFE AND NUTRITIOUS FOOD DURING INCREASE POPULATION DEMAND.  HELP RESEARCHES OR PRODUCERS (FARMERS) IN DETERMINING THE RELATIONSHIP B/W STRESS AND THEYIELD POTENTIALTHUS HELPING IN IMPROVING VARIETIES.
  11. 11. MILESTONES  1977- FIRST SEQUENCEDΦx 174 BACTERIOPHAGE GENOME (F.SANGER) (5,375bp)  1995- HAEMOPHILUS INFLUENZAE (1,830,137bp) ; MYCOPLASMA GENITALIUM (5,80,000bp)CRAIGVENTER AND HAMILTON SMITH)  1996- SACCAROMYCES CEREVISIAE (12,068,000)  1997- ESCHERICHIA COLI (4,639,221bp)  2000- DROSOPHILA MELANOGASTER (180,000,000bp)  2001- HUMANWORKING DRAFT (320,000,000bp)  2002-PLASMODIUM FALCIPARUM (23,000,000bp) ;ANOPHELES GAMBIEA (278,000,000bp)  2003- HUMAN FINISHED SEQUENCE (3,200,000,000bp)  2005- ORYZA SATIVA (489,000,000bp)  2006- POPULUSTRICHOCARPA (485,000,000bp)
  12. 12. SEQUENCING OF OTHER ORGANISM  The sequence of many organisms have been carried out at a rapid pace  There are many medical ; genetics ; and commercial reasons for sequencing genomes of other organisms :-  Escherichia coli  Saccharomyces cerevisiae  Caenorhabditis elegans  Drosophila melanogaster  Arabidopsis thaliana(Thale / Mouse ear cress)  Oryza sativa L. (Rice)  Mus musculus(laboratory mouse)
  13. 13. DETERMINING THE SEQUENCE OF DNA  METHODS :-  MAXAM & GILBERT CHEMICAL DEGRADATION METHOD  FREDRICK SANGERS CHAINTERMINATION METHOD  GENOME SEQUENCING METHODS :-  - SHOT GUN SEQUENCING  - CLONE CONTIG APPROACH  - AUTOMATED SEQUENCER  - FLUORESCENCE SEQUENCER  2nd GENERATION SEQUENCING METHOD :-  - PYRO SEQUENCING  - NANOPORE SEQUENCING  - ILLUMINA SEQUENCING  - SOLID SEQUENCING  3rd GENERATION SEQUENCING METHOD
  14. 14. AUTOMATED SEQUENCER • First automated sequence was invented by Llyod. M.Smith. • It uses the Sangers sequence method and formed the basis of first generation of Dna sequences. • The 1st automated sequencer was AB370A which was able to sequence 96 samples simultaneously with 500-600kb in size. • Later in 1955 AB310 took over and completed the ‘’ human genome project “ in 2001 • The manufactures of this sequencer are Roche , Illumina ,Life Technologies ,Beckman coulter,Pacific biosciences and Oxford nanopore.
  15. 15. AUTOMATED SEQUENCER • It is basically radio active sequencing approach. • The electrophoretic bands gets activated by scanning laser. • The colour is read by and then the computer assembles the images as electropherograms • They analyse the resulting electropherograms giving the output as four colour chromatogram. • There are many software tools which are optimized for sequencing the data like preassemble ,seqtrace etc.
  16. 16. FLUORESCENCE SEQUENCER• Since it was radio active in nature there were disposable problems and health risks • Hence fluorescence sequencer used fluorescent dyes . • Sequencing products are electrophoresed and they use laser to detect fragments. • Incorporation of randomly labelled ddNTPs produces a series of fragment in which chain growth has been terminated at each successive position. • Each nucleotide will be longer than the previous one. • Separation of fragments for determining the order by size in the form of ladder and as a series of coloured band. • Polyphred is a software tool.
  17. 17. As of september 2007, complete sequence was known : 1879 viruses 577 bacterial species Approx 23 E/K species (mostly half are viruses)
  18. 18. REFERENCES:-  Brown B,Aoran M (2001)The rise of modern genomics,3rd ednWiley,NewYork,p234-295  C.A Graham and A.J.M Hill, vol 167: Dna sequencing protocols,p645-660  Bishop, J.E &Waldholz M.Genome (Simon and Schuster New york,1990),p109-117  Aoran MThe future of genomics ,proceedings of the genomics researchers,boston (e-book)  Springer  Research gate

×