O slideshow foi denunciado.
Utilizamos seu perfil e dados de atividades no LinkedIn para personalizar e exibir anúncios mais relevantes. Altere suas preferências de anúncios quando desejar.

Project presentation

366 visualizações

Publicada em

  • Seja o primeiro a comentar

Project presentation

  1. 1. Surface Entropy Reduction to increase the crystallizability of the Fab-RNA complex<br />Priyadarshini P. Ravindran<br />
  2. 2. INTRODUCTION<br />2<br />
  3. 3. Crystallization of RNA and its Limitations<br />RNA crystals are difficult to obtain because of <br /><ul><li> Tertiary structure flexibility
  4. 4. Fewer surface functional groups
  5. 5. Negatively charged phosphates </li></ul>Hence we are in need for assistive methods for crystallization <br /><ul><li> One such method is the Chaperone Assisted RNA Crystallography (CARC).</li></ul>3<br />
  6. 6. Chaperone Assisted RNA Crystallography<br />Crystallization chaperone - an auxiliary protein such as fragments of monoclonal antibody that binds to RNA of interest and increases its crystallization probability<br />These chaperones<br /> 1. Mask the counterproductive surfaces while extending <br /> surfaces predisposed to forming crystal contacts<br /> 2. Provide good initial phasing information<br /> 3. Reduce conformational heterogenity<br />4<br />
  7. 7. Concept of crystallization chaperones<br />5<br />CurrOpinStructBiol Koide 2009<br />
  8. 8. Schematic Representation of IgG, Fab and Fv<br />http://www.ub.es/biocel/wbc/tecnicas/anticuerpos.htm<br />6<br />
  9. 9. Phage Display as a Platform for Obtaining anti-RNA Antibodies<br />Amenable nuclease; Fast; Economical; High-throughput<br />7<br />
  10. 10. P5a<br />3’<br />P5c<br />5’<br />L6b<br />Crystal Structure (1.95 Å) of ∆C209 P4-P6/Fab2 <br /><ul><li> P4-P6 of Tetrahymena group I intron binds to many Fabs of which Fab2 shows high affinity
  11. 11. Dr.Yeet al, have successfully crystallized this P4-P6/Fab2 complex (1.95Å )</li></ul>P4-P6/Fab2 complex<br />8<br />Ye et al. PNAS 2008<br />
  12. 12. Fab Participates Extensively in Crystal Packing<br />Greenbluegrey: RNA<br />RedMangenta: Fab<br />9<br />
  13. 13. Crystal Structure (1.95 Å) of ∆C209 P4-P6/Fab2 <br />Electron density 2Fo-Fc map calculated with Fab model-based phases. The map is shown around the selected C209 P4-P6 regions at 1 level. <br />4 oC, 25 mM Mg, 36~39% MPD, 0.2 M <br />NH4OAc, 0.1 M Na Citrate pH 5.4~5.9<br />10<br />
  14. 14. Lysine Glutamate<br />RotamersRotamers<br />Surface Entropy Reduction<br /> Rational Protein Crystallization by mutational surface engineering – ZygmuntS.Derewenda<br />Protein-Protein interaction disfavors lysine and glutamate residues, mutating large flexible side chains with smaller amino acid residues like alanine and serine lowers the surface entropy creating hotspots for crystal contact formation<br />Residues to be chosen should not interfere with protein function<br />11<br />
  15. 15. Proof of SER Principle - globular domain of RhoGDI<br />KtoA Series<br />Longenecker, et al., 2001<br />EtoA Series<br />Van der Waal surface representation of RhoGDI with Lysines and glutamates <br />Mateja, et al., 2002 <br />Derewenda & Vekilov ., 2005<br />12<br />
  16. 16. Identifying probable SER mutation residues<br />on ∆C209 P4-P6/Fab2 <br />13<br />
  17. 17. Crystal structure of ∆C209 P4-P6/Fab2 (2R8S)<br />14<br />
  18. 18. A software tool to predict SER mutations<br /><ul><li>Recently Eisenberg’s and Derewenda’s group developed a tool for designing surface mutations for crystallization (http://nihserver.mbi.ucla.edu/SER/)
  19. 19. The suggestions from the web-based surface entropy software are as follows</li></ul>15<br />
  20. 20. Identified SER mutations <br />K217(H)<br />K218(H)<br />E220(H)<br />K190(L)<br />E123(L)<br />Supermutant Alanine(SMA) : ∆C209 P4-P6/Fab2SMA<br />Supermutant Serine (SMS) : ∆C209 P4-P6/Fab2SMS<br />Kunkel mutagenesis - method used to incorporate the mutations<br />Since the 5 mutations are at different locations, 3 Kunkel primers were in use<br />16<br />
  21. 21. Construction of the ∆C209 P4-P6/Fab2 mutants<br />17<br />
  22. 22. Kunkel Mutagenesis<br />CJ236<br />XL1blue<br />M13 Helper phage infection<br />18<br />
  23. 23. Design of Kunkel primers<br />Lys217,Lys218,Glu220 and Stop codon (heavy chain)<br />AGCAACACCAAGGTCGACGCCGCCGTTGCCCCCAAATCTTGTGAC<br />AAACTACACATAGGGCCGGCCCTCTGGTTCC<br />Melting temp 5’end = 56 oC<br />Melting temp 3’end = 64 oC<br />Glu123(Light chain)<br />CTTCATCTTCCCGCCATCTGATGCCCAGTTGAAATCTGGAACTGC<br />Melting temp 5’end = 66 oC<br />Melting temp 3’end = 58 oC<br />Lys190(Light chain)<br />AGCAGACTACGAGAAACACGCCGTCTACGCCTGCGAAGTA<br />Melting temp 5’end = 56 oC<br />Melting temp 3’end = 60 oC<br />GCC a frequent Alanine coding triplet, AGC a frequent Serine coding triplet <br />19<br />
  24. 24. Large scale expression and purification of the Fabs<br />20<br />
  25. 25. Expression and Purification of Fabs<br />P4P6Fab2SMA,P4P6Fab2SMS,P4P6Fab2 clones were transformed into 34B8<br />cells for expression in the CRAP media prepared as per protocol<br />Proteins were purified by affinity chromatography (protein A column) <br />1- Standard protein marker 5-P4P6/Fab2SMS non-reduced<br />2-P4-P6/Fab2SMA reduced 6-P4P6Fab2 reduced<br />3- P4-P6/Fab2SMA non-reduced 7-P4P6Fab2 non-reduced<br />4-P4-P6/Fab2SMS reduced<br />21<br />
  26. 26. 22<br />Optimization of CRAP media for large scale Fab expression<br />Previous protocol<br /><ul><li> 25ml 2YT/ampicillin starting culture at 37 oC O/N
  27. 27. 24 hrs incubation 1L CRAP/ampicillin culture in 2.8 L baffled flask at 30 oC 250 RPM</li></ul>Trials for media optimization for Fab expression-variation in media volume<br />
  28. 28. Optimized protocol <br /><ul><li>25ml 2YT/ampicillin starting culture at 30 oC O/N
  29. 29. 24 hrs incubation 500 ml CRAP/ampicillin culture in 2.8 L baffled flask at 30 oC 300 RPM</li></ul>Indications for good yield are<br />After 24 hr OD600nm >6 <br />Good observable foaming<br />23<br />
  30. 30. Large scale expression and purification of <br />∆C209 P4-P6/Fab2SMA<br />Expression in two batches of 3L each in CRAP/amp media<br />After protein A purification<br /> P4P6Fab2SMA ~ 3.7mg/L<br /> 1 2<br />1 P4P6Fab2SMA<br />2 Standard marker<br />50 kD<br />25 kD<br />24<br />
  31. 31. High S resin purification of ∆C209 P4-P6/Fab2SMA <br />50 kD<br />25 kD<br />1- Standard protein marker<br />4- After protein A column P4P6Fab2SMA<br />7- After 1st round of high S P4P6Fab2SMA <br />8-After 2nd round of high S P4P6Fab2SMA <br />25<br />
  32. 32. Nuclease test activity data for the Fabs binding to <br />∆C209 P4-P6<br />*unrelated RNA added in all the lanes<br />Lane1-P4P6Fab2<br />Lane2-P4P6Fab2SMA <br />Lane3-P4P6Fab2SMS <br />Lane4-Fab storage buffer<br />Lane5-TE buffer<br />Lane6-ddWater<br />1 2 3 4 5 6<br />Intact RNA 87% 91% 89% 90% 92% 92%<br />26<br />
  33. 33. Large scale expression and purification of the Fabs and RNA<br />27<br />
  34. 34. Characterization of the Fab mutants<br />28<br />
  35. 35. Dot-blot apparatus<br />Nitrocellulose membrane<br />Hybond N+ membrane<br />29<br />
  36. 36. Scatter plot showing ∆C209 P4-P6 binding to wild-type and mutant Fabs<br />30<br />Hybond membrane<br />Nitrocellulose<br />membrane<br />
  37. 37. Binding curves for the ∆C209 P4-P6 RNA binding to Fab2, Fab2SMA and Fab2SMS<br />31<br />
  38. 38. Mobility shift analysis of the complex formation between ∆C209P4P6 RNA Fab2,Fab2SMA and Fab2SMS<br />P4P6 Fab2 1:1.1,1:1.2,1:1.3 SMA 1:1.1,1:1.2,1:1.3,1:1.4 SMS 1:1.1,1:1.2,1:1.3,1:1.4<br />32<br />P4P6/Fab2<br />P4P6/Fab2 mutants<br />P4P6<br />A working stoichiometric ratio of RNA: Fab =1:1.1 was determined.<br />
  39. 39. Crystallization of ∆C209 P4-P6 and the Fab2 mutant complexes<br />33<br />
  40. 40. Initial Crystal screening for P4-P6/Fab2, P4-P6/Fab2SMA, P4-P6/Fab2SMS complexes<br />We have set up the crystal screening using the Hampton Crystal Screen I&II (96) and Index kit (96) and Natrix Crystal Screen I&II (96)<br />Sitting drop technique<br />Crystal screening conditions: <br />Sample: P4-P6/Fab2, P4-P6/Fab2SMAandP4-P6/Fab2SMS<br />Sample concentration: 12mg/ml<br />Sample buffer: 10mM Tris pH7.5, 25mM MgCl2, 50mM NaCl, 0.5mM <br />Spermine-4HCl and RNase inhibitor<br />Reservoir volume: 100 μl Temperature: 4 oC and 20 oC<br />Drop volume -1 μl Sample: 0.5 μl and Reservoir: 0.5μl<br />34<br />
  41. 41. Sitting drop method ∆C209 P4-P6/Fab2 mutant crystals at 20 oC<br />∆C209 P4-P6/Fab2SMA crystal 0.15M DL-Malic acid pH 7.0, 20%w/v PEG 3,350 at 20 oC<br />∆C209 P4-P6/Fab2SMA crystal 0.2 M Magnesium chloride hexahydrate, 0.1 M Tris Ph 8.5, 3.4M 1,6-Hexanediol at 20 oC<br />∆C209 P4-P6/Fab2SMA 0.01 M Magnesium chloride hexahydrate, 0.05M MES monohydrate ph 5.6, 1.8 M Lithium sulfate monohydrate <br />at 20 oC<br />35<br />∆C209 P4-P6/Fab2SMS crystal 2.0 M NaCl, 10%w/v PEG 6000 at 20 oC<br />
  42. 42. Sitting drop method ∆C209 P4-P6/Fab2 mutant crystals at 4 oC<br />∆C209 P4-P6/Fab2SMA 0.2 M Ammonium acetate, 0.1M Sodium citrate tribasicdihydrate pH 5.6, 30%v/v(+/-)-2-Methyl-2, 4-pentanediol at 4 oC<br />∆C209 P4-P6/Fab2SMS 0.2 M Ammonium acetate, 0.1M Sodium citrate tribasicdihydrate pH 5.6, 30%v/v(+/-)-2-Methyl-2, 4-pentanediol at 4 oC<br />36<br />
  43. 43. 37<br />Optimization results using hanging drop technique<br />
  44. 44. Surface engineered Fabs bind to VCIII glycineriboswitch<br />38<br />Strobel 2008<br />
  45. 45. Surface engineered Fabs bind to VCIII glycineriboswitch<br />39<br />
  46. 46. Conclusion<br /><ul><li>Using visual inspection and web-based software, 5 sites for surface entropy reduction on Fab surface were selected, mutations were incorporated and clones were isolated
  47. 47. Optimisation of the shake flask expression of Fabs to 3-4mg/L was performed
  48. 48. Initial screening of all Fabscomplexed with P4-P6 side-by-side was performed to determine the crystal hit ratio using commercially available crystallization screening kits
  49. 49. Two new crystal forms showed diffraction</li></ul> VCIII binding SER mutant Fabs show good binding to VCIII indicating the generality of the SER mutations <br />40<br />
  50. 50. Future Directions<br />Using gel-filtration column to purify the Fab-RNA complex and employ seeding technique to get better resolution crystals<br />Incorporation of the two other lysine mutations from the Category A K76(H), K169(L)<br />Promotion of anti-parallel β sheet formation-crystal contact engineering<br />41<br />
  51. 51. 42<br />
  52. 52. Questions<br />43<br />
  53. 53. Background slides<br />44<br />
  54. 54. Hanging drop technique<br />Sitting drop technique<br />45<br />
  55. 55. Crystals are like structure amplifiers<br />Molecule<br />Unit cell<br />Crystal lattice<br />
  56. 56. CRAP media components<br />Adjust pH to 7.3, autoclave.Then add the following (these solutions should be filtered sterile!) to cooled CRAP media (room temperature)<br />47<br />
  57. 57. Fab Storage buffer composition<br /> 10 mMTris PH 7.5 and 50mM NaCl<br />48<br />
  58. 58. Phage ELISA<br />From Phage Display individual clones are picked and screened by phage ELISA, positive clones are identified through plate reader (visible region), sequenced, expressed as soluble Fabs, and purified.<br /><ul><li>To make sure that we have more phage carried through from the RNA than from the beads.</li></ul>From Phage Display<br />TMB<br />Anti-M13/HRP<br />Phage<br />RNA/or non-RNA<br />NAV<br />
  59. 59. If two yellow colors: M-13 binded to NAV so discard.<br />If no color: M-13 didn’t bind to clone so no phage is present.<br />Clone will have yellow color (binding) and control should have no color or intensity 3-10x less.<br />Phage ELISA<br />
  60. 60. 51<br />Crystal structure of class I ligase/BL3-6 (3IVK)<br />Koldobskaya et al. NSMB 2010<br />
  61. 61. Small scale extraction of mutated DNA<br />Sequencing analysis of the mutated DNA <br />3/4 clones showed successful incorporation of alanine in both heavy chain and light chain <br />0/4 showed incorporation of serine in both chains<br />Light chain serine mutations were added in the subsequent step(single strand extraction of mutated heavy chain) <br />Kunkel mutagenesis was performed on ∆C209 P4-P6/Fab2 to incorporate the stop codon<br />Positive clones were identified by colony PCR, DNA was extracted by mini-prep and pooled together<br />Construction of Fabmutants <br />52<br />
  62. 62. 53<br />Crystal contacts residues in several Fab-4D5 derivative containing structures<br />
  63. 63. Examples of proteins crystallized using SER<br />The RGSL domain of PDZRhoGEF<br />Longenecker KL, et al. & Derewenda Z.S. Structure (2001) <br />Unactivated insulin-like growth factor-1 receptor kinase<br />Munshi, S. et al. & Kuo, L.C. ActaCryst (2003) <br />Outer surface protein A of Borreliaburgdorferi<br />Makabe, et al., Protein Science (2006) <br />c-Src and its inactivatorCsk<br />Levinson, et al., Cell (2008)<br />54<br />
  64. 64. 55<br />

×