Bioinformática e computaçãocientífica aplicadas à pesquisaagropecuáriaWagner Arbexarbex@cnpgl.embrapa.brSeminários da Comp...
A Embrapa• Empresa Brasileira de Pesquisa Agropecuária:• ~ 45 centros serviços e de pesquisa deprodutos, temas básicos e e...
O que é computação científica?• Algumas vezes é chamada de ciência computacional enão deve ser confundida com ciência da c...
• É comum...• ... basear-se em software livre;• ... exigir recursos de computação de alto desempenho;• ... não apresentar ...
O que é bioinformática?
O que é bioinformática?BiologiacomputacionalBioinformáticaProteomaGenoma
• Bioinformática:• Surgiu da necessidade de identificar, tratar, organizar,armazenar, pesquisar e recuperar dados genômicos...
• Elizabeth II foi coroada rainha da Inglaterra... econtinua sendo até hoje!Era uma vez, em 1953...
• Foi publicado o primeirolivro com uma novel deBond... James Bond...Era uma vez, em 1953...
• Já nas bancas a primeiraPlayboy!Era uma vez, em 1953...
• James Watson e FrancisCrick descobrem a molé-cula de DNA, o ácidodesoxirribonucleico;Era uma vez, em 1953...
• Em 1958, Francis Crick descreve o dogma centralda biologia molecular;O que são dados genômicos?
• Em 1975, FrederickSanger desenvolve osfundamentos para osmétodos de sequencia-mento automático;O que são dados genômicos?
Sequenciamento “a mil”
• Em 2000:• Genoma da Xylella fastidiosa, abactéria causadora da “pragado amarelinho”;• Primeiro trabalho brasileiro, em13...
• Em 2000, o anúncio oficial da primeira versão dogenoma humano, em 26/7/2000;Projeto Genoma Humano
• PGH – 1990-2001/2003:• Projeto GenomaHumano;• Desenvolvido por umconsórcio entre empresasprivadas e públicas;• Francis C...
• O PGH mostrou que o genoma humano tem:• Cerca de de nucleotídeos;• Entre 20.000 e 25.000 genes – “mas, só ...
seq 1 - 600 bases. ... 1.. . .. .1:  TCGGCACTGTCTCATCTCTGCTGTTGCTCCTGCS A L S H L C C C S C..................................
Mas, o que eu faço com isso?
Muito Obrigado!Bioinformática e computação científicaaplicadas à pesquisa agropecuáriaWagner Arbexarbex@cnpgl.embrapa.brSe...
Próximos SlideShares
Carregando em…5

Seminários da Computação do Programa de Pós-graduação de Ciência da Computação da UFJF

264 visualizações

Publicada em

Bioinformática e computação científica aplicadas à pesquisa agropecuária (Wagner Arbex). Palestra apresentada nos Seminários da Computação do Programa de Pós-graduação de Ciência da Computação da UFJF, em 26/4/2012

Publicada em: Tecnologia
0 comentários
0 gostaram
  • Seja o primeiro a comentar

  • Seja a primeira pessoa a gostar disto

Sem downloads
Visualizações totais
No SlideShare
A partir de incorporações
Número de incorporações
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Seminários da Computação do Programa de Pós-graduação de Ciência da Computação da UFJF

  1. 1. Bioinformática e computaçãocientífica aplicadas à pesquisaagropecuáriaWagner Arbexarbex@cnpgl.embrapa.brSeminários da ComputaçãoUniversidade Federal de Juiz de ForaJuiz de Fora – 26/4/2012
  2. 2. A Embrapa• Empresa Brasileira de Pesquisa Agropecuária:• ~ 45 centros serviços e de pesquisa deprodutos, temas básicos e ecorregionais país;• ~ 12 projetos ou laboratórios de pesquisa,prospecção e articulação no exterior;• Embrapa Gado de Leite• Centro Nacional de Pesquisa de Gado de Leite;
  3. 3. O que é computação científica?• Algumas vezes é chamada de ciência computacional enão deve ser confundida com ciência da computação;• Desenvolve modelos matemáticos e computacionaispara tratar problemas científicos e tecnológicos;• Promove/Possibilita a computação massiva e/oucomplexa, o que é um “novo” paradigma de pesquisacientífica;
  4. 4. • É comum...• ... basear-se em software livre;• ... exigir recursos de computação de alto desempenho;• ... não apresentar padrão para demanda de processamentoou para uso de recursos computacionais;• ... pagar pra ver. Ou seja, testar inovações, novastecnologias e/ou recursos tecnológicos - algumas vezes, semcomprovação de eficiência - para buscar alguma novasolução;O que é computação científica?
  5. 5. O que é bioinformática?
  6. 6. O que é bioinformática?BiologiacomputacionalBioinformáticaProteomaGenoma
  7. 7. • Bioinformática:• Surgiu da necessidade de identificar, tratar, organizar,armazenar, pesquisar e recuperar dados genômicos;• O que são dados genômicos?• Era uma vez, em 1953...O que é bioinformática?
  8. 8. • Elizabeth II foi coroada rainha da Inglaterra... econtinua sendo até hoje!Era uma vez, em 1953...
  9. 9. • Foi publicado o primeirolivro com uma novel deBond... James Bond...Era uma vez, em 1953...
  10. 10. • Já nas bancas a primeiraPlayboy!Era uma vez, em 1953...
  11. 11. • James Watson e FrancisCrick descobrem a molé-cula de DNA, o ácidodesoxirribonucleico;Era uma vez, em 1953...
  12. 12. • Em 1958, Francis Crick descreve o dogma centralda biologia molecular;O que são dados genômicos?
  13. 13. • Em 1975, FrederickSanger desenvolve osfundamentos para osmétodos de sequencia-mento automático;O que são dados genômicos?
  14. 14. Sequenciamento “a mil”
  16. 16. • Em 2000:• Genoma da Xylella fastidiosa, abactéria causadora da “pragado amarelinho”;• Primeiro trabalho brasileiro, em130 anos, na capa da Nature,em 13/7/2000;Sequenciamento “a mil”
  17. 17. • Em 2000, o anúncio oficial da primeira versão dogenoma humano, em 26/7/2000;Projeto Genoma Humano
  18. 18. • PGH – 1990-2001/2003:• Projeto GenomaHumano;• Desenvolvido por umconsórcio entre empresasprivadas e públicas;• Francis Collins e CraigVenter;Transforma a biologia emciência exata...O que são dados genômicos?
  26. 26. seq 1 - 600 bases. ... 1.. . .. .1: TCGGCACTGTCTCATCTCTGCTGTTGCTCCTGCS A L S H L C C C S C.................................121: GCACAGGATGGCAAGACGCAGTAGCTGGGACTGA Q D G K T Q X L G L.................................241: CGGTTTCTTCCTCGGCTTCCCGGACATACCCTGR F L P R L P G H T L.......2.........................361: CTGTGCCTGGGCCCCAGCTCTTGGTCTGAGCGCL C L G P S S W S E R1 - ATC/I: 1 50% TCG/S: 1 50%2 - GCA/A: 1 50% TTT/F: 1 50%3 - CTG/L: 1 50% CCT/P: 1 50%4 - TCT/S: 2 100%5 - TCC/S: 1 50% CAT/H: 1 50%6 - TTC/F: 1 50% CTC/L: 1 50%7 - TGC/C: 1 50% AGG/R: 1 50%8 - TGT/C: 1 50% ATT/I: 1 50%9 - TGC/C: 1 50% TCA/S: 1 50%10 - AAC/N: 1 50% TCC/S: 1 50%11 - TGC/C: 1 50% ACA/T: 1 50%12 - TGT/C: 1 50% ACA/T: 1 50%13 - GTG/V: 1 50% CTC/L: 1 50%Mas, o que eu faço com isso?
  27. 27. Mas, o que eu faço com isso?
  28. 28. Muito Obrigado!Bioinformática e computação científicaaplicadas à pesquisa agropecuáriaWagner Arbexarbex@cnpgl.embrapa.brSeminários da ComputaçãoUniversidade Federal de Juiz de ForaJuiz de Fora – 26/4/2012
