SlideShare a Scribd company logo
1 of 35
Saroopa Samaradivakara  Genetech Research Institute
Cinnamon ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Genetech Research Institute
What is Barcoding? ,[object Object],[object Object],[object Object],Genetech Research Institute
Genetech Research Institute
Why TrnH and MatK barcoding loci? ,[object Object],[object Object],[object Object],http://www.pnas.org/content/106/31/12794   (12.10.2009) Genetech Research Institute
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Why is it important to barcode Cinnamon? http://en.wikipedia.org/wiki/Cinnamon Genetech Research Institute
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Genetech Research Institute
OBJECTIVES ,[object Object],[object Object],[object Object],Genetech Research Institute
Method Objective 1 ,[object Object],[object Object],[object Object],[object Object],[object Object],Genetech Research Institute
Genetech Research Institute Cinnamomum aromaticum “ Wal Kurundu” “ Dawul kurundu” Cinnamomum camphora
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Genetech Research Institute
Results Genetech Research Institute
[object Object],A  -  λ 100 bp  ladder B  -  PCR amplified products of primers  trnH-psbA C  -  Negative control for trnH-psbA primer products  (all except template DNA) D  -  PCR amplified products of primer matK with  0.5  µ l of  14.07 M  DMSO  E  -  PCR amplified products of primer matK with  1.0  µ l of 14.07 M  DMSO F  -  PCR amplified products of primer matK with  1.5 µ l of 14.07 M  DMSO G  -  Negative control for matK (including 1.0  µ l of    14.07 M  DMSO)  500bp Genetech Research Institute matK trnH A  B  C  D  E  F  G  H
GTAGTTATGAACCCTGTAGACATCCCCACGGGGTGGTGAAGGGAGGGCCCGATTGGTAGAAAAAAAC CCACAACCCCGGGGTTATCCTGCGCTTGGAAGAAAAAGTAGGAAAAGGAATAAATATAGTAATAGTTT TATTATTCGTCGCCGTAAATAGAAATATTCAAAATCAAATAAATATTGTTTTTTAAGGTGAAATAAAGATATTTACACCCCGTCCAAGTTTATAGGGATAGCAAATGCTGGGCGAACGACGGGAATTGAACCCGCGCATGTGGATTCACTCCACTGCCTTGATCCACTTGGCTACATCCGCCCCTCCTCTCTCAAAAGGATTCCATTTTCACCATTCATTATTTTTTCTTTATTACTTCACTCTCCTTCCTGCTGAAATACAGATATTGTACATAAAACAAAATGTTGTACGTAAAATAAAAAAAAAAAGAAAAATGCTTTGATTTTTTCCTAAAATCAAATTCTTTTGAAGAATAAGAGTATATAAATTGCAGGTTGGTACAGAAGAAACTACGATATCGATCACGAAATAACCAGCGGTTTTCATAAGTTGAATAAAAGAAATGAAAATGAAAAACGATTATGTGAAAACACTCTGAACCAAATAGATCAATCCAAACTTCTTAATAGAACAGAAGTTTGGTATTGATC Trn H  Cinnamomum camphora Genetech Research Institute
Genetech Research Institute
[object Object],[object Object],Genetech Research Institute
Genetech Research Institute
“ Dawul   kurundu” D1  - λ 100 bp  ladder D2  -  PCR amplified products of primers matK for  “   Dawul kurudu ” D3  -  Negative control for matK D4 -  PCR amplified products of primer trnH-psbA for  “ Dawul kurudu ” D5  -  PCR amplified products of primer trnH-psbA  for  C. camphora D6  -  Negative control for matK primer products Genetech Research Institute 500bp D1  D2  D3  D4  D5  D6  trnH
“ Dawul kurundu” TrnH ,[object Object],Genetech Research Institute
Genetech Research Institute
Cinnamomum aromaticum  and  “Wal kurundu” TrnH A- 100bp Ladder B- Amplification with TrnH  C- negative control D- Amplification with MatK having 1ul of DMSO E- negative control  F- Amplification with MatK having 1.5ul of DMSO G- negative control Genetech Research Institute 500bp
[object Object],[object Object],[object Object],[object Object],Genetech Research Institute
[object Object],[object Object],[object Object],Objective 2 Extraction of DNA from processed Cinnamon bark for obtaining DNA Barcodes Genetech Research Institute
Discussion ,[object Object],[object Object],[object Object],[object Object],Genetech Research Institute
[object Object],[object Object],[object Object],Genetech Research Institute
[object Object],[object Object],Cinnamon bark DNA extraction and amplification Genetech Research Institute
[object Object],[object Object],[object Object],[object Object],[object Object],Genetech Research Institute
[object Object],[object Object],[object Object],Genetech Research Institute
References ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Genetech Research Institute
Aknowledgement ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],Genetech Research Institute
Genetech Research Institute
[object Object],[object Object],[object Object],[object Object],[object Object],Genetech Research Institute
Genetech Research Institute
[object Object],[object Object],[object Object],[object Object],[object Object],PCR protocol Genetech Research Institute
A- 100bp Ladder B- Amplification of  Cinnamomum aromaticum  with  TrnH C- Amplification of “Wal kurundu” with TrnH Genetech Research Institute 500bp

More Related Content

What's hot

DNA sequencing methods
DNA sequencing methodsDNA sequencing methods
DNA sequencing methodssepidehsaroghi
 
Biological screening of herbal drugs for anti cancer activity
Biological screening of herbal drugs for anti cancer activityBiological screening of herbal drugs for anti cancer activity
Biological screening of herbal drugs for anti cancer activityshafna hussain
 
Polymerase chain reaction (pcr)
Polymerase chain reaction (pcr)Polymerase chain reaction (pcr)
Polymerase chain reaction (pcr)Raju Bishnoi
 
DNA Extraction Methods
DNA Extraction MethodsDNA Extraction Methods
DNA Extraction MethodsMwaseemtanoli
 
Dietary uptake of environmental dsRNA in humans and other vertebrates - Thais...
Dietary uptake of environmental dsRNA in humans and other vertebrates - Thais...Dietary uptake of environmental dsRNA in humans and other vertebrates - Thais...
Dietary uptake of environmental dsRNA in humans and other vertebrates - Thais...OECD Environment
 
PCR PPT
PCR PPTPCR PPT
PCR PPTakslal
 
Dna isolation from various sources
Dna isolation  from various sourcesDna isolation  from various sources
Dna isolation from various sourcesTamiru Tadele
 
Molecular markers for measuring genetic diversity
Molecular markers for measuring genetic diversity Molecular markers for measuring genetic diversity
Molecular markers for measuring genetic diversity Zohaib HUSSAIN
 
Genome assembly: the art of trying to make one big thing from millions of ver...
Genome assembly: the art of trying to make one big thing from millions of ver...Genome assembly: the art of trying to make one big thing from millions of ver...
Genome assembly: the art of trying to make one big thing from millions of ver...Keith Bradnam
 
Andrographis paniculata
Andrographis paniculataAndrographis paniculata
Andrographis paniculataPPRC AYUR
 
Turmeric: Medicinal, Cancer, Bacteria Cure
Turmeric:  Medicinal, Cancer, Bacteria CureTurmeric:  Medicinal, Cancer, Bacteria Cure
Turmeric: Medicinal, Cancer, Bacteria CureRose Haft
 
Critical Factors for Successful Real-Time PCR: Multiplex PCR
Critical Factors for Successful Real-Time PCR: Multiplex PCRCritical Factors for Successful Real-Time PCR: Multiplex PCR
Critical Factors for Successful Real-Time PCR: Multiplex PCRQIAGEN
 
RNA sequencing: advances and opportunities
RNA sequencing: advances and opportunities RNA sequencing: advances and opportunities
RNA sequencing: advances and opportunities Paolo Dametto
 

What's hot (20)

Restriction Enzymes
Restriction EnzymesRestriction Enzymes
Restriction Enzymes
 
Dna fingerprinting
Dna fingerprintingDna fingerprinting
Dna fingerprinting
 
Pcr 29 07-2011 final
Pcr 29 07-2011 finalPcr 29 07-2011 final
Pcr 29 07-2011 final
 
DNA sequencing methods
DNA sequencing methodsDNA sequencing methods
DNA sequencing methods
 
Biological screening of herbal drugs for anti cancer activity
Biological screening of herbal drugs for anti cancer activityBiological screening of herbal drugs for anti cancer activity
Biological screening of herbal drugs for anti cancer activity
 
Polymerase chain reaction (pcr)
Polymerase chain reaction (pcr)Polymerase chain reaction (pcr)
Polymerase chain reaction (pcr)
 
Pcr
PcrPcr
Pcr
 
DNA Extraction Methods
DNA Extraction MethodsDNA Extraction Methods
DNA Extraction Methods
 
DNA Fingerprinting
DNA FingerprintingDNA Fingerprinting
DNA Fingerprinting
 
Dietary uptake of environmental dsRNA in humans and other vertebrates - Thais...
Dietary uptake of environmental dsRNA in humans and other vertebrates - Thais...Dietary uptake of environmental dsRNA in humans and other vertebrates - Thais...
Dietary uptake of environmental dsRNA in humans and other vertebrates - Thais...
 
PCR PPT
PCR PPTPCR PPT
PCR PPT
 
Dna isolation from various sources
Dna isolation  from various sourcesDna isolation  from various sources
Dna isolation from various sources
 
Pcr
PcrPcr
Pcr
 
Qiagen handbooks
Qiagen handbooksQiagen handbooks
Qiagen handbooks
 
Molecular markers for measuring genetic diversity
Molecular markers for measuring genetic diversity Molecular markers for measuring genetic diversity
Molecular markers for measuring genetic diversity
 
Genome assembly: the art of trying to make one big thing from millions of ver...
Genome assembly: the art of trying to make one big thing from millions of ver...Genome assembly: the art of trying to make one big thing from millions of ver...
Genome assembly: the art of trying to make one big thing from millions of ver...
 
Andrographis paniculata
Andrographis paniculataAndrographis paniculata
Andrographis paniculata
 
Turmeric: Medicinal, Cancer, Bacteria Cure
Turmeric:  Medicinal, Cancer, Bacteria CureTurmeric:  Medicinal, Cancer, Bacteria Cure
Turmeric: Medicinal, Cancer, Bacteria Cure
 
Critical Factors for Successful Real-Time PCR: Multiplex PCR
Critical Factors for Successful Real-Time PCR: Multiplex PCRCritical Factors for Successful Real-Time PCR: Multiplex PCR
Critical Factors for Successful Real-Time PCR: Multiplex PCR
 
RNA sequencing: advances and opportunities
RNA sequencing: advances and opportunities RNA sequencing: advances and opportunities
RNA sequencing: advances and opportunities
 

Viewers also liked

Use of DNA barcoding and its role in the plant species/varietal Identifica...
Use of DNA  barcoding  and its role in the plant species/varietal  Identifica...Use of DNA  barcoding  and its role in the plant species/varietal  Identifica...
Use of DNA barcoding and its role in the plant species/varietal Identifica...Senthil Natesan
 
DNA Barcoding: A simple way of identifying species by DNA
DNA Barcoding: A simple way of identifying species by DNADNA Barcoding: A simple way of identifying species by DNA
DNA Barcoding: A simple way of identifying species by DNAmarkstoeckle
 
The Evolution of Information literacy in Galway Mayo Institute of Technology ...
The Evolution of Information literacy in Galway Mayo Institute of Technology ...The Evolution of Information literacy in Galway Mayo Institute of Technology ...
The Evolution of Information literacy in Galway Mayo Institute of Technology ...CONUL Conference
 
DNA barcode sequence identification incorporating taxonomic hierarchy and wit...
DNA barcode sequence identification incorporating taxonomic hierarchy and wit...DNA barcode sequence identification incorporating taxonomic hierarchy and wit...
DNA barcode sequence identification incorporating taxonomic hierarchy and wit...Raunak Shrestha
 
Johannes Bergsten Dna Barcoding
Johannes Bergsten Dna BarcodingJohannes Bergsten Dna Barcoding
Johannes Bergsten Dna Barcodingbioinfocourse
 
Microscopic evaluation of crude drugs
Microscopic evaluation of crude drugsMicroscopic evaluation of crude drugs
Microscopic evaluation of crude drugsArslan Tahir
 
What is Called Design ?
What is Called Design ?What is Called Design ?
What is Called Design ?Stéphane Vial
 
Presentazione corso Informatica Giuridica Avanzata
Presentazione corso Informatica Giuridica AvanzataPresentazione corso Informatica Giuridica Avanzata
Presentazione corso Informatica Giuridica AvanzataCouncil of Europe
 
Bloco K: Entenda as mudanças e prepare-se
Bloco K: Entenda as mudanças e prepare-seBloco K: Entenda as mudanças e prepare-se
Bloco K: Entenda as mudanças e prepare-seSenior Sistemas
 
James Metcalfe's February Real Estate Update
James Metcalfe's February Real Estate UpdateJames Metcalfe's February Real Estate Update
James Metcalfe's February Real Estate UpdateJames Metcalfe
 
Uniform Code of Pharmaceuticals Marketing Practices
Uniform Code of Pharmaceuticals Marketing PracticesUniform Code of Pharmaceuticals Marketing Practices
Uniform Code of Pharmaceuticals Marketing PracticesAnup Soans
 
James Metcalfe's real estate market update march 2012
James Metcalfe's real estate market update march 2012James Metcalfe's real estate market update march 2012
James Metcalfe's real estate market update march 2012James Metcalfe
 

Viewers also liked (20)

Use of DNA barcoding and its role in the plant species/varietal Identifica...
Use of DNA  barcoding  and its role in the plant species/varietal  Identifica...Use of DNA  barcoding  and its role in the plant species/varietal  Identifica...
Use of DNA barcoding and its role in the plant species/varietal Identifica...
 
Dna barcoding
Dna barcodingDna barcoding
Dna barcoding
 
DNA Barcoding: A simple way of identifying species by DNA
DNA Barcoding: A simple way of identifying species by DNADNA Barcoding: A simple way of identifying species by DNA
DNA Barcoding: A simple way of identifying species by DNA
 
The Evolution of Information literacy in Galway Mayo Institute of Technology ...
The Evolution of Information literacy in Galway Mayo Institute of Technology ...The Evolution of Information literacy in Galway Mayo Institute of Technology ...
The Evolution of Information literacy in Galway Mayo Institute of Technology ...
 
David Schindel - Barcode Data Standard Compliance
David Schindel - Barcode Data Standard ComplianceDavid Schindel - Barcode Data Standard Compliance
David Schindel - Barcode Data Standard Compliance
 
DNA barcode sequence identification incorporating taxonomic hierarchy and wit...
DNA barcode sequence identification incorporating taxonomic hierarchy and wit...DNA barcode sequence identification incorporating taxonomic hierarchy and wit...
DNA barcode sequence identification incorporating taxonomic hierarchy and wit...
 
Cardamom
CardamomCardamom
Cardamom
 
cardamom
cardamomcardamom
cardamom
 
Johannes Bergsten Dna Barcoding
Johannes Bergsten Dna BarcodingJohannes Bergsten Dna Barcoding
Johannes Bergsten Dna Barcoding
 
Dna barcoding
Dna  barcoding Dna  barcoding
Dna barcoding
 
Symposium
Symposium Symposium
Symposium
 
Microscopic evaluation of crude drugs
Microscopic evaluation of crude drugsMicroscopic evaluation of crude drugs
Microscopic evaluation of crude drugs
 
Pharmacognosy
PharmacognosyPharmacognosy
Pharmacognosy
 
What is Called Design ?
What is Called Design ?What is Called Design ?
What is Called Design ?
 
Presentazione corso Informatica Giuridica Avanzata
Presentazione corso Informatica Giuridica AvanzataPresentazione corso Informatica Giuridica Avanzata
Presentazione corso Informatica Giuridica Avanzata
 
Bloco K: Entenda as mudanças e prepare-se
Bloco K: Entenda as mudanças e prepare-seBloco K: Entenda as mudanças e prepare-se
Bloco K: Entenda as mudanças e prepare-se
 
James Metcalfe's February Real Estate Update
James Metcalfe's February Real Estate UpdateJames Metcalfe's February Real Estate Update
James Metcalfe's February Real Estate Update
 
Uniform Code of Pharmaceuticals Marketing Practices
Uniform Code of Pharmaceuticals Marketing PracticesUniform Code of Pharmaceuticals Marketing Practices
Uniform Code of Pharmaceuticals Marketing Practices
 
James Metcalfe's real estate market update march 2012
James Metcalfe's real estate market update march 2012James Metcalfe's real estate market update march 2012
James Metcalfe's real estate market update march 2012
 
Brand blog
Brand blogBrand blog
Brand blog
 

Similar to 9 112 Samaradivakara S DNA barcoding of cinnamon

molecular biology techniques -jaypee university of information technology- ra...
molecular biology techniques -jaypee university of information technology- ra...molecular biology techniques -jaypee university of information technology- ra...
molecular biology techniques -jaypee university of information technology- ra...RAVI RANJAN
 
molecular biology techniques -jaypee university of information technology- ra...
molecular biology techniques -jaypee university of information technology- ra...molecular biology techniques -jaypee university of information technology- ra...
molecular biology techniques -jaypee university of information technology- ra...RAVI RANJAN
 
Dna fingerprinting of herbal drugs
Dna fingerprinting of herbal drugsDna fingerprinting of herbal drugs
Dna fingerprinting of herbal drugsGovindarajulaJP
 
DNA Preparation for sequencing
DNA Preparation for sequencingDNA Preparation for sequencing
DNA Preparation for sequencingDr. Pavan Kundur
 
Preparing Genomic DNA for Sequencing
Preparing Genomic DNA for SequencingPreparing Genomic DNA for Sequencing
Preparing Genomic DNA for SequencingDr. Pavan Kundur
 
Next Generation Sequencing Technologies and Their Applications in Ornamental ...
Next Generation Sequencing Technologies and Their Applications in Ornamental ...Next Generation Sequencing Technologies and Their Applications in Ornamental ...
Next Generation Sequencing Technologies and Their Applications in Ornamental ...Ravindra Kumar
 
20150601 bio sb_assembly_course
20150601 bio sb_assembly_course20150601 bio sb_assembly_course
20150601 bio sb_assembly_coursehansjansen9999
 
PCR and its types
PCR and  its typesPCR and  its types
PCR and its typessujathar23
 
Bioinformatic analysis of the Proanthocyanidin Biosynthetic Pathway in Hawtho...
Bioinformatic analysis of the Proanthocyanidin Biosynthetic Pathway in Hawtho...Bioinformatic analysis of the Proanthocyanidin Biosynthetic Pathway in Hawtho...
Bioinformatic analysis of the Proanthocyanidin Biosynthetic Pathway in Hawtho...Afnan Zuiter
 
Rnaseq basics ngs_application1
Rnaseq basics ngs_application1Rnaseq basics ngs_application1
Rnaseq basics ngs_application1Yaoyu Wang
 
Molecular markers - EASY!!
Molecular markers - EASY!!Molecular markers - EASY!!
Molecular markers - EASY!!Shovan Das
 
PCR Webinar: COVID-19 (2020)
PCR Webinar: COVID-19 (2020)PCR Webinar: COVID-19 (2020)
PCR Webinar: COVID-19 (2020)Sijo A
 
11.isolation and pcr amplification of genomic dna from traded seeds of nutmeg
11.isolation and pcr amplification of genomic dna from traded seeds of nutmeg11.isolation and pcr amplification of genomic dna from traded seeds of nutmeg
11.isolation and pcr amplification of genomic dna from traded seeds of nutmegAlexander Decker
 
Isolation and pcr amplification of genomic dna from traded seeds of nutmeg
Isolation and pcr amplification of genomic dna from traded seeds of nutmegIsolation and pcr amplification of genomic dna from traded seeds of nutmeg
Isolation and pcr amplification of genomic dna from traded seeds of nutmegAlexander Decker
 

Similar to 9 112 Samaradivakara S DNA barcoding of cinnamon (20)

molecular biology techniques -jaypee university of information technology- ra...
molecular biology techniques -jaypee university of information technology- ra...molecular biology techniques -jaypee university of information technology- ra...
molecular biology techniques -jaypee university of information technology- ra...
 
molecular biology techniques -jaypee university of information technology- ra...
molecular biology techniques -jaypee university of information technology- ra...molecular biology techniques -jaypee university of information technology- ra...
molecular biology techniques -jaypee university of information technology- ra...
 
Dna fingerprinting of herbal drugs
Dna fingerprinting of herbal drugsDna fingerprinting of herbal drugs
Dna fingerprinting of herbal drugs
 
Polymerase chain reaction & electrophoresis
Polymerase chain reaction & electrophoresisPolymerase chain reaction & electrophoresis
Polymerase chain reaction & electrophoresis
 
DNA Preparation for sequencing
DNA Preparation for sequencingDNA Preparation for sequencing
DNA Preparation for sequencing
 
Preparing Genomic DNA for Sequencing
Preparing Genomic DNA for SequencingPreparing Genomic DNA for Sequencing
Preparing Genomic DNA for Sequencing
 
Technique of polymerase chain reaction (pcr) experimental biotechnology
Technique of polymerase chain reaction (pcr) experimental biotechnologyTechnique of polymerase chain reaction (pcr) experimental biotechnology
Technique of polymerase chain reaction (pcr) experimental biotechnology
 
Next Generation Sequencing Technologies and Their Applications in Ornamental ...
Next Generation Sequencing Technologies and Their Applications in Ornamental ...Next Generation Sequencing Technologies and Their Applications in Ornamental ...
Next Generation Sequencing Technologies and Their Applications in Ornamental ...
 
PCR Types
PCR TypesPCR Types
PCR Types
 
20150601 bio sb_assembly_course
20150601 bio sb_assembly_course20150601 bio sb_assembly_course
20150601 bio sb_assembly_course
 
Recombinant DNA
Recombinant DNARecombinant DNA
Recombinant DNA
 
PCR and its types
PCR and  its typesPCR and  its types
PCR and its types
 
Bioinformatic analysis of the Proanthocyanidin Biosynthetic Pathway in Hawtho...
Bioinformatic analysis of the Proanthocyanidin Biosynthetic Pathway in Hawtho...Bioinformatic analysis of the Proanthocyanidin Biosynthetic Pathway in Hawtho...
Bioinformatic analysis of the Proanthocyanidin Biosynthetic Pathway in Hawtho...
 
Rnaseq basics ngs_application1
Rnaseq basics ngs_application1Rnaseq basics ngs_application1
Rnaseq basics ngs_application1
 
Molecular markers - EASY!!
Molecular markers - EASY!!Molecular markers - EASY!!
Molecular markers - EASY!!
 
PCR Webinar: COVID-19 (2020)
PCR Webinar: COVID-19 (2020)PCR Webinar: COVID-19 (2020)
PCR Webinar: COVID-19 (2020)
 
4 68 Wickramasinghe E[1].D.T.S DNA barcoding of Tea
4 68 Wickramasinghe  E[1].D.T.S DNA barcoding of Tea4 68 Wickramasinghe  E[1].D.T.S DNA barcoding of Tea
4 68 Wickramasinghe E[1].D.T.S DNA barcoding of Tea
 
PCR lecture.ppt
PCR lecture.pptPCR lecture.ppt
PCR lecture.ppt
 
11.isolation and pcr amplification of genomic dna from traded seeds of nutmeg
11.isolation and pcr amplification of genomic dna from traded seeds of nutmeg11.isolation and pcr amplification of genomic dna from traded seeds of nutmeg
11.isolation and pcr amplification of genomic dna from traded seeds of nutmeg
 
Isolation and pcr amplification of genomic dna from traded seeds of nutmeg
Isolation and pcr amplification of genomic dna from traded seeds of nutmegIsolation and pcr amplification of genomic dna from traded seeds of nutmeg
Isolation and pcr amplification of genomic dna from traded seeds of nutmeg
 

Recently uploaded

WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure serviceWhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure servicePooja Nehwal
 
The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024Rafal Los
 
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...apidays
 
Unblocking The Main Thread Solving ANRs and Frozen Frames
Unblocking The Main Thread Solving ANRs and Frozen FramesUnblocking The Main Thread Solving ANRs and Frozen Frames
Unblocking The Main Thread Solving ANRs and Frozen FramesSinan KOZAK
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Scriptwesley chun
 
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...Neo4j
 
Handwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed textsHandwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed textsMaria Levchenko
 
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...Neo4j
 
Slack Application Development 101 Slides
Slack Application Development 101 SlidesSlack Application Development 101 Slides
Slack Application Development 101 Slidespraypatel2
 
A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024Results
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Drew Madelung
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonAnna Loughnan Colquhoun
 
Top 5 Benefits OF Using Muvi Live Paywall For Live Streams
Top 5 Benefits OF Using Muvi Live Paywall For Live StreamsTop 5 Benefits OF Using Muvi Live Paywall For Live Streams
Top 5 Benefits OF Using Muvi Live Paywall For Live StreamsRoshan Dwivedi
 
Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024The Digital Insurer
 
IAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsIAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsEnterprise Knowledge
 
Boost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityBoost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityPrincipled Technologies
 
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEarley Information Science
 
CNv6 Instructor Chapter 6 Quality of Service
CNv6 Instructor Chapter 6 Quality of ServiceCNv6 Instructor Chapter 6 Quality of Service
CNv6 Instructor Chapter 6 Quality of Servicegiselly40
 
Kalyanpur ) Call Girls in Lucknow Finest Escorts Service 🍸 8923113531 🎰 Avail...
Kalyanpur ) Call Girls in Lucknow Finest Escorts Service 🍸 8923113531 🎰 Avail...Kalyanpur ) Call Girls in Lucknow Finest Escorts Service 🍸 8923113531 🎰 Avail...
Kalyanpur ) Call Girls in Lucknow Finest Escorts Service 🍸 8923113531 🎰 Avail...gurkirankumar98700
 
[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdfhans926745
 

Recently uploaded (20)

WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure serviceWhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
 
The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024
 
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
 
Unblocking The Main Thread Solving ANRs and Frozen Frames
Unblocking The Main Thread Solving ANRs and Frozen FramesUnblocking The Main Thread Solving ANRs and Frozen Frames
Unblocking The Main Thread Solving ANRs and Frozen Frames
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Script
 
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
 
Handwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed textsHandwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed texts
 
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
 
Slack Application Development 101 Slides
Slack Application Development 101 SlidesSlack Application Development 101 Slides
Slack Application Development 101 Slides
 
A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024
 
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
Strategies for Unlocking Knowledge Management in Microsoft 365 in the Copilot...
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt Robison
 
Top 5 Benefits OF Using Muvi Live Paywall For Live Streams
Top 5 Benefits OF Using Muvi Live Paywall For Live StreamsTop 5 Benefits OF Using Muvi Live Paywall For Live Streams
Top 5 Benefits OF Using Muvi Live Paywall For Live Streams
 
Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024Partners Life - Insurer Innovation Award 2024
Partners Life - Insurer Innovation Award 2024
 
IAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsIAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI Solutions
 
Boost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivityBoost PC performance: How more available memory can improve productivity
Boost PC performance: How more available memory can improve productivity
 
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptxEIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
EIS-Webinar-Prompt-Knowledge-Eng-2024-04-08.pptx
 
CNv6 Instructor Chapter 6 Quality of Service
CNv6 Instructor Chapter 6 Quality of ServiceCNv6 Instructor Chapter 6 Quality of Service
CNv6 Instructor Chapter 6 Quality of Service
 
Kalyanpur ) Call Girls in Lucknow Finest Escorts Service 🍸 8923113531 🎰 Avail...
Kalyanpur ) Call Girls in Lucknow Finest Escorts Service 🍸 8923113531 🎰 Avail...Kalyanpur ) Call Girls in Lucknow Finest Escorts Service 🍸 8923113531 🎰 Avail...
Kalyanpur ) Call Girls in Lucknow Finest Escorts Service 🍸 8923113531 🎰 Avail...
 
[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf
 

9 112 Samaradivakara S DNA barcoding of cinnamon