SlideShare uma empresa Scribd logo
Ácidos NucléicosProf. Fabiano Reis
TiposDNA(ácido desoxirrubonucléico)RNA(ácido ribonucléico)
Carboidrato(Pentose)Desoxirribose-PODNA4Radical FosfatoBase NitrogenadaDNucleotídeoCarboidrato(Pentose)Base NitrogenadaNucleosídeo
Carboidrato(Pentose)Desoxirribose----POPOPOPODNA4444Radical FosfatoBase NitrogenadaDTiminaLigação FosfodiésteDAdeninaDCitosinaDGuanina
TAATATATCGCGGCGCGCGCATAT
Relação de Chargaff A = TG = CErwin Chargaff (1905-1992)
Descoberta da Estrutura Helicoidal do DNADifração do raio-X para determinação da estrutura da molécula do DNARosalind Franklin (1920 —1958)
3’5’TATAAATTCGCGGCGCGCATJames Watson e Francis Crick GCDupla HeliceAT5’3’
Duplicação (Replicação) do DNADNA Helicase
Duplicação (Replicação) do DNAsemi-conservativaDNA HelicaseDNA PolimeraseDNA Polimerasesemi-conservativa
Carboidrato(Pentose)Ribose-PORNA4Radical FosfatoBase NitrogenadaRNucleotídeo
Carboidrato(Pentose)Ribose----POPOPOPORNA4444Radical FosfatoBase Nitrogenada3’RUUracilaLigação FosfodiésteARAdeninaCRCitosinaGRGuanina5’
Tipos de RNARNAm (mensageiro)Simples hélice
Tipos de RNARNAt (transportador ou de Transporte)
Tipos de RNARNAr (ribossômico)
Síntese Protéica3’5’TAGCCAUATURNAmCGGCribossomoRNAtGCUGAAT5’3’DNAaminoácidos
Ligação peptídica3’5’aminoácidoTAaminoácidoRNAtATACUGGACG3’5’GCGCATGCCAUU5’3’RNAm5’3’
Tabela do Código Genético (Baseado nos Codons)
Tabela do Código Genético (Baseado nos Codons)
Núcleocitoplasma
Email: fabianobiologico@hotmail.comBlog: http://biologiaquepariu.blogspot.com

Mais conteúdo relacionado

Destaque

Sistema reprodutor feminino
Sistema reprodutor femininoSistema reprodutor feminino
Sistema reprodutor feminino
Fabiano Reis
 
Embriologia
EmbriologiaEmbriologia
Embriologia
Fabiano Reis
 
Morfologia externa das angiospermas
Morfologia externa das angiospermasMorfologia externa das angiospermas
Morfologia externa das angiospermas
Fabiano Reis
 
Genética probabilidade slides
Genética probabilidade slidesGenética probabilidade slides
Genética probabilidade slides
Fabiano Reis
 
Taxonomia
TaxonomiaTaxonomia
Taxonomia
Fabiano Reis
 
Aula teorica minicurso modelagem de proteinas por homologia
Aula teorica minicurso modelagem de proteinas por homologiaAula teorica minicurso modelagem de proteinas por homologia
Aula teorica minicurso modelagem de proteinas por homologia
Fabiano Reis
 
Genética – 2 lei de mendel
Genética – 2 lei de mendelGenética – 2 lei de mendel
Genética – 2 lei de mendel
Fabiano Reis
 
Bioquimica
BioquimicaBioquimica
Bioquimica
Fabiano Reis
 
Genética probabilidade slides
Genética probabilidade slidesGenética probabilidade slides
Genética probabilidade slides
Fabiano Reis
 
Introdução à Anatomia e Fisiologia Humana
Introdução à Anatomia e Fisiologia HumanaIntrodução à Anatomia e Fisiologia Humana
Introdução à Anatomia e Fisiologia Humana
Eiderson Silva Cabral
 
Sistemanervoso
SistemanervosoSistemanervoso
Sistemanervoso
thaissa_yagami
 
Poríferos e cnidários
Poríferos e cnidáriosPoríferos e cnidários
Poríferos e cnidários
Fabiano Reis
 
Aula sistema digestivo e nutrição
Aula sistema digestivo e nutriçãoAula sistema digestivo e nutrição
Aula sistema digestivo e nutrição
Dejair Monacelli
 
Genética probabilidade slides
Genética probabilidade slidesGenética probabilidade slides
Genética probabilidade slides
Fabiano Reis
 
IV.2 Sistema digestório
IV.2 Sistema digestórioIV.2 Sistema digestório
IV.2 Sistema digestório
Rebeca Vale
 
Sistema Digestório
Sistema DigestórioSistema Digestório
Sistema Digestório
paleocmsilva
 
Fisiologia do sistema_nervoso_e_sistema_neuromuscular
Fisiologia do sistema_nervoso_e_sistema_neuromuscularFisiologia do sistema_nervoso_e_sistema_neuromuscular
Fisiologia do sistema_nervoso_e_sistema_neuromuscular
Raul Tomé
 
Sistema endócrino slides da aula
Sistema endócrino slides da aulaSistema endócrino slides da aula
Sistema endócrino slides da aula
Fabiano Reis
 
Sistema digestorio slides
Sistema digestorio slidesSistema digestorio slides
Sistema digestorio slides
Fabiano Reis
 
Introdução ao Corpo Humano
Introdução ao Corpo HumanoIntrodução ao Corpo Humano
Introdução ao Corpo Humano
paleocmsilva
 

Destaque (20)

Sistema reprodutor feminino
Sistema reprodutor femininoSistema reprodutor feminino
Sistema reprodutor feminino
 
Embriologia
EmbriologiaEmbriologia
Embriologia
 
Morfologia externa das angiospermas
Morfologia externa das angiospermasMorfologia externa das angiospermas
Morfologia externa das angiospermas
 
Genética probabilidade slides
Genética probabilidade slidesGenética probabilidade slides
Genética probabilidade slides
 
Taxonomia
TaxonomiaTaxonomia
Taxonomia
 
Aula teorica minicurso modelagem de proteinas por homologia
Aula teorica minicurso modelagem de proteinas por homologiaAula teorica minicurso modelagem de proteinas por homologia
Aula teorica minicurso modelagem de proteinas por homologia
 
Genética – 2 lei de mendel
Genética – 2 lei de mendelGenética – 2 lei de mendel
Genética – 2 lei de mendel
 
Bioquimica
BioquimicaBioquimica
Bioquimica
 
Genética probabilidade slides
Genética probabilidade slidesGenética probabilidade slides
Genética probabilidade slides
 
Introdução à Anatomia e Fisiologia Humana
Introdução à Anatomia e Fisiologia HumanaIntrodução à Anatomia e Fisiologia Humana
Introdução à Anatomia e Fisiologia Humana
 
Sistemanervoso
SistemanervosoSistemanervoso
Sistemanervoso
 
Poríferos e cnidários
Poríferos e cnidáriosPoríferos e cnidários
Poríferos e cnidários
 
Aula sistema digestivo e nutrição
Aula sistema digestivo e nutriçãoAula sistema digestivo e nutrição
Aula sistema digestivo e nutrição
 
Genética probabilidade slides
Genética probabilidade slidesGenética probabilidade slides
Genética probabilidade slides
 
IV.2 Sistema digestório
IV.2 Sistema digestórioIV.2 Sistema digestório
IV.2 Sistema digestório
 
Sistema Digestório
Sistema DigestórioSistema Digestório
Sistema Digestório
 
Fisiologia do sistema_nervoso_e_sistema_neuromuscular
Fisiologia do sistema_nervoso_e_sistema_neuromuscularFisiologia do sistema_nervoso_e_sistema_neuromuscular
Fisiologia do sistema_nervoso_e_sistema_neuromuscular
 
Sistema endócrino slides da aula
Sistema endócrino slides da aulaSistema endócrino slides da aula
Sistema endócrino slides da aula
 
Sistema digestorio slides
Sistema digestorio slidesSistema digestorio slides
Sistema digestorio slides
 
Introdução ao Corpo Humano
Introdução ao Corpo HumanoIntrodução ao Corpo Humano
Introdução ao Corpo Humano
 

Mais de Fabiano Reis

Ciclos de vida dos vegetais
Ciclos de vida dos vegetaisCiclos de vida dos vegetais
Ciclos de vida dos vegetais
Fabiano Reis
 
Histologia vegetal
Histologia vegetalHistologia vegetal
Histologia vegetal
Fabiano Reis
 
Sistema reprodutor masculino
Sistema reprodutor masculinoSistema reprodutor masculino
Sistema reprodutor masculino
Fabiano Reis
 
Sistema nervoso slides
Sistema nervoso slidesSistema nervoso slides
Sistema nervoso slides
Fabiano Reis
 
Genética probabilidade slides
Genética probabilidade slidesGenética probabilidade slides
Genética probabilidade slides
Fabiano Reis
 
Sistema digestorio slides
Sistema digestorio slidesSistema digestorio slides
Sistema digestorio slides
Fabiano Reis
 
Sistema urinario apresentação de slides
Sistema urinario apresentação de slidesSistema urinario apresentação de slides
Sistema urinario apresentação de slides
Fabiano Reis
 
Sistema circulatorio slides da aula
Sistema circulatorio slides da aulaSistema circulatorio slides da aula
Sistema circulatorio slides da aula
Fabiano Reis
 
Sistema respiratorio slides da aula
Sistema respiratorio slides da aulaSistema respiratorio slides da aula
Sistema respiratorio slides da aula
Fabiano Reis
 
Introdução ao estudo da citologia slides
Introdução ao estudo da citologia slidesIntrodução ao estudo da citologia slides
Introdução ao estudo da citologia slides
Fabiano Reis
 
Genética parte1
Genética parte1Genética parte1
Genética parte1
Fabiano Reis
 
Slides estudo das mutaçoes
Slides estudo das mutaçoesSlides estudo das mutaçoes
Slides estudo das mutaçoes
Fabiano Reis
 

Mais de Fabiano Reis (12)

Ciclos de vida dos vegetais
Ciclos de vida dos vegetaisCiclos de vida dos vegetais
Ciclos de vida dos vegetais
 
Histologia vegetal
Histologia vegetalHistologia vegetal
Histologia vegetal
 
Sistema reprodutor masculino
Sistema reprodutor masculinoSistema reprodutor masculino
Sistema reprodutor masculino
 
Sistema nervoso slides
Sistema nervoso slidesSistema nervoso slides
Sistema nervoso slides
 
Genética probabilidade slides
Genética probabilidade slidesGenética probabilidade slides
Genética probabilidade slides
 
Sistema digestorio slides
Sistema digestorio slidesSistema digestorio slides
Sistema digestorio slides
 
Sistema urinario apresentação de slides
Sistema urinario apresentação de slidesSistema urinario apresentação de slides
Sistema urinario apresentação de slides
 
Sistema circulatorio slides da aula
Sistema circulatorio slides da aulaSistema circulatorio slides da aula
Sistema circulatorio slides da aula
 
Sistema respiratorio slides da aula
Sistema respiratorio slides da aulaSistema respiratorio slides da aula
Sistema respiratorio slides da aula
 
Introdução ao estudo da citologia slides
Introdução ao estudo da citologia slidesIntrodução ao estudo da citologia slides
Introdução ao estudo da citologia slides
 
Genética parte1
Genética parte1Genética parte1
Genética parte1
 
Slides estudo das mutaçoes
Slides estudo das mutaçoesSlides estudo das mutaçoes
Slides estudo das mutaçoes
 

Último

Caça - palavras e cruzadinha com dígrafos
Caça - palavras  e cruzadinha   com  dígrafosCaça - palavras  e cruzadinha   com  dígrafos
Caça - palavras e cruzadinha com dígrafos
Mary Alvarenga
 
Apostila em LIBRAS - Curso Básico ENAP 2019.pdf
Apostila em LIBRAS - Curso Básico ENAP 2019.pdfApostila em LIBRAS - Curso Básico ENAP 2019.pdf
Apostila em LIBRAS - Curso Básico ENAP 2019.pdf
pattyhsilva271204
 
Texto e atividade - Fontes alternativas de energia
Texto e atividade -  Fontes alternativas de energiaTexto e atividade -  Fontes alternativas de energia
Texto e atividade - Fontes alternativas de energia
Mary Alvarenga
 
Plano Analitico de Psicopedagogia -11 Classe- II Trimestre - 2024_014203.docx
Plano Analitico de Psicopedagogia -11 Classe- II Trimestre - 2024_014203.docxPlano Analitico de Psicopedagogia -11 Classe- II Trimestre - 2024_014203.docx
Plano Analitico de Psicopedagogia -11 Classe- II Trimestre - 2024_014203.docx
IsaiasJohaneSimango
 
1°ao5°ano_HISTÓRIA_ORGANIZADOR CURRICULAR BIMESTRAL (1) educação infantil fu...
1°ao5°ano_HISTÓRIA_ORGANIZADOR CURRICULAR BIMESTRAL (1)  educação infantil fu...1°ao5°ano_HISTÓRIA_ORGANIZADOR CURRICULAR BIMESTRAL (1)  educação infantil fu...
1°ao5°ano_HISTÓRIA_ORGANIZADOR CURRICULAR BIMESTRAL (1) educação infantil fu...
antonio carlos
 
escrita criativa utilizada na arteterapia
escrita criativa   utilizada na arteterapiaescrita criativa   utilizada na arteterapia
escrita criativa utilizada na arteterapia
shirleisousa9166
 
Aprendizagem Imersiva: Conceitos e Caminhos
Aprendizagem Imersiva: Conceitos e CaminhosAprendizagem Imersiva: Conceitos e Caminhos
Aprendizagem Imersiva: Conceitos e Caminhos
Leonel Morgado
 
Texto e atividade - O que fazemos com a água que usamos.
Texto e atividade -  O que fazemos com a água que usamos.Texto e atividade -  O que fazemos com a água que usamos.
Texto e atividade - O que fazemos com a água que usamos.
Mary Alvarenga
 
Painel para comemerorar odia dos avós grátis.pdf
Painel  para comemerorar odia dos avós grátis.pdfPainel  para comemerorar odia dos avós grátis.pdf
Painel para comemerorar odia dos avós grátis.pdf
marcos oliveira
 
Relatório de Atividades 2009 CENSIPAM
Relatório de Atividades 2009 CENSIPAM Relatório de Atividades 2009 CENSIPAM
Relatório de Atividades 2009 CENSIPAM
Falcão Brasil
 
Infografia | Presidência húngara do Conselho da UE
Infografia | Presidência húngara do Conselho da UEInfografia | Presidência húngara do Conselho da UE
Infografia | Presidência húngara do Conselho da UE
Centro Jacques Delors
 
A perspectiva colaborativa e as novas práticas de inclusão. (1).pptx
A perspectiva colaborativa e as novas práticas de inclusão. (1).pptxA perspectiva colaborativa e as novas práticas de inclusão. (1).pptx
A perspectiva colaborativa e as novas práticas de inclusão. (1).pptx
marcos oliveira
 
Acróstico - Bullying é crime!
Acróstico - Bullying é crime!Acróstico - Bullying é crime!
Acróstico - Bullying é crime!
Mary Alvarenga
 
Auxiliar Adolescente 2024 3 trimestre 24
Auxiliar Adolescente 2024 3 trimestre 24Auxiliar Adolescente 2024 3 trimestre 24
Auxiliar Adolescente 2024 3 trimestre 24
DirceuSilva26
 
Temática – Projeto para Empreendedores Locais
Temática – Projeto para Empreendedores LocaisTemática – Projeto para Empreendedores Locais
Temática – Projeto para Empreendedores Locais
Colaborar Educacional
 
oficia de construção de recursos para aluno DI.pdf
oficia de construção de recursos para aluno DI.pdfoficia de construção de recursos para aluno DI.pdf
oficia de construção de recursos para aluno DI.pdf
marcos oliveira
 
A EDUCAÇÃO COM A INTELIGÊNCIA ARTIFICIAL E AS DEFICIÊNCIAS DE SUA APLICAÇÃO N...
A EDUCAÇÃO COM A INTELIGÊNCIA ARTIFICIAL E AS DEFICIÊNCIAS DE SUA APLICAÇÃO N...A EDUCAÇÃO COM A INTELIGÊNCIA ARTIFICIAL E AS DEFICIÊNCIAS DE SUA APLICAÇÃO N...
A EDUCAÇÃO COM A INTELIGÊNCIA ARTIFICIAL E AS DEFICIÊNCIAS DE SUA APLICAÇÃO N...
Faga1939
 
Alfabetização de adultos.pdf
Alfabetização de             adultos.pdfAlfabetização de             adultos.pdf
Alfabetização de adultos.pdf
arodatos81
 
EBOOK_HORA DO CONTO_O MONSTRO DAS CORES_ANGELINA & MÓNICA_22_23
EBOOK_HORA DO CONTO_O MONSTRO DAS CORES_ANGELINA & MÓNICA_22_23EBOOK_HORA DO CONTO_O MONSTRO DAS CORES_ANGELINA & MÓNICA_22_23
EBOOK_HORA DO CONTO_O MONSTRO DAS CORES_ANGELINA & MÓNICA_22_23
Sandra Pratas
 
(45-ESTUDO - LUCAS) A EPIRITUALIDADE DE JESUS
(45-ESTUDO - LUCAS) A EPIRITUALIDADE DE JESUS(45-ESTUDO - LUCAS) A EPIRITUALIDADE DE JESUS
(45-ESTUDO - LUCAS) A EPIRITUALIDADE DE JESUS
Pr Davi Passos - Estudos Bíblicos
 

Último (20)

Caça - palavras e cruzadinha com dígrafos
Caça - palavras  e cruzadinha   com  dígrafosCaça - palavras  e cruzadinha   com  dígrafos
Caça - palavras e cruzadinha com dígrafos
 
Apostila em LIBRAS - Curso Básico ENAP 2019.pdf
Apostila em LIBRAS - Curso Básico ENAP 2019.pdfApostila em LIBRAS - Curso Básico ENAP 2019.pdf
Apostila em LIBRAS - Curso Básico ENAP 2019.pdf
 
Texto e atividade - Fontes alternativas de energia
Texto e atividade -  Fontes alternativas de energiaTexto e atividade -  Fontes alternativas de energia
Texto e atividade - Fontes alternativas de energia
 
Plano Analitico de Psicopedagogia -11 Classe- II Trimestre - 2024_014203.docx
Plano Analitico de Psicopedagogia -11 Classe- II Trimestre - 2024_014203.docxPlano Analitico de Psicopedagogia -11 Classe- II Trimestre - 2024_014203.docx
Plano Analitico de Psicopedagogia -11 Classe- II Trimestre - 2024_014203.docx
 
1°ao5°ano_HISTÓRIA_ORGANIZADOR CURRICULAR BIMESTRAL (1) educação infantil fu...
1°ao5°ano_HISTÓRIA_ORGANIZADOR CURRICULAR BIMESTRAL (1)  educação infantil fu...1°ao5°ano_HISTÓRIA_ORGANIZADOR CURRICULAR BIMESTRAL (1)  educação infantil fu...
1°ao5°ano_HISTÓRIA_ORGANIZADOR CURRICULAR BIMESTRAL (1) educação infantil fu...
 
escrita criativa utilizada na arteterapia
escrita criativa   utilizada na arteterapiaescrita criativa   utilizada na arteterapia
escrita criativa utilizada na arteterapia
 
Aprendizagem Imersiva: Conceitos e Caminhos
Aprendizagem Imersiva: Conceitos e CaminhosAprendizagem Imersiva: Conceitos e Caminhos
Aprendizagem Imersiva: Conceitos e Caminhos
 
Texto e atividade - O que fazemos com a água que usamos.
Texto e atividade -  O que fazemos com a água que usamos.Texto e atividade -  O que fazemos com a água que usamos.
Texto e atividade - O que fazemos com a água que usamos.
 
Painel para comemerorar odia dos avós grátis.pdf
Painel  para comemerorar odia dos avós grátis.pdfPainel  para comemerorar odia dos avós grátis.pdf
Painel para comemerorar odia dos avós grátis.pdf
 
Relatório de Atividades 2009 CENSIPAM
Relatório de Atividades 2009 CENSIPAM Relatório de Atividades 2009 CENSIPAM
Relatório de Atividades 2009 CENSIPAM
 
Infografia | Presidência húngara do Conselho da UE
Infografia | Presidência húngara do Conselho da UEInfografia | Presidência húngara do Conselho da UE
Infografia | Presidência húngara do Conselho da UE
 
A perspectiva colaborativa e as novas práticas de inclusão. (1).pptx
A perspectiva colaborativa e as novas práticas de inclusão. (1).pptxA perspectiva colaborativa e as novas práticas de inclusão. (1).pptx
A perspectiva colaborativa e as novas práticas de inclusão. (1).pptx
 
Acróstico - Bullying é crime!
Acróstico - Bullying é crime!Acróstico - Bullying é crime!
Acróstico - Bullying é crime!
 
Auxiliar Adolescente 2024 3 trimestre 24
Auxiliar Adolescente 2024 3 trimestre 24Auxiliar Adolescente 2024 3 trimestre 24
Auxiliar Adolescente 2024 3 trimestre 24
 
Temática – Projeto para Empreendedores Locais
Temática – Projeto para Empreendedores LocaisTemática – Projeto para Empreendedores Locais
Temática – Projeto para Empreendedores Locais
 
oficia de construção de recursos para aluno DI.pdf
oficia de construção de recursos para aluno DI.pdfoficia de construção de recursos para aluno DI.pdf
oficia de construção de recursos para aluno DI.pdf
 
A EDUCAÇÃO COM A INTELIGÊNCIA ARTIFICIAL E AS DEFICIÊNCIAS DE SUA APLICAÇÃO N...
A EDUCAÇÃO COM A INTELIGÊNCIA ARTIFICIAL E AS DEFICIÊNCIAS DE SUA APLICAÇÃO N...A EDUCAÇÃO COM A INTELIGÊNCIA ARTIFICIAL E AS DEFICIÊNCIAS DE SUA APLICAÇÃO N...
A EDUCAÇÃO COM A INTELIGÊNCIA ARTIFICIAL E AS DEFICIÊNCIAS DE SUA APLICAÇÃO N...
 
Alfabetização de adultos.pdf
Alfabetização de             adultos.pdfAlfabetização de             adultos.pdf
Alfabetização de adultos.pdf
 
EBOOK_HORA DO CONTO_O MONSTRO DAS CORES_ANGELINA & MÓNICA_22_23
EBOOK_HORA DO CONTO_O MONSTRO DAS CORES_ANGELINA & MÓNICA_22_23EBOOK_HORA DO CONTO_O MONSTRO DAS CORES_ANGELINA & MÓNICA_22_23
EBOOK_HORA DO CONTO_O MONSTRO DAS CORES_ANGELINA & MÓNICA_22_23
 
(45-ESTUDO - LUCAS) A EPIRITUALIDADE DE JESUS
(45-ESTUDO - LUCAS) A EPIRITUALIDADE DE JESUS(45-ESTUDO - LUCAS) A EPIRITUALIDADE DE JESUS
(45-ESTUDO - LUCAS) A EPIRITUALIDADE DE JESUS
 

áCidos nucléicos slides