Estrutura e função do cromossomo eucarioto Edgar Bione
20 Å 110 Å 300 Å 3.000 Å 7.000 Å 14.000 Å
Núcleo: Núcleo Eucromatina Heterocromatina Constitutiva Facultatitutiva Barra 300nm
Cromossomo Eucariótico: Constrição Secundária Centrômero (Constrição primária) Cinetócoro Braço longo q Telômeros Braço cu...
Classificação: Quanto ao tamanho Grande Médio Pequeno Onde: r = razão entre braços ic = índice centromérico l = braço long...
Centrômero: Centromere satellite on  Macropus rufogriseus  metaphase chromosomes (K. Bulazel)
Telêmero: do grego : Telos  = final Meros  = parte Manter a estabilidade estrutural dos cromossomos Ancorar o cromossomo n...
Constrição secundária: Sítios de rDNA DNA moderadamente repetitivo Marcador cromossômico Região Organizadora de nucléolos ...
Características da Cromatina <ul><li>70% proteína </li></ul><ul><ul><li>Histonas (proteínas básicas) </li></ul></ul><ul><u...
Hetrocromatina: <ul><li>Características gerais </li></ul><ul><ul><ul><li>Ausência de atividade gênica </li></ul></ul></ul>...
Exemplos de Het. Facultativa: Inativação de um dos cromossomos X em fêmeas de humanos
O X de gafanhotos:
Bandamento cromossômico: <ul><li>Bandamento C </li></ul><ul><li>Bandamento G, Q e R </li></ul><ul><li>Coloração com Fluoro...
Referências Bibliográficas: <ul><li>Introdução à Genética. Suzuki,  et al.,  4 ª ed. Guanabara Koogan. 1992, Cap. 14. </li...
Cromossomo  r  ic Metacêntrico 1,00 – 1,49 50,0 – 40,1 Submetacêntrico 1,50 – 2,99 40,0 – 25,1 Acrocêntrico 3,00 -  ∞ 25,0...
Quanto ao centrômero:
Bandamento C
Bandamento G
Quinacrina mostarda
Bandamento R
Fluorocromos base-específicos:
Próximos SlideShares
Carregando em…5

2 - Estrutura E Função do Cromossomo Eucarioto

39.928 visualizações

Publicada em

2ª APresentação de aula

0 comentários
2 gostaram
  • Seja o primeiro a comentar

Sem downloads
Visualizações totais
No SlideShare
A partir de incorporações
Número de incorporações
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

2 - Estrutura E Função do Cromossomo Eucarioto

  1. 1. Estrutura e função do cromossomo eucarioto Edgar Bione
  2. 2. Introdução:
  3. 3. 20 Å 110 Å 300 Å 3.000 Å 7.000 Å 14.000 Å
  4. 4. Núcleo: Núcleo Eucromatina Heterocromatina Constitutiva Facultatitutiva Barra 300nm
  5. 5. Cromossomo Eucariótico: Constrição Secundária Centrômero (Constrição primária) Cinetócoro Braço longo q Telômeros Braço curto p Cromátides
  6. 6. Classificação: Quanto ao tamanho Grande Médio Pequeno Onde: r = razão entre braços ic = índice centromérico l = braço longo c = braço curto Quanto a posição do centrômero
  7. 7. Centrômero: Centromere satellite on Macropus rufogriseus metaphase chromosomes (K. Bulazel)
  8. 8. Telêmero: do grego : Telos = final Meros = parte Manter a estabilidade estrutural dos cromossomos Ancorar o cromossomo no envoltório nuclear Iniciar o pareamento dos cromossomos homólogos Principais funções
  9. 9. Constrição secundária: Sítios de rDNA DNA moderadamente repetitivo Marcador cromossômico Região Organizadora de nucléolos RON ou NOR
  10. 10. Cromatina:
  11. 11. Características da Cromatina <ul><li>70% proteína </li></ul><ul><ul><li>Histonas (proteínas básicas) </li></ul></ul><ul><ul><li>não Histonas (proteínas ácidas) </li></ul></ul><ul><li>DNA e RNA (~25% e 5% respectivamente) </li></ul><ul><li>DNA altamente repetitivo (10% do genoma) </li></ul><ul><ul><li>DNA satélite </li></ul></ul><ul><ul><li>contém mais proporção de pb AT ou GC </li></ul></ul><ul><ul><li>encontra-se, geralmente, em blocos no cromossomo </li></ul></ul><ul><ul><li>apresenta seqüências em tandem </li></ul></ul><ul><li>Moderadamente repetitivo </li></ul><ul><ul><li>genes que codificam as histonas </li></ul></ul><ul><ul><li>genes que codificam os RNAr e RNAt </li></ul></ul><ul><li>DNA de seqüências únicas </li></ul><ul><ul><li>contém todos os demais genes estruturais </li></ul></ul>
  12. 12. Hetrocromatina: <ul><li>Características gerais </li></ul><ul><ul><ul><li>Ausência de atividade gênica </li></ul></ul></ul><ul><ul><ul><li>Replicação tardia </li></ul></ul></ul><ul><ul><li>Constitutiva </li></ul></ul><ul><ul><ul><li>permanece condensada durante todo o ciclo celular </li></ul></ul></ul><ul><ul><ul><li>concentra-se em blocos </li></ul></ul></ul><ul><ul><ul><li>encontra-se em ambos homólogos (= tamanho e local) </li></ul></ul></ul><ul><ul><ul><li>geralmente não apresenta genes estruturais </li></ul></ul></ul><ul><ul><ul><li>detém a maior parte do DNA satélite </li></ul></ul></ul><ul><ul><li>Facultativa </li></ul></ul><ul><ul><ul><li>aparece em apenas um cromossomo do par homólogo </li></ul></ul></ul><ul><ul><ul><li>envolve todo o cromossomo ou set cromossômico </li></ul></ul></ul><ul><ul><ul><li>não apresenta particularidades quanto à composição de DNA </li></ul></ul></ul>
  13. 13. Exemplos de Het. Facultativa: Inativação de um dos cromossomos X em fêmeas de humanos
  14. 14. O X de gafanhotos:
  15. 15. Bandamento cromossômico: <ul><li>Bandamento C </li></ul><ul><li>Bandamento G, Q e R </li></ul><ul><li>Coloração com Fluorocromos base-específicos: CMA 3 , DAPI, Quinacrina </li></ul><ul><li>Hibridação in situ fluorescente </li></ul>Pareamento cromossômico Localizar regiões específicas da cromatina Verificar alterações numéricas e estruturais Permite estudos evolutivos em grupos afins
  16. 16. Referências Bibliográficas: <ul><li>Introdução à Genética. Suzuki, et al., 4 ª ed. Guanabara Koogan. 1992, Cap. 14. </li></ul><ul><li>Introdução à Citogenética Geral. Marcelo Guerra. Guanabara Koogan. 1988. </li></ul><ul><li>Genes VI. Lewin, B. Oxford Univ. Press. 1997. Cap. 26. </li></ul><ul><li>Genética Médica. Thompson & Thompson. 6 ª ed. Guanabara Koogan. 2002. Cap. 9. </li></ul><ul><li> </li></ul>
  17. 17. Cromossomo r ic Metacêntrico 1,00 – 1,49 50,0 – 40,1 Submetacêntrico 1,50 – 2,99 40,0 – 25,1 Acrocêntrico 3,00 - ∞ 25,0 – 0,01
  18. 18. TGTGGGTGTGGTG ou G(2-3)(TG)(1-6)T GGGGTCTGGGTGCTG GGTGTACGGATGTCTAACTTCTT GGTGTA[C/A]GGATGTCACGATCATT GGTGTACGGATGCAGACTCGCTT GGTGTAC GGTGTACGGATTTGATTAGTTATGT GGTGTACGGATTTGATTAGGTATGT Saccharomyces cerevisiae Candida glabrata Candida albicans Candida tropicalis Candida maltosa Candida guillermondii Candida pseudotropicalis Kluyveromyces lactis Leveduras TTAGGC Ascaris lumbricoides Nemátodos TTAGG Bombyx mori Insetos TTTTAGGG Chlamydomonas Clorófitos TTTAGGG Arabidopsis thaliana Plantas superiores TTAGGG(T/C) Plasmodium Protozoários (Apicomplexa) TTGGGG TTGGG(T/G) TTTTGGGG Tetrahymena Paramecium Oxytricha, Stylonychia, Euplotes Protozoários ciliados TTAGGG Trypanosoma, Crithidia Protozoários (Kinetoplastea) TTAGGG AG(1-8) Physarum, Didymium Dictyostelium Micetozoários TTAGGG Neurospora crassa Fungos filamentos TTAGGG Humano, Rato, Xenopus Vertebrados Repetição (5' > 3') Organismo Grupo Algumas seqüências de telômeros conhecidas:
  19. 20. Quanto ao centrômero:
  20. 21. Bandamento C
  21. 22. Bandamento G
  22. 23. Quinacrina mostarda
  23. 24. Bandamento R
  24. 25. Fluorocromos base-específicos:
  25. 26. FISH:
