SlideShare uma empresa Scribd logo
1 de 15
Baixar para ler offline
O uso da plataforma HPC na
descoberta de doenças genéticas
David Santos Marco Antonio. PhD
Profa. Maria Rita Passos Bueno
Laboratório de Genética do Desenvolvimento Humano
Departamento de Genética e Biologia Evolutiva
Instituto de Biociências - USP
Finding the variability that could
explain genetic disorders.
DNA : Chromosome : Genes
DNA: A T C G
Chromosomes:
1 – 22
X and/or Y
Mitochondrial
DNA : Chromosome : Genes
http://en.wikipedia.org/wiki/Human_genome
DNA : Chromosome : Genes
Human genetic variation in populations
• Genes on the same order
• Mapped using reference genome: hg19, GRCh38.
• Variability among relatives/populations.
• Susceptibility to diseases.
• Improvements.
Falar sobre populações
1000Genomes
Human genetic variation in populations
Haplogroups YMitochondrial DNA
Disorder Mutation Chromosome
22q11.2 deletion syndrome D 22q
Angelman syndrome DCP 15
Canavan disease 17p
Charcot–Marie–Tooth disease
Color blindness P X
Cri du chat D 5
Cystic fibrosis P 7q
Down syndrome C 21
Duchenne muscular dystrophy D Xp
Haemochromatosis P 6
Haemophilia P X
Klinefelter syndrome C X
Neurofibromatosis 17q/22q/?
Phenylketonuria P 12q
Polycystic kidney disease P 16 (PKD1) or 4 (PKD2)
Prader–Willi syndrome DC 15
Sickle-cell disease P 11p
Tay–Sachs disease P 15
Turner syndrome C X
 P – Point mutation: InDel.
 D – Deletion of gene.
 C – Whole chromosome
extra/missing.
 T – Nucleotide repeat disorders.
Human Genetic Diseases
Genomic Sequencing
• Terabytes of data/sequencing.
• Storage.
• Processing.
• Lots of RAM.
Ben Moore
Genomic Sequencing
Data Processing
STEPS
Alignment
Quality
Control
Quality
Control
Sequencing
Reference
Sorting
Remove
Errors
Realignment
Recalibration
Data Processing
STEPS
Alignment
Quality
Control
Quality
Control
Sequencing
Reference
Sorting
Remove
Errors
Realignment
RecalibrationVariant Calling
Data Processing
STEPS
Variant Calling
dbSNP
SIFT
PolyPhen OMIM
exac03
6500
Exomes1000
Genomes
Clinical
Relevant Data
High Computational Cost
• Storage.
• RAM.
• CPU.
• Reprocessing.
@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
Fastq format
Research
• Authism
• Cranio-fascial development
• Richieri-Costa
• Down
Diseases Models
• Human
• Zebra fish
• Drosophila
• Microbiome
Acknowledgements
• LCCA
• Guys in LCCA
• Guys in LCCA
• Profa. Maria Rita Passos Bueno
• Laboratório de Genética do Desenvolvimento Humano
• Instituto de Biociências.
• USP

Mais conteúdo relacionado

Mais procurados

Bio263 Who is our Closest Relative
Bio263 Who is  our Closest RelativeBio263 Who is  our Closest Relative
Bio263 Who is our Closest RelativeMark Pallen
 
oncolytic herpes simplex virus
oncolytic herpes simplex virusoncolytic herpes simplex virus
oncolytic herpes simplex virusCandySwift_NY
 
Antiviral Hammerhead ribozymes are ef
Antiviral Hammerhead ribozymes are efAntiviral Hammerhead ribozymes are ef
Antiviral Hammerhead ribozymes are efSiddhesh Sapre
 
Repeated detection of frog virus 3 during aquaculture health surveys
Repeated detection of frog virus 3 during aquaculture health surveysRepeated detection of frog virus 3 during aquaculture health surveys
Repeated detection of frog virus 3 during aquaculture health surveysmgray11
 
Doddinobelprizepresentation
DoddinobelprizepresentationDoddinobelprizepresentation
Doddinobelprizepresentationsdoddi11
 
Phytothreats: WP4 overview
Phytothreats: WP4 overviewPhytothreats: WP4 overview
Phytothreats: WP4 overviewForest Research
 
Extended Letermovir Prophylactic Therapy as CMV Prophylaxis in Graft-versus-H...
Extended Letermovir Prophylactic Therapy as CMV Prophylaxis in Graft-versus-H...Extended Letermovir Prophylactic Therapy as CMV Prophylaxis in Graft-versus-H...
Extended Letermovir Prophylactic Therapy as CMV Prophylaxis in Graft-versus-H...Vijay Elipay
 
Carcinogenesis , invasion & metastasis
Carcinogenesis , invasion & metastasis Carcinogenesis , invasion & metastasis
Carcinogenesis , invasion & metastasis Charith Kumara
 
Oncolytic Virotherapy
Oncolytic VirotherapyOncolytic Virotherapy
Oncolytic VirotherapyStella Evelyn
 
Presentacio¦ün nicole 2
Presentacio¦ün nicole 2Presentacio¦ün nicole 2
Presentacio¦ün nicole 2Nicole Rivera
 
The Origin of Ashkenazi Levites
The Origin of Ashkenazi Levites The Origin of Ashkenazi Levites
The Origin of Ashkenazi Levites Family Tree DNA
 
Pistoia Alliance US Conference 2015 - 1.5.4 New data - Nikolaus Schultz
Pistoia Alliance US Conference 2015 - 1.5.4 New data - Nikolaus SchultzPistoia Alliance US Conference 2015 - 1.5.4 New data - Nikolaus Schultz
Pistoia Alliance US Conference 2015 - 1.5.4 New data - Nikolaus SchultzPistoia Alliance
 
Bio263 Lecture 2: Becoming human
Bio263 Lecture 2: Becoming humanBio263 Lecture 2: Becoming human
Bio263 Lecture 2: Becoming humanMark Pallen
 
NetBioSIG2014-Talk by Yu Xia
NetBioSIG2014-Talk by Yu XiaNetBioSIG2014-Talk by Yu Xia
NetBioSIG2014-Talk by Yu XiaAlexander Pico
 
Hum evolgen2011 scatterlingsofafrica
Hum evolgen2011 scatterlingsofafricaHum evolgen2011 scatterlingsofafrica
Hum evolgen2011 scatterlingsofafricaMark Pallen
 

Mais procurados (20)

Htlv 1
Htlv 1Htlv 1
Htlv 1
 
Bio263 Who is our Closest Relative
Bio263 Who is  our Closest RelativeBio263 Who is  our Closest Relative
Bio263 Who is our Closest Relative
 
oncolytic herpes simplex virus
oncolytic herpes simplex virusoncolytic herpes simplex virus
oncolytic herpes simplex virus
 
Antiviral Hammerhead ribozymes are ef
Antiviral Hammerhead ribozymes are efAntiviral Hammerhead ribozymes are ef
Antiviral Hammerhead ribozymes are ef
 
Repeated detection of frog virus 3 during aquaculture health surveys
Repeated detection of frog virus 3 during aquaculture health surveysRepeated detection of frog virus 3 during aquaculture health surveys
Repeated detection of frog virus 3 during aquaculture health surveys
 
Doddinobelprizepresentation
DoddinobelprizepresentationDoddinobelprizepresentation
Doddinobelprizepresentation
 
Artigo - Bárbara
Artigo - BárbaraArtigo - Bárbara
Artigo - Bárbara
 
Phytothreats: WP4 overview
Phytothreats: WP4 overviewPhytothreats: WP4 overview
Phytothreats: WP4 overview
 
Extended Letermovir Prophylactic Therapy as CMV Prophylaxis in Graft-versus-H...
Extended Letermovir Prophylactic Therapy as CMV Prophylaxis in Graft-versus-H...Extended Letermovir Prophylactic Therapy as CMV Prophylaxis in Graft-versus-H...
Extended Letermovir Prophylactic Therapy as CMV Prophylaxis in Graft-versus-H...
 
Carcinogenesis , invasion & metastasis
Carcinogenesis , invasion & metastasis Carcinogenesis , invasion & metastasis
Carcinogenesis , invasion & metastasis
 
Oncolytic Virotherapy
Oncolytic VirotherapyOncolytic Virotherapy
Oncolytic Virotherapy
 
Viruses and cancer
Viruses and cancerViruses and cancer
Viruses and cancer
 
GKA deel 1 college 15
GKA deel 1 college 15GKA deel 1 college 15
GKA deel 1 college 15
 
Presentacio¦ün nicole 2
Presentacio¦ün nicole 2Presentacio¦ün nicole 2
Presentacio¦ün nicole 2
 
The Origin of Ashkenazi Levites
The Origin of Ashkenazi Levites The Origin of Ashkenazi Levites
The Origin of Ashkenazi Levites
 
Pistoia Alliance US Conference 2015 - 1.5.4 New data - Nikolaus Schultz
Pistoia Alliance US Conference 2015 - 1.5.4 New data - Nikolaus SchultzPistoia Alliance US Conference 2015 - 1.5.4 New data - Nikolaus Schultz
Pistoia Alliance US Conference 2015 - 1.5.4 New data - Nikolaus Schultz
 
Retroviruses and HIV
Retroviruses and HIVRetroviruses and HIV
Retroviruses and HIV
 
Bio263 Lecture 2: Becoming human
Bio263 Lecture 2: Becoming humanBio263 Lecture 2: Becoming human
Bio263 Lecture 2: Becoming human
 
NetBioSIG2014-Talk by Yu Xia
NetBioSIG2014-Talk by Yu XiaNetBioSIG2014-Talk by Yu Xia
NetBioSIG2014-Talk by Yu Xia
 
Hum evolgen2011 scatterlingsofafrica
Hum evolgen2011 scatterlingsofafricaHum evolgen2011 scatterlingsofafrica
Hum evolgen2011 scatterlingsofafrica
 

Destaque

"The BG collaboration, Past, Present, Future. The new available resources". P...
"The BG collaboration, Past, Present, Future. The new available resources". P..."The BG collaboration, Past, Present, Future. The new available resources". P...
"The BG collaboration, Past, Present, Future. The new available resources". P...lccausp
 
“Interação entre peptídeos virais de fusão com membranas modelo”. Danilo Oliv...
“Interação entre peptídeos virais de fusão com membranas modelo”. Danilo Oliv...“Interação entre peptídeos virais de fusão com membranas modelo”. Danilo Oliv...
“Interação entre peptídeos virais de fusão com membranas modelo”. Danilo Oliv...lccausp
 
“Modelagem Computacional Multiescala aplicada a Ciência dos Materiais”. Rober...
“Modelagem Computacional Multiescala aplicada a Ciência dos Materiais”. Rober...“Modelagem Computacional Multiescala aplicada a Ciência dos Materiais”. Rober...
“Modelagem Computacional Multiescala aplicada a Ciência dos Materiais”. Rober...lccausp
 
“Simulations of Lipidic Bilayers”. Prof. Dr. Kaline Coutinho – IF/USP.
“Simulations of Lipidic Bilayers”. Prof. Dr. Kaline Coutinho – IF/USP.“Simulations of Lipidic Bilayers”. Prof. Dr. Kaline Coutinho – IF/USP.
“Simulations of Lipidic Bilayers”. Prof. Dr. Kaline Coutinho – IF/USP.lccausp
 
"The topological instability model for metallic glass formation: MD assessmen...
"The topological instability model for metallic glass formation: MD assessmen..."The topological instability model for metallic glass formation: MD assessmen...
"The topological instability model for metallic glass formation: MD assessmen...lccausp
 
“Quantum Theory Calculations of Supported and Unsupported Transition-Metal Cl...
“Quantum Theory Calculations of Supported and Unsupported Transition-Metal Cl...“Quantum Theory Calculations of Supported and Unsupported Transition-Metal Cl...
“Quantum Theory Calculations of Supported and Unsupported Transition-Metal Cl...lccausp
 
"Aula sobre Paralelização Automática". Rogério A. Gonçalves e Prof. Dr. Alfre...
"Aula sobre Paralelização Automática". Rogério A. Gonçalves e Prof. Dr. Alfre..."Aula sobre Paralelização Automática". Rogério A. Gonçalves e Prof. Dr. Alfre...
"Aula sobre Paralelização Automática". Rogério A. Gonçalves e Prof. Dr. Alfre...lccausp
 
Ud.13. genética mendeliana nuevo
Ud.13. genética mendeliana nuevoUd.13. genética mendeliana nuevo
Ud.13. genética mendeliana nuevobiologiahipatia
 
“Programação paralela híbrida com MPI e OpenMP – uma abordagem prática”. Edua...
“Programação paralela híbrida com MPI e OpenMP – uma abordagem prática”. Edua...“Programação paralela híbrida com MPI e OpenMP – uma abordagem prática”. Edua...
“Programação paralela híbrida com MPI e OpenMP – uma abordagem prática”. Edua...lccausp
 

Destaque (9)

"The BG collaboration, Past, Present, Future. The new available resources". P...
"The BG collaboration, Past, Present, Future. The new available resources". P..."The BG collaboration, Past, Present, Future. The new available resources". P...
"The BG collaboration, Past, Present, Future. The new available resources". P...
 
“Interação entre peptídeos virais de fusão com membranas modelo”. Danilo Oliv...
“Interação entre peptídeos virais de fusão com membranas modelo”. Danilo Oliv...“Interação entre peptídeos virais de fusão com membranas modelo”. Danilo Oliv...
“Interação entre peptídeos virais de fusão com membranas modelo”. Danilo Oliv...
 
“Modelagem Computacional Multiescala aplicada a Ciência dos Materiais”. Rober...
“Modelagem Computacional Multiescala aplicada a Ciência dos Materiais”. Rober...“Modelagem Computacional Multiescala aplicada a Ciência dos Materiais”. Rober...
“Modelagem Computacional Multiescala aplicada a Ciência dos Materiais”. Rober...
 
“Simulations of Lipidic Bilayers”. Prof. Dr. Kaline Coutinho – IF/USP.
“Simulations of Lipidic Bilayers”. Prof. Dr. Kaline Coutinho – IF/USP.“Simulations of Lipidic Bilayers”. Prof. Dr. Kaline Coutinho – IF/USP.
“Simulations of Lipidic Bilayers”. Prof. Dr. Kaline Coutinho – IF/USP.
 
"The topological instability model for metallic glass formation: MD assessmen...
"The topological instability model for metallic glass formation: MD assessmen..."The topological instability model for metallic glass formation: MD assessmen...
"The topological instability model for metallic glass formation: MD assessmen...
 
“Quantum Theory Calculations of Supported and Unsupported Transition-Metal Cl...
“Quantum Theory Calculations of Supported and Unsupported Transition-Metal Cl...“Quantum Theory Calculations of Supported and Unsupported Transition-Metal Cl...
“Quantum Theory Calculations of Supported and Unsupported Transition-Metal Cl...
 
"Aula sobre Paralelização Automática". Rogério A. Gonçalves e Prof. Dr. Alfre...
"Aula sobre Paralelização Automática". Rogério A. Gonçalves e Prof. Dr. Alfre..."Aula sobre Paralelização Automática". Rogério A. Gonçalves e Prof. Dr. Alfre...
"Aula sobre Paralelização Automática". Rogério A. Gonçalves e Prof. Dr. Alfre...
 
Ud.13. genética mendeliana nuevo
Ud.13. genética mendeliana nuevoUd.13. genética mendeliana nuevo
Ud.13. genética mendeliana nuevo
 
“Programação paralela híbrida com MPI e OpenMP – uma abordagem prática”. Edua...
“Programação paralela híbrida com MPI e OpenMP – uma abordagem prática”. Edua...“Programação paralela híbrida com MPI e OpenMP – uma abordagem prática”. Edua...
“Programação paralela híbrida com MPI e OpenMP – uma abordagem prática”. Edua...
 

Semelhante a Finding genetic disorders using HPC platforms

Abraham B. Korol, Lecture presentation
Abraham B. Korol, Lecture presentationAbraham B. Korol, Lecture presentation
Abraham B. Korol, Lecture presentationMoshe Kenigshtein
 
GA4GH Monarch Driver Project Introduction
GA4GH Monarch Driver Project IntroductionGA4GH Monarch Driver Project Introduction
GA4GH Monarch Driver Project Introductionmhaendel
 
Voskarides 2nd aging symposium-unic 240514
Voskarides 2nd aging symposium-unic 240514Voskarides 2nd aging symposium-unic 240514
Voskarides 2nd aging symposium-unic 240514Marios Kyriazis
 
Comparitive genomic hybridisation
Comparitive genomic hybridisationComparitive genomic hybridisation
Comparitive genomic hybridisationnamrathrs87
 
Computing on Phenotypes AMP 2015
Computing on Phenotypes AMP 2015Computing on Phenotypes AMP 2015
Computing on Phenotypes AMP 2015Chris Mungall
 
Addressing standardization challenges through integrated approaches in biomed...
Addressing standardization challenges through integrated approaches in biomed...Addressing standardization challenges through integrated approaches in biomed...
Addressing standardization challenges through integrated approaches in biomed...Lynn Schriml
 
Identify Disease-Associated Genetic Variants Via 3D Genomics Structure and Re...
Identify Disease-Associated Genetic Variants Via 3D Genomics Structure and Re...Identify Disease-Associated Genetic Variants Via 3D Genomics Structure and Re...
Identify Disease-Associated Genetic Variants Via 3D Genomics Structure and Re...Databricks
 
Gabbay Award Lecture
Gabbay Award LectureGabbay Award Lecture
Gabbay Award Lectureahandyside
 
Human genetic technologies
Human genetic technologiesHuman genetic technologies
Human genetic technologiesAparna Chaudhary
 
Dan Geschwind, MD, PhD: Advances in Genetics 2016
Dan Geschwind, MD, PhD: Advances in Genetics 2016Dan Geschwind, MD, PhD: Advances in Genetics 2016
Dan Geschwind, MD, PhD: Advances in Genetics 2016Semel Admin
 
POSTGENETICS MEDICINE
POSTGENETICS MEDICINEPOSTGENETICS MEDICINE
POSTGENETICS MEDICINEinemet
 
DNA Methylation & C Value.pdf
DNA Methylation & C Value.pdfDNA Methylation & C Value.pdf
DNA Methylation & C Value.pdfsoniaangeline
 
TLSC Biotech 101 Noc 2010 (Moore)
TLSC Biotech 101 Noc 2010 (Moore)TLSC Biotech 101 Noc 2010 (Moore)
TLSC Biotech 101 Noc 2010 (Moore)jmoore89
 
Describe in your own words the benefits, but also the problems of ha.pdf
Describe in your own words the benefits, but also the problems of ha.pdfDescribe in your own words the benefits, but also the problems of ha.pdf
Describe in your own words the benefits, but also the problems of ha.pdfarenamobiles123
 

Semelhante a Finding genetic disorders using HPC platforms (20)

Genetics
GeneticsGenetics
Genetics
 
Abraham B. Korol, Lecture presentation
Abraham B. Korol, Lecture presentationAbraham B. Korol, Lecture presentation
Abraham B. Korol, Lecture presentation
 
Human genome project 1
Human genome project 1Human genome project 1
Human genome project 1
 
GA4GH Monarch Driver Project Introduction
GA4GH Monarch Driver Project IntroductionGA4GH Monarch Driver Project Introduction
GA4GH Monarch Driver Project Introduction
 
Voskarides 2nd aging symposium-unic 240514
Voskarides 2nd aging symposium-unic 240514Voskarides 2nd aging symposium-unic 240514
Voskarides 2nd aging symposium-unic 240514
 
Biomol
BiomolBiomol
Biomol
 
Biomol
BiomolBiomol
Biomol
 
Biomol
BiomolBiomol
Biomol
 
Comparitive genomic hybridisation
Comparitive genomic hybridisationComparitive genomic hybridisation
Comparitive genomic hybridisation
 
Computing on Phenotypes AMP 2015
Computing on Phenotypes AMP 2015Computing on Phenotypes AMP 2015
Computing on Phenotypes AMP 2015
 
Addressing standardization challenges through integrated approaches in biomed...
Addressing standardization challenges through integrated approaches in biomed...Addressing standardization challenges through integrated approaches in biomed...
Addressing standardization challenges through integrated approaches in biomed...
 
Identify Disease-Associated Genetic Variants Via 3D Genomics Structure and Re...
Identify Disease-Associated Genetic Variants Via 3D Genomics Structure and Re...Identify Disease-Associated Genetic Variants Via 3D Genomics Structure and Re...
Identify Disease-Associated Genetic Variants Via 3D Genomics Structure and Re...
 
Gabbay Award Lecture
Gabbay Award LectureGabbay Award Lecture
Gabbay Award Lecture
 
Human genetic technologies
Human genetic technologiesHuman genetic technologies
Human genetic technologies
 
Dan Geschwind, MD, PhD: Advances in Genetics 2016
Dan Geschwind, MD, PhD: Advances in Genetics 2016Dan Geschwind, MD, PhD: Advances in Genetics 2016
Dan Geschwind, MD, PhD: Advances in Genetics 2016
 
POSTGENETICS MEDICINE
POSTGENETICS MEDICINEPOSTGENETICS MEDICINE
POSTGENETICS MEDICINE
 
DNA Methylation & C Value.pdf
DNA Methylation & C Value.pdfDNA Methylation & C Value.pdf
DNA Methylation & C Value.pdf
 
TLSC Biotech 101 Noc 2010 (Moore)
TLSC Biotech 101 Noc 2010 (Moore)TLSC Biotech 101 Noc 2010 (Moore)
TLSC Biotech 101 Noc 2010 (Moore)
 
Describe in your own words the benefits, but also the problems of ha.pdf
Describe in your own words the benefits, but also the problems of ha.pdfDescribe in your own words the benefits, but also the problems of ha.pdf
Describe in your own words the benefits, but also the problems of ha.pdf
 
Genes
GenesGenes
Genes
 

Último

Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...aartirawatdelhi
 
Call Girls Ooty Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ooty Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Ooty Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ooty Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night EnjoyCall Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoybabeytanya
 
Call Girls Siliguri Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Siliguri Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Low Rate Call Girls Kochi Anika 8250192130 Independent Escort Service Kochi
Low Rate Call Girls Kochi Anika 8250192130 Independent Escort Service KochiLow Rate Call Girls Kochi Anika 8250192130 Independent Escort Service Kochi
Low Rate Call Girls Kochi Anika 8250192130 Independent Escort Service KochiSuhani Kapoor
 
VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...
VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...
VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...Neha Kaur
 
Bangalore Call Girls Nelamangala Number 7001035870 Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 7001035870  Meetin With Bangalore Esc...Bangalore Call Girls Nelamangala Number 7001035870  Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 7001035870 Meetin With Bangalore Esc...narwatsonia7
 
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort ServicePremium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Servicevidya singh
 
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...hotbabesbook
 
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...Arohi Goyal
 
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore EscortsCall Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escortsvidya singh
 
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on DeliveryCall Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Deliverynehamumbai
 
Call Girl Number in Panvel Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Panvel Mumbai📲 9833363713 💞 Full Night EnjoyCall Girl Number in Panvel Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Panvel Mumbai📲 9833363713 💞 Full Night Enjoybabeytanya
 
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...Taniya Sharma
 
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls JaipurCall Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipurparulsinha
 

Último (20)

Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
Night 7k to 12k Navi Mumbai Call Girl Photo 👉 BOOK NOW 9833363713 👈 ♀️ night ...
 
Call Girls Ooty Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ooty Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Ooty Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ooty Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night EnjoyCall Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Vashi Mumbai📲 9833363713 💞 Full Night Enjoy
 
Call Girls Siliguri Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Siliguri Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Siliguri Just Call 9907093804 Top Class Call Girl Service Available
 
Low Rate Call Girls Kochi Anika 8250192130 Independent Escort Service Kochi
Low Rate Call Girls Kochi Anika 8250192130 Independent Escort Service KochiLow Rate Call Girls Kochi Anika 8250192130 Independent Escort Service Kochi
Low Rate Call Girls Kochi Anika 8250192130 Independent Escort Service Kochi
 
VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...
VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...
VIP Russian Call Girls in Varanasi Samaira 8250192130 Independent Escort Serv...
 
Bangalore Call Girls Nelamangala Number 7001035870 Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 7001035870  Meetin With Bangalore Esc...Bangalore Call Girls Nelamangala Number 7001035870  Meetin With Bangalore Esc...
Bangalore Call Girls Nelamangala Number 7001035870 Meetin With Bangalore Esc...
 
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort ServicePremium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
Premium Call Girls Cottonpet Whatsapp 7001035870 Independent Escort Service
 
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Ludhiana Just Call 9907093804 Top Class Call Girl Service Available
 
Escort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCR
Escort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCREscort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCR
Escort Service Call Girls In Sarita Vihar,, 99530°56974 Delhi NCR
 
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 9907093804 Top Class Call Girl Service Available
 
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Cuttack Just Call 9907093804 Top Class Call Girl Service Available
 
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
Night 7k to 12k Chennai City Center Call Girls 👉👉 7427069034⭐⭐ 100% Genuine E...
 
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
All Time Service Available Call Girls Marine Drive 📳 9820252231 For 18+ VIP C...
 
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore EscortsCall Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
Call Girls Horamavu WhatsApp Number 7001035870 Meeting With Bangalore Escorts
 
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on DeliveryCall Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
Call Girls Colaba Mumbai ❤️ 9920874524 👈 Cash on Delivery
 
Call Girl Number in Panvel Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Panvel Mumbai📲 9833363713 💞 Full Night EnjoyCall Girl Number in Panvel Mumbai📲 9833363713 💞 Full Night Enjoy
Call Girl Number in Panvel Mumbai📲 9833363713 💞 Full Night Enjoy
 
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
 
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
 
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls JaipurCall Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
Call Girls Service Jaipur Grishma WhatsApp ❤8445551418 VIP Call Girls Jaipur
 

Finding genetic disorders using HPC platforms