SlideShare uma empresa Scribd logo
1 de 32
A transcription-splicing integrated network
 reveals pervasive cross-regulation among
            regulatory proteins


             Network Biology SIG
                 ISMB 2012
               Long Beach CA




                 Idit Kosti
         Computational Biology Lab
           Technion, Haifa, Israel
Regulation of the gene expression pathway
 DNA       Promoter     intron      exon

                      Transcription
 RNA
                      Splicing
                      Alternative Splicing




 Protein              Translation



                P     Phosphorylation
                      Posttranslational modification
Transcription
DNA      Promoter         intron   exon

                        Transcription




• The first step leading to gene expression.
• Transcription is regulated by transcription
  factors (TFs) that are bound to the promoter
  region of the gene.
Alternative splicing
RNA
                       Alternative Splicing




• Alternative splicing (AS) creates a huge protein
  variety from a small number of genes.
• 95% of the genes have at least one AS event.
• AS is regulated by splicing factors (SFs).
Phosphorylation
Protein                 Translation



              P          Phosphorylation




• Protein phosphorylation plays a significant role in
  a wide range of cellular processes
• Phosphorylation occurs at phosphorylation sites
  and facilitated by kinases.
In our network we focus on
transcription and alternative splicing
        regulation in human
The splicing-transcription co-regulatory network
                                        SF

                                20 Splicing Factors         Transcription
           SF                   (gene/protein)
                                                            regulation
                                        TF

   SF              TF        90 Transcription Factors
                             (gene/protein)


                                        K
            K
                                   147 Kinases
                                   (gene only)



Kosti I., Radivojac P., Mandel-Gutfreund Y., An integrated regulatory network
reveals pervasive cross-regulation among transcription and splicing factors,
PLoS Computational Biology, in press.
Predicting TF binding sites using TRANSFAC

                                 A   [13 13 3 1]
       TRANSFAC PSSMs            C   [13 39 5 53]
                                 G   [17 2 37 0]
                                 T   [11 0 9 0]




Predication of TFBS using PSSM        Human TCGACGCCTCACGTGTTCCTCCTGG
       and conservation               Mouse ATCGCACTGCACGTGGGATCTGATC




  Significant hits in promoter
             region


 TFBS table, UCSC genone broswer
The splicing-transcription co-regulatory network

                            SF

                    20 Splicing Factors       Transcription
       SF           (gene/protein)
                                              regulation
                            TF

  SF        TF   90 Transcription Factors
                 (gene/protein)             Alternative Splicing
                                            regulation
                            K
       K
                       147 Kinases
                       (gene only)
Predicting SF binding sites using SFmap
                                    sfmap.technion.ac.il
                                              UCUU
 Experimentally defined binding               YCAY
            motifs
                                             YGCUKY
                                             GAAGAA




                                             Human UCGACGCCUUCCUUCUCUUUCCUCCU
 Predication of SFBS using motif,
  conservation and multiplicity              Mouse AUCGCACUGUCUUAUCGGAUCUGAUC




   Significant hits in AS region



    Paz I. et al., Nucleic Acids Res. 2010
Regulation on AS events changes
   according to event types

                    Cassette exon



                Alternative 5’ splice site


                Alternative 3’ splice site
How do we wire the network?
         1       2   3       A   X




 X



             3


     2


                         X       A
     1
Our network behaves like a regulatory
              network
Highly clustered                                  Sparse



                                                                Sparseness=0.046


   p-value =1.09e-61        Outdegree Frequency




   Power law
   outdegree distribution

                                                    Outdegree
Cross-regulation vs. Cross-talk regulation

                                 TF
                            TF




                  SF                  K




cross-talk regulation (regulation across functional group)
cross-regulation (regulation within the functional group)
Transcription regulation is highest among
                   TFs
                          Transcription Regulation


                            pv= 1.2E-3        pv = 3.8E-7
      Number of inedges




                                                                         3654




                            SF           TF         Kinase   pv < 0.05
Splicing regulation is highest among SFs

                       Splicing Regulation


                                pv= 2.7E-3
   Number of inedges




                          pv= 2.3E-4
                                                            97




                         SF       TF         Kinase
                                                      P-value < 2.2e-16
Similar gene length, number of exons
               and number of AS events
                                                  Gene length                                                                                    Number of exons per factor
                         20000 30000 40000




                                                                                                                                            30
                                                                                                               Number of exons per factor
                                                                                                                                            25
      Gene length (nt)




                                                                                                                                            20
                                                                                                                                            15
                         10000




                                                                                                                                            10
                                                                                                                                            5
                         0




                                                                                                                                            0
                                             SF        TF                                 Kinase                                                   SF         TF   Kinase
                                                            Frequency from target group




                                                                                                                                                        SFs
Number of alternative                                                                                                                                   TFs
splicing events per factor                                                                                                                              Kinases




                                                                                           Number of alternative splicing events
Random networks showed insignificant
                          inedges density

                  Splicing regulation                 Transcription regulation
Inedge average




                                         Inedge average



                   SF     TF    Kinase                     SF    TF    Kinase
Experimental binding data supports
     splicing regulation trend
                                                   RNA
  QKI


                                                   splicing
                                                   Transcription
                                                   activity
  PTB
  FOX2
  SF2/ASF




            0   2   4      6     8       10   12

                        -Log10(pvalue)
Cross regulation vs. cross-talk regulation

                         TF
                    TF




             SF               K
Same trend, different organisms
                   Transcription regulation

 Human                            Drosophila                           Yeast



 pv= 1.2e-3                                                     pv= 9.2e-10




SF            TF             SF           TF                      SF            TF

                       Marbach et al. Genome Res. 2011   Pelechano et al., PLoS Genetics 2009
Same trend, different organisms
                                   Splicing regulation
                                                                                Guy Plaut
                          Human                               Drosophila
 Number of inedges




                      pv= 2.3e-4          Number of inedges      pv= 1.7e-11




                     SF        TF                               SF         TF
Screening using expressionshow for
  Tissue specific networks data the
      muscleregulatory behavior
      same and heart tissues
Tissue specific networks show the
                        same regulatory behavior
                         Splicing Regulation                        Transcription Regulation
Number of inedges




                                                Number of inedges


                    SF     TF        SF   TF                         SF   TF      SF   TF


                                40 TFs 11 SFs                             33 TFs 14 SFs
The splicing-transcription co-regulatory network
                            SF

                    20 Splicing Factors       Transcription
       SF           (gene/protein)
                                              regulation
                            TF

  SF        TF   90 Transcription Factors
                 (gene/protein)             Alternative Splicing
                                            regulation
                            K
       K
                       147 Kinases
                       (gene only)
is highest
                              among Kinases
                                                 Phosphorylation Regulation

            Fraction of protein with predicted
                   phosphorylation site




Predrag
Radivojac
                                                      SF        TF        Kinase
Cross-regulation vs. cross-talk regulation


                         TF
                    TF




             SF               K
The role of cross talk between splicing and
          transcription regulation




           SRP20
                   SRP55
                               PAX 6

    SC35



                      SF2ASF
            9G8
Regulatory proteins tend to be highly
regulated by the specific regulation they
               carry out.
                         TF
                    TF




             SF               K
Thanks!
Technion
Yael Mandel Gutfreund

Guy Plaut
Inbal Paz
Iris Dror
Martin Akerman
And all lab members

Indiana University
Predrag Radivojac

      And you for your attention!

Mais conteúdo relacionado

Semelhante a NetBioSIG2012 kostiidit

Conferencia Narendra Maheshri
Conferencia Narendra Maheshri Conferencia Narendra Maheshri
Conferencia Narendra Maheshri lideresacademicos
 
2011 Rna Course Part 1
2011 Rna Course Part 12011 Rna Course Part 1
2011 Rna Course Part 1ICGEB
 
New methods for high-throughput nucleic sequencing and diagnostics using a th...
New methods for high-throughput nucleic sequencing and diagnostics using a th...New methods for high-throughput nucleic sequencing and diagnostics using a th...
New methods for high-throughput nucleic sequencing and diagnostics using a th...Douglas Wu
 
Gene prediction and expression
Gene prediction and expressionGene prediction and expression
Gene prediction and expressionishi tandon
 
Regulation of Gene Expression ppt
Regulation of Gene Expression pptRegulation of Gene Expression ppt
Regulation of Gene Expression pptKhaled Elmasry
 
Random RNA interactions control protein expression in prokaryotes
Random RNA interactions control protein expression in prokaryotesRandom RNA interactions control protein expression in prokaryotes
Random RNA interactions control protein expression in prokaryotesPaul Gardner
 
Wellstein poster embl meeting nov 2018
Wellstein poster embl meeting nov 2018Wellstein poster embl meeting nov 2018
Wellstein poster embl meeting nov 2018Anne Deslattes Mays
 
Alternative splicing by kk sahu
Alternative splicing by kk sahuAlternative splicing by kk sahu
Alternative splicing by kk sahuKAUSHAL SAHU
 
Transcription Regulation in Eukaryotes
Transcription Regulation in EukaryotesTranscription Regulation in Eukaryotes
Transcription Regulation in EukaryotesIshaqueAbdulla
 
Transcription Regulation
Transcription Regulation Transcription Regulation
Transcription Regulation IshaqueAbdulla
 
2013 transcription
2013 transcription2013 transcription
2013 transcriptionkuldip sodhi
 
2013 transcription
2013 transcription2013 transcription
2013 transcriptionkuldip sodhi
 
Gene structure and genetic code
Gene structure and genetic codeGene structure and genetic code
Gene structure and genetic codeNOOR ARSHIA
 
Sept2016 plenary mercer_sequins
Sept2016 plenary mercer_sequinsSept2016 plenary mercer_sequins
Sept2016 plenary mercer_sequinsGenomeInABottle
 
Nextgenerationsequencing 120202015950-phpapp02
Nextgenerationsequencing 120202015950-phpapp02Nextgenerationsequencing 120202015950-phpapp02
Nextgenerationsequencing 120202015950-phpapp02t7260678
 
Bio305 Lecture on Gene Regulation in Bacterial Pathogens
Bio305 Lecture on Gene Regulation in Bacterial PathogensBio305 Lecture on Gene Regulation in Bacterial Pathogens
Bio305 Lecture on Gene Regulation in Bacterial PathogensMark Pallen
 

Semelhante a NetBioSIG2012 kostiidit (20)

Conferencia Narendra Maheshri
Conferencia Narendra Maheshri Conferencia Narendra Maheshri
Conferencia Narendra Maheshri
 
Msb201158
Msb201158Msb201158
Msb201158
 
Apoptosis
ApoptosisApoptosis
Apoptosis
 
2011 Rna Course Part 1
2011 Rna Course Part 12011 Rna Course Part 1
2011 Rna Course Part 1
 
New methods for high-throughput nucleic sequencing and diagnostics using a th...
New methods for high-throughput nucleic sequencing and diagnostics using a th...New methods for high-throughput nucleic sequencing and diagnostics using a th...
New methods for high-throughput nucleic sequencing and diagnostics using a th...
 
Collegepart B.Burgering Deel 2
Collegepart B.Burgering Deel 2Collegepart B.Burgering Deel 2
Collegepart B.Burgering Deel 2
 
Gene prediction and expression
Gene prediction and expressionGene prediction and expression
Gene prediction and expression
 
Regulation of Gene Expression ppt
Regulation of Gene Expression pptRegulation of Gene Expression ppt
Regulation of Gene Expression ppt
 
Random RNA interactions control protein expression in prokaryotes
Random RNA interactions control protein expression in prokaryotesRandom RNA interactions control protein expression in prokaryotes
Random RNA interactions control protein expression in prokaryotes
 
Wellstein poster embl meeting nov 2018
Wellstein poster embl meeting nov 2018Wellstein poster embl meeting nov 2018
Wellstein poster embl meeting nov 2018
 
Alternative splicing by kk sahu
Alternative splicing by kk sahuAlternative splicing by kk sahu
Alternative splicing by kk sahu
 
Transcription Regulation in Eukaryotes
Transcription Regulation in EukaryotesTranscription Regulation in Eukaryotes
Transcription Regulation in Eukaryotes
 
Transcription Regulation
Transcription Regulation Transcription Regulation
Transcription Regulation
 
2013 transcription
2013 transcription2013 transcription
2013 transcription
 
2013 transcription
2013 transcription2013 transcription
2013 transcription
 
Gene structure and genetic code
Gene structure and genetic codeGene structure and genetic code
Gene structure and genetic code
 
Genetic code and translation
Genetic code and translationGenetic code and translation
Genetic code and translation
 
Sept2016 plenary mercer_sequins
Sept2016 plenary mercer_sequinsSept2016 plenary mercer_sequins
Sept2016 plenary mercer_sequins
 
Nextgenerationsequencing 120202015950-phpapp02
Nextgenerationsequencing 120202015950-phpapp02Nextgenerationsequencing 120202015950-phpapp02
Nextgenerationsequencing 120202015950-phpapp02
 
Bio305 Lecture on Gene Regulation in Bacterial Pathogens
Bio305 Lecture on Gene Regulation in Bacterial PathogensBio305 Lecture on Gene Regulation in Bacterial Pathogens
Bio305 Lecture on Gene Regulation in Bacterial Pathogens
 

Mais de Alexander Pico

NRNB Annual Report 2018
NRNB Annual Report 2018NRNB Annual Report 2018
NRNB Annual Report 2018Alexander Pico
 
NRNB Annual Report 2017
NRNB Annual Report 2017NRNB Annual Report 2017
NRNB Annual Report 2017Alexander Pico
 
2016 Cytoscape 3.3 Tutorial
2016 Cytoscape 3.3 Tutorial2016 Cytoscape 3.3 Tutorial
2016 Cytoscape 3.3 TutorialAlexander Pico
 
NRNB Annual Report 2016: Overall
NRNB Annual Report 2016: OverallNRNB Annual Report 2016: Overall
NRNB Annual Report 2016: OverallAlexander Pico
 
Technology R&D Theme 3: Multi-scale Network Representations
Technology R&D Theme 3: Multi-scale Network RepresentationsTechnology R&D Theme 3: Multi-scale Network Representations
Technology R&D Theme 3: Multi-scale Network RepresentationsAlexander Pico
 
Technology R&D Theme 2: From Descriptive to Predictive Networks
Technology R&D Theme 2: From Descriptive to Predictive NetworksTechnology R&D Theme 2: From Descriptive to Predictive Networks
Technology R&D Theme 2: From Descriptive to Predictive NetworksAlexander Pico
 
Technology R&D Theme 1: Differential Networks
Technology R&D Theme 1: Differential NetworksTechnology R&D Theme 1: Differential Networks
Technology R&D Theme 1: Differential NetworksAlexander Pico
 
Overall Vision for NRNB: 2015-2020
Overall Vision for NRNB: 2015-2020Overall Vision for NRNB: 2015-2020
Overall Vision for NRNB: 2015-2020Alexander Pico
 
2015 Cytoscape 3.2 Tutorial
2015 Cytoscape 3.2 Tutorial2015 Cytoscape 3.2 Tutorial
2015 Cytoscape 3.2 TutorialAlexander Pico
 
NetBioSIG2014-FlashJournalClub by Frank Kramer
NetBioSIG2014-FlashJournalClub by Frank KramerNetBioSIG2014-FlashJournalClub by Frank Kramer
NetBioSIG2014-FlashJournalClub by Frank KramerAlexander Pico
 
NetBioSIG2014-Talk by Salvatore Loguercio
NetBioSIG2014-Talk by Salvatore LoguercioNetBioSIG2014-Talk by Salvatore Loguercio
NetBioSIG2014-Talk by Salvatore LoguercioAlexander Pico
 
NetBioSIG2014-Intro by Alex Pico
NetBioSIG2014-Intro by Alex PicoNetBioSIG2014-Intro by Alex Pico
NetBioSIG2014-Intro by Alex PicoAlexander Pico
 
NetBioSIG2014-Talk by Traver Hart
NetBioSIG2014-Talk by Traver HartNetBioSIG2014-Talk by Traver Hart
NetBioSIG2014-Talk by Traver HartAlexander Pico
 
NetBioSIG2014-Talk by Tijana Milenkovic
NetBioSIG2014-Talk by Tijana MilenkovicNetBioSIG2014-Talk by Tijana Milenkovic
NetBioSIG2014-Talk by Tijana MilenkovicAlexander Pico
 
NetBioSIG2014-Talk by Yu Xia
NetBioSIG2014-Talk by Yu XiaNetBioSIG2014-Talk by Yu Xia
NetBioSIG2014-Talk by Yu XiaAlexander Pico
 
NetBioSIG2014-Keynote by Marian Walhout
NetBioSIG2014-Keynote by Marian WalhoutNetBioSIG2014-Keynote by Marian Walhout
NetBioSIG2014-Keynote by Marian WalhoutAlexander Pico
 
NetBioSIG2014-Talk by Ashwini Patil
NetBioSIG2014-Talk by Ashwini PatilNetBioSIG2014-Talk by Ashwini Patil
NetBioSIG2014-Talk by Ashwini PatilAlexander Pico
 
NetBioSIG2014-Talk by David Amar
NetBioSIG2014-Talk by David AmarNetBioSIG2014-Talk by David Amar
NetBioSIG2014-Talk by David AmarAlexander Pico
 
NetBioSIG2014-Talk by Hyunghoon Cho
NetBioSIG2014-Talk by Hyunghoon ChoNetBioSIG2014-Talk by Hyunghoon Cho
NetBioSIG2014-Talk by Hyunghoon ChoAlexander Pico
 
NetBioSIG2014-Talk by Gerald Quon
NetBioSIG2014-Talk by Gerald QuonNetBioSIG2014-Talk by Gerald Quon
NetBioSIG2014-Talk by Gerald QuonAlexander Pico
 

Mais de Alexander Pico (20)

NRNB Annual Report 2018
NRNB Annual Report 2018NRNB Annual Report 2018
NRNB Annual Report 2018
 
NRNB Annual Report 2017
NRNB Annual Report 2017NRNB Annual Report 2017
NRNB Annual Report 2017
 
2016 Cytoscape 3.3 Tutorial
2016 Cytoscape 3.3 Tutorial2016 Cytoscape 3.3 Tutorial
2016 Cytoscape 3.3 Tutorial
 
NRNB Annual Report 2016: Overall
NRNB Annual Report 2016: OverallNRNB Annual Report 2016: Overall
NRNB Annual Report 2016: Overall
 
Technology R&D Theme 3: Multi-scale Network Representations
Technology R&D Theme 3: Multi-scale Network RepresentationsTechnology R&D Theme 3: Multi-scale Network Representations
Technology R&D Theme 3: Multi-scale Network Representations
 
Technology R&D Theme 2: From Descriptive to Predictive Networks
Technology R&D Theme 2: From Descriptive to Predictive NetworksTechnology R&D Theme 2: From Descriptive to Predictive Networks
Technology R&D Theme 2: From Descriptive to Predictive Networks
 
Technology R&D Theme 1: Differential Networks
Technology R&D Theme 1: Differential NetworksTechnology R&D Theme 1: Differential Networks
Technology R&D Theme 1: Differential Networks
 
Overall Vision for NRNB: 2015-2020
Overall Vision for NRNB: 2015-2020Overall Vision for NRNB: 2015-2020
Overall Vision for NRNB: 2015-2020
 
2015 Cytoscape 3.2 Tutorial
2015 Cytoscape 3.2 Tutorial2015 Cytoscape 3.2 Tutorial
2015 Cytoscape 3.2 Tutorial
 
NetBioSIG2014-FlashJournalClub by Frank Kramer
NetBioSIG2014-FlashJournalClub by Frank KramerNetBioSIG2014-FlashJournalClub by Frank Kramer
NetBioSIG2014-FlashJournalClub by Frank Kramer
 
NetBioSIG2014-Talk by Salvatore Loguercio
NetBioSIG2014-Talk by Salvatore LoguercioNetBioSIG2014-Talk by Salvatore Loguercio
NetBioSIG2014-Talk by Salvatore Loguercio
 
NetBioSIG2014-Intro by Alex Pico
NetBioSIG2014-Intro by Alex PicoNetBioSIG2014-Intro by Alex Pico
NetBioSIG2014-Intro by Alex Pico
 
NetBioSIG2014-Talk by Traver Hart
NetBioSIG2014-Talk by Traver HartNetBioSIG2014-Talk by Traver Hart
NetBioSIG2014-Talk by Traver Hart
 
NetBioSIG2014-Talk by Tijana Milenkovic
NetBioSIG2014-Talk by Tijana MilenkovicNetBioSIG2014-Talk by Tijana Milenkovic
NetBioSIG2014-Talk by Tijana Milenkovic
 
NetBioSIG2014-Talk by Yu Xia
NetBioSIG2014-Talk by Yu XiaNetBioSIG2014-Talk by Yu Xia
NetBioSIG2014-Talk by Yu Xia
 
NetBioSIG2014-Keynote by Marian Walhout
NetBioSIG2014-Keynote by Marian WalhoutNetBioSIG2014-Keynote by Marian Walhout
NetBioSIG2014-Keynote by Marian Walhout
 
NetBioSIG2014-Talk by Ashwini Patil
NetBioSIG2014-Talk by Ashwini PatilNetBioSIG2014-Talk by Ashwini Patil
NetBioSIG2014-Talk by Ashwini Patil
 
NetBioSIG2014-Talk by David Amar
NetBioSIG2014-Talk by David AmarNetBioSIG2014-Talk by David Amar
NetBioSIG2014-Talk by David Amar
 
NetBioSIG2014-Talk by Hyunghoon Cho
NetBioSIG2014-Talk by Hyunghoon ChoNetBioSIG2014-Talk by Hyunghoon Cho
NetBioSIG2014-Talk by Hyunghoon Cho
 
NetBioSIG2014-Talk by Gerald Quon
NetBioSIG2014-Talk by Gerald QuonNetBioSIG2014-Talk by Gerald Quon
NetBioSIG2014-Talk by Gerald Quon
 

Último

Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, AdobeApidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobeapidays
 
Why Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire businessWhy Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire businesspanagenda
 
AXA XL - Insurer Innovation Award Americas 2024
AXA XL - Insurer Innovation Award Americas 2024AXA XL - Insurer Innovation Award Americas 2024
AXA XL - Insurer Innovation Award Americas 2024The Digital Insurer
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Scriptwesley chun
 
A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?Igalia
 
Corporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptxCorporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptxRustici Software
 
Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processorsdebabhi2
 
Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)wesley chun
 
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...apidays
 
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfBoost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfsudhanshuwaghmare1
 
Architecting Cloud Native Applications
Architecting Cloud Native ApplicationsArchitecting Cloud Native Applications
Architecting Cloud Native ApplicationsWSO2
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerThousandEyes
 
ICT role in 21st century education and its challenges
ICT role in 21st century education and its challengesICT role in 21st century education and its challenges
ICT role in 21st century education and its challengesrafiqahmad00786416
 
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...apidays
 
Apidays Singapore 2024 - Modernizing Securities Finance by Madhu Subbu
Apidays Singapore 2024 - Modernizing Securities Finance by Madhu SubbuApidays Singapore 2024 - Modernizing Securities Finance by Madhu Subbu
Apidays Singapore 2024 - Modernizing Securities Finance by Madhu Subbuapidays
 
Strategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a FresherStrategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a FresherRemote DBA Services
 
Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...
Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...
Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...apidays
 
AWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAndrey Devyatkin
 
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc
 

Último (20)

Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, AdobeApidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
Apidays New York 2024 - Scaling API-first by Ian Reasor and Radu Cotescu, Adobe
 
Why Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire businessWhy Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire business
 
AXA XL - Insurer Innovation Award Americas 2024
AXA XL - Insurer Innovation Award Americas 2024AXA XL - Insurer Innovation Award Americas 2024
AXA XL - Insurer Innovation Award Americas 2024
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Script
 
A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?
 
Corporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptxCorporate and higher education May webinar.pptx
Corporate and higher education May webinar.pptx
 
Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processors
 
Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)Powerful Google developer tools for immediate impact! (2023-24 C)
Powerful Google developer tools for immediate impact! (2023-24 C)
 
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
 
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfBoost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdf
 
Architecting Cloud Native Applications
Architecting Cloud Native ApplicationsArchitecting Cloud Native Applications
Architecting Cloud Native Applications
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected Worker
 
ICT role in 21st century education and its challenges
ICT role in 21st century education and its challengesICT role in 21st century education and its challenges
ICT role in 21st century education and its challenges
 
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
Apidays New York 2024 - Accelerating FinTech Innovation by Vasa Krishnan, Fin...
 
Apidays Singapore 2024 - Modernizing Securities Finance by Madhu Subbu
Apidays Singapore 2024 - Modernizing Securities Finance by Madhu SubbuApidays Singapore 2024 - Modernizing Securities Finance by Madhu Subbu
Apidays Singapore 2024 - Modernizing Securities Finance by Madhu Subbu
 
Strategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a FresherStrategies for Landing an Oracle DBA Job as a Fresher
Strategies for Landing an Oracle DBA Job as a Fresher
 
Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...
Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...
Apidays Singapore 2024 - Scalable LLM APIs for AI and Generative AI Applicati...
 
AWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of Terraform
 
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
 

NetBioSIG2012 kostiidit

  • 1. A transcription-splicing integrated network reveals pervasive cross-regulation among regulatory proteins Network Biology SIG ISMB 2012 Long Beach CA Idit Kosti Computational Biology Lab Technion, Haifa, Israel
  • 2. Regulation of the gene expression pathway DNA Promoter intron exon Transcription RNA Splicing Alternative Splicing Protein Translation P Phosphorylation Posttranslational modification
  • 3. Transcription DNA Promoter intron exon Transcription • The first step leading to gene expression. • Transcription is regulated by transcription factors (TFs) that are bound to the promoter region of the gene.
  • 4. Alternative splicing RNA Alternative Splicing • Alternative splicing (AS) creates a huge protein variety from a small number of genes. • 95% of the genes have at least one AS event. • AS is regulated by splicing factors (SFs).
  • 5. Phosphorylation Protein Translation P Phosphorylation • Protein phosphorylation plays a significant role in a wide range of cellular processes • Phosphorylation occurs at phosphorylation sites and facilitated by kinases.
  • 6. In our network we focus on transcription and alternative splicing regulation in human
  • 7. The splicing-transcription co-regulatory network SF 20 Splicing Factors Transcription SF (gene/protein) regulation TF SF TF 90 Transcription Factors (gene/protein) K K 147 Kinases (gene only) Kosti I., Radivojac P., Mandel-Gutfreund Y., An integrated regulatory network reveals pervasive cross-regulation among transcription and splicing factors, PLoS Computational Biology, in press.
  • 8. Predicting TF binding sites using TRANSFAC A [13 13 3 1] TRANSFAC PSSMs C [13 39 5 53] G [17 2 37 0] T [11 0 9 0] Predication of TFBS using PSSM Human TCGACGCCTCACGTGTTCCTCCTGG and conservation Mouse ATCGCACTGCACGTGGGATCTGATC Significant hits in promoter region TFBS table, UCSC genone broswer
  • 9. The splicing-transcription co-regulatory network SF 20 Splicing Factors Transcription SF (gene/protein) regulation TF SF TF 90 Transcription Factors (gene/protein) Alternative Splicing regulation K K 147 Kinases (gene only)
  • 10. Predicting SF binding sites using SFmap sfmap.technion.ac.il UCUU Experimentally defined binding YCAY motifs YGCUKY GAAGAA Human UCGACGCCUUCCUUCUCUUUCCUCCU Predication of SFBS using motif, conservation and multiplicity Mouse AUCGCACUGUCUUAUCGGAUCUGAUC Significant hits in AS region Paz I. et al., Nucleic Acids Res. 2010
  • 11. Regulation on AS events changes according to event types Cassette exon Alternative 5’ splice site Alternative 3’ splice site
  • 12. How do we wire the network? 1 2 3 A X X 3 2 X A 1
  • 13. Our network behaves like a regulatory network Highly clustered Sparse Sparseness=0.046 p-value =1.09e-61 Outdegree Frequency Power law outdegree distribution Outdegree
  • 14. Cross-regulation vs. Cross-talk regulation TF TF SF K cross-talk regulation (regulation across functional group) cross-regulation (regulation within the functional group)
  • 15.
  • 16. Transcription regulation is highest among TFs Transcription Regulation pv= 1.2E-3 pv = 3.8E-7 Number of inedges 3654 SF TF Kinase pv < 0.05
  • 17.
  • 18. Splicing regulation is highest among SFs Splicing Regulation pv= 2.7E-3 Number of inedges pv= 2.3E-4 97 SF TF Kinase P-value < 2.2e-16
  • 19. Similar gene length, number of exons and number of AS events Gene length Number of exons per factor 20000 30000 40000 30 Number of exons per factor 25 Gene length (nt) 20 15 10000 10 5 0 0 SF TF Kinase SF TF Kinase Frequency from target group SFs Number of alternative TFs splicing events per factor Kinases Number of alternative splicing events
  • 20. Random networks showed insignificant inedges density Splicing regulation Transcription regulation Inedge average Inedge average SF TF Kinase SF TF Kinase
  • 21. Experimental binding data supports splicing regulation trend RNA QKI splicing Transcription activity PTB FOX2 SF2/ASF 0 2 4 6 8 10 12 -Log10(pvalue)
  • 22. Cross regulation vs. cross-talk regulation TF TF SF K
  • 23. Same trend, different organisms Transcription regulation Human Drosophila Yeast pv= 1.2e-3 pv= 9.2e-10 SF TF SF TF SF TF Marbach et al. Genome Res. 2011 Pelechano et al., PLoS Genetics 2009
  • 24. Same trend, different organisms Splicing regulation Guy Plaut Human Drosophila Number of inedges pv= 2.3e-4 Number of inedges pv= 1.7e-11 SF TF SF TF
  • 25. Screening using expressionshow for Tissue specific networks data the muscleregulatory behavior same and heart tissues
  • 26. Tissue specific networks show the same regulatory behavior Splicing Regulation Transcription Regulation Number of inedges Number of inedges SF TF SF TF SF TF SF TF 40 TFs 11 SFs 33 TFs 14 SFs
  • 27. The splicing-transcription co-regulatory network SF 20 Splicing Factors Transcription SF (gene/protein) regulation TF SF TF 90 Transcription Factors (gene/protein) Alternative Splicing regulation K K 147 Kinases (gene only)
  • 28. is highest among Kinases Phosphorylation Regulation Fraction of protein with predicted phosphorylation site Predrag Radivojac SF TF Kinase
  • 29. Cross-regulation vs. cross-talk regulation TF TF SF K
  • 30. The role of cross talk between splicing and transcription regulation SRP20 SRP55 PAX 6 SC35 SF2ASF 9G8
  • 31. Regulatory proteins tend to be highly regulated by the specific regulation they carry out. TF TF SF K
  • 32. Thanks! Technion Yael Mandel Gutfreund Guy Plaut Inbal Paz Iris Dror Martin Akerman And all lab members Indiana University Predrag Radivojac And you for your attention!

Notas do Editor

  1. Gene expression pathway, many regulatory points on the way to create a protein from DNAWe focued on AS and transcription
  2. We take experimentally verifies SF motifsAS events – 2 sources
  3. Weak but necesery