O slideshow foi denunciado.
Utilizamos seu perfil e dados de atividades no LinkedIn para personalizar e exibir anúncios mais relevantes. Altere suas preferências de anúncios quando desejar.
O uso da plataforma HPC na
descoberta de doenças genéticas
David Santos Marco Antonio. PhD
Profa. Maria Rita Passos Bueno
...
DNA : Chromosome : Genes
DNA: A T C G
Chromosomes:
1 – 22
X and/or Y
Mitochondrial
DNA : Chromosome : Genes
http://en.wikipedia.org/wiki/Human_genome
DNA : Chromosome : Genes
Human genetic variation in populations
• Genes on the same order
• Mapped using reference genome: hg19, GRCh38.
• Variabil...
Human genetic variation in populations
Haplogroups YMitochondrial DNA
Disorder Mutation Chromosome
22q11.2 deletion syndrome D 22q
Angelman syndrome DCP 15
Canavan disease 17p
Charcot–Marie–To...
Genomic Sequencing
• Terabytes of data/sequencing.
• Storage.
• Processing.
• Lots of RAM.
Ben Moore
Genomic Sequencing
Data Processing
STEPS
Alignment
Quality
Control
Quality
Control
Sequencing
Reference
Sorting
Remove
Errors
Realignment
Rec...
Data Processing
STEPS
Alignment
Quality
Control
Quality
Control
Sequencing
Reference
Sorting
Remove
Errors
Realignment
Rec...
Data Processing
STEPS
Variant Calling
dbSNP
SIFT
PolyPhen OMIM
exac03
6500
Exomes1000
Genomes
Clinical
Relevant Data
High Computational Cost
• Storage.
• RAM.
• CPU.
• Reprocessing.
@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCA...
Research
• Authism
• Cranio-fascial development
• Richieri-Costa
• Down
Diseases Models
• Human
• Zebra fish
• Drosophila
...
Acknowledgements
• LCCA
• Guys in LCCA
• Guys in LCCA
• Profa. Maria Rita Passos Bueno
• Laboratório de Genética do Desenv...
Próximos SlideShares
Carregando em…5
×

"O uso da plataforma HPC na descoberta de doenças genéticas" . David Santos Marco Antonio - IB/USP.

435 visualizações

Publicada em

"O uso da plataforma HPC na descoberta de doenças genéticas", presented on http://3whpc.lcca.usp.br

Publicada em: Saúde e medicina
  • DOWNLOAD THE BOOK INTO AVAILABLE FORMAT (New Update) ......................................................................................................................... ......................................................................................................................... Download Full PDF EBOOK here { https://urlzs.com/UABbn } ......................................................................................................................... Download Full EPUB Ebook here { https://urlzs.com/UABbn } ......................................................................................................................... Download Full doc Ebook here { https://urlzs.com/UABbn } ......................................................................................................................... Download PDF EBOOK here { https://urlzs.com/UABbn } ......................................................................................................................... Download EPUB Ebook here { https://urlzs.com/UABbn } ......................................................................................................................... Download doc Ebook here { https://urlzs.com/UABbn } ......................................................................................................................... ......................................................................................................................... ................................................................................................................................... eBook is an electronic version of a traditional print book THE can be read by using a personal computer or by using an eBook reader. (An eBook reader can be a software application for use on a computer such as Microsoft's free Reader application, or a book-sized computer THE is used solely as a reading device such as Nuvomedia's Rocket eBook.) Users can purchase an eBook on diskette or CD, but the most popular method of getting an eBook is to purchase a downloadable file of the eBook (or other reading material) from a Web site (such as Barnes and Noble) to be read from the user's computer or reading device. Generally, an eBook can be downloaded in five minutes or less ......................................................................................................................... .............. Browse by Genre Available eBOOK .............................................................................................................................. Art, Biography, Business, Chick Lit, Children's, Christian, Classics, Comics, Contemporary, CookBOOK, Manga, Memoir, Music, Mystery, Non Fiction, Paranormal, Philosophy, Poetry, Psychology, Religion, Romance, Science, Science Fiction, Self Help, Suspense, Spirituality, Sports, Thriller, Travel, Young Adult, Crime, EBOOK, Fantasy, Fiction, Graphic Novels, Historical Fiction, History, Horror, Humor And Comedy, ......................................................................................................................... ......................................................................................................................... .....BEST SELLER FOR EBOOK RECOMMEND............................................................. ......................................................................................................................... Blowout: Corrupted Democracy, Rogue State Russia, and the Richest, Most Destructive Industry on Earth,-- The Ride of a Lifetime: Lessons Learned from 15 Years as CEO of the Walt Disney Company,-- Call Sign Chaos: Learning to Lead,-- StrengthsFinder 2.0,-- Stillness Is the Key,-- She Said: Breaking the Sexual Harassment Story THE Helped Ignite a Movement,-- Atomic Habits: An Easy & Proven Way to Build Good Habits & Break Bad Ones,-- Everything Is Figureoutable,-- What It Takes: Lessons in the Pursuit of Excellence,-- Rich Dad Poor Dad: What the Rich Teach Their Kids About Money THE the Poor and Middle Class Do Not!,-- The Total Money Makeover: Classic Edition: A Proven Plan for Financial Fitness,-- Shut Up and Listen!: Hard Business Truths THE Will Help You Succeed, ......................................................................................................................... .........................................................................................................................
       Responder 
    Tem certeza que deseja  Sim  Não
    Insira sua mensagem aqui
  • Seja a primeira pessoa a gostar disto

"O uso da plataforma HPC na descoberta de doenças genéticas" . David Santos Marco Antonio - IB/USP.

  1. 1. O uso da plataforma HPC na descoberta de doenças genéticas David Santos Marco Antonio. PhD Profa. Maria Rita Passos Bueno Laboratório de Genética do Desenvolvimento Humano Departamento de Genética e Biologia Evolutiva Instituto de Biociências - USP Finding the variability that could explain genetic disorders.
  2. 2. DNA : Chromosome : Genes DNA: A T C G Chromosomes: 1 – 22 X and/or Y Mitochondrial
  3. 3. DNA : Chromosome : Genes
  4. 4. http://en.wikipedia.org/wiki/Human_genome DNA : Chromosome : Genes
  5. 5. Human genetic variation in populations • Genes on the same order • Mapped using reference genome: hg19, GRCh38. • Variability among relatives/populations. • Susceptibility to diseases. • Improvements. Falar sobre populações 1000Genomes
  6. 6. Human genetic variation in populations Haplogroups YMitochondrial DNA
  7. 7. Disorder Mutation Chromosome 22q11.2 deletion syndrome D 22q Angelman syndrome DCP 15 Canavan disease 17p Charcot–Marie–Tooth disease Color blindness P X Cri du chat D 5 Cystic fibrosis P 7q Down syndrome C 21 Duchenne muscular dystrophy D Xp Haemochromatosis P 6 Haemophilia P X Klinefelter syndrome C X Neurofibromatosis 17q/22q/? Phenylketonuria P 12q Polycystic kidney disease P 16 (PKD1) or 4 (PKD2) Prader–Willi syndrome DC 15 Sickle-cell disease P 11p Tay–Sachs disease P 15 Turner syndrome C X  P – Point mutation: InDel.  D – Deletion of gene.  C – Whole chromosome extra/missing.  T – Nucleotide repeat disorders. Human Genetic Diseases
  8. 8. Genomic Sequencing • Terabytes of data/sequencing. • Storage. • Processing. • Lots of RAM. Ben Moore
  9. 9. Genomic Sequencing
  10. 10. Data Processing STEPS Alignment Quality Control Quality Control Sequencing Reference Sorting Remove Errors Realignment Recalibration
  11. 11. Data Processing STEPS Alignment Quality Control Quality Control Sequencing Reference Sorting Remove Errors Realignment RecalibrationVariant Calling
  12. 12. Data Processing STEPS Variant Calling dbSNP SIFT PolyPhen OMIM exac03 6500 Exomes1000 Genomes Clinical Relevant Data
  13. 13. High Computational Cost • Storage. • RAM. • CPU. • Reprocessing. @SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 Fastq format
  14. 14. Research • Authism • Cranio-fascial development • Richieri-Costa • Down Diseases Models • Human • Zebra fish • Drosophila • Microbiome
  15. 15. Acknowledgements • LCCA • Guys in LCCA • Guys in LCCA • Profa. Maria Rita Passos Bueno • Laboratório de Genética do Desenvolvimento Humano • Instituto de Biociências. • USP

×