2. Cell Inoculation
As determined by hemocytometry, single cell suspensions of hu-
man pulp cells were seeded in 24-well tissue culture plates at 5 ϫ 104
cells per well in complete DMEM and incubated in a humidified atmo-
sphere of air and 5% CO2 at 37°C for 24 hours.
Preparation of Test Materials
Four materials listed in Table 1 were tested. Portland cement
(0.5 g) was mixed with sterile distilled water (0.2 ml) on a glass slab,
and the other materials were mixed according to the manufacturers’
recommendations. Subsequently, all materials were placed at the bot-
tom of an insert well, which had a membrane pore diameter of 0.4 m.
After setting for 24 hours, the insert wells were exposed to ultraviolet
(UV) light, placed inside the culture wells, and incubated for 12, 24, 48,
and 72 hours.
MTT Assay
After exposure to the materials for 12, 24, 48, and 72 hours, viable
cells were detected using the MTT dye, which forms blue formazan
crystals that are reduced by the mitochondrial dehydrogenase present
in living cells. Briefly, 200 l of MTT solution [2 mg/ml in phosphate-
buffered saline (PBS)] was added to each well, and the wells were
incubated for 4 hours. Subsequently, 200 l of DMSO was added to
each well. The plates were then shaken until the crystals had dissolved,
and the solution in each well was transferred to a 96-well tissue culture
plate. Reduced MTT was then measured spectrophotometrically at 540
nm in a dual-beam microtiter plate reader. One-way ANOVA (p ϭ 0.05)
and Duncan’s multiple range tests were used for statistical analysis.
SEM Analysis
Under aseptic conditions materials were condensed into 2- ϫ
20-mm round acrylic molds. Materials were allowed to set for 24 hours
in a humidified incubator at 37°C. The disks were all placed at the
bottom of 12-well tissue culture plates.
Human pulp cells were seeded at 1.0 ϫ 105
cells per well on the
prepared materials. After a 24-hour incubation period, the dishes were
fixed with 2.5% glutaraldehyde for 2 hours. Samples were then dehy-
drated in increasing concentrations of ethanol (70%, 80%, 90%, 95%,
and 100%) for 20 minutes at each concentration, immersed in tert-
butanol for 20 minutes, and freeze-dried for 24 hours. SEM was per-
formed using a JSM-6360 (JEOL) system operated at 10 kV.
RT-PCR Gene Expression Analysis
Cells (1 ϫ 105
) in DMEM containing 10% serum were seeded in
6-well tissue culture plates and incubated for 24 hours. After an initial
attachment period of 24 hours, the medium was switched to mineral-
izing medium for the duration of the experiment. Portland cement was
mixed and placed at the bottom of an insert well having a membrane
pore diameter of 0.4 m. After setting for 6 hours, insert wells were
placed inside the culture wells and incubated for 7 days.
After 7 days of culture, the media were removed, and total RNA was
extracted using the Trizol reagent (Life Technologies) according to the
manufacturer’s instructions. Reverse transcription of RNA was per-
formed using AccuPower RT PreMix (Bioneer). Thereafter, the RT-
generated DNA (2–5 l) was amplified using AccuPower PCR PreMix
(Bioneer). Amplification was carried out for 30 cycles in a DNA thermal
cycler. Primer sequences for ON, DSPP, and GAPDH are detailed in
Table 2. The PCR products were resolved on a 1.5% agarose gel and
stained with ethidium bromide.
Results
MTT Assay
With the exception of Portland cement, all the other materials
(including GIC, IRM, and Dycal) showed a marked decrease in cell
viability within 12 hours (as shown in Fig. 1). The Portland cement
group showed statistically higher cell viability than the other groups at
12, 24, 48, and 72 hours. Moreover, the Portland cement group exhib-
ited cell viability similar to that of the control group until 72 hours.
Therefore, in comparison with the other groups, the Portland cement
group showed no cytotoxicity.
TABLE 2. Primer sets and PCR conditions
Protein Sequence (5=-3=)
Size
(bp)
Tm
(°C)
ON Forward: ACATGGGTGGACACGG
Reverse: CCAACAGCCTAATGTGAA
405 52
DSPP Forward: AATGGGACTAAGGAAGCTG
Reverse: AAGAAGCATCTCCTCGGC
814 54
GAPDH Forward: CGGAGTCAACGGATTTGGTCGTAT
Reverse: AGCCTTCTCCATGGTGGTGAAGAC
306 54
TABLE 1. Composition of the materials tested in this study
Name (Manufacturer) Components Composition
Portland Cement (Ssangyong, Korea) Powder Tricalcium silicate, dicalcium silicate, tricalcium aluminate, tetracalcium
aluminoferrite, hydrated calcium sulphate
Fuji II LC (GC, Japan) Powder Aluminosilicate glass
Liquid Polyacrylic acid. HEMA
IRM (Dentsply-Caulk) Powder Zinc oxide, polymethylmethacrylate
Liquid Eugenol, acetic acid
Dycal (Dentsply-Caulk) Base Disalicylate ester, calcium-phosphate, calcium tungstate, zinc oxide, iron oxide
Catalyst Calcium hydroxide, ethyl toluenesulfonamide, zinc state, titanium dioxide,
zinc oxide, iron oxide
Figure 1. Effects of Portland cement, GIC, IRM, and Dycal on cultured human
pulp cells measured by the MTT assay. Each point and bar represents the
mean Ϯ SD; *p Ͻ 0.05.
Basic Research—Technology
164 Min et al. JOE — Volume 33, Number 2, February 2007
3. SEM Analysis
In the GIC, IRM, and Dycal groups, a few rounded cells were
observed on the materials, but no living cells were seen (Fig. 2B, C, D).
In contrast, the Portland cement group showed flattened cells in close
proximity to one another, and these were seen to be spreading across
the substrate. Numerous thin cytoplasmic extensions were also ob-
served, and these projected from the cell to the surrounding surface or
adjacent cells (Fig. 2A).
RT-PCR Gene Expression Analysis
We examined the Portland cement–induced expression of ON and
DSPP mRNAs in human pulp cells. As shown in Fig. 3, the expression of
ON and DSPP mRNAs was induced in human pulp cells. Furthermore,
the expression of the ON mRNA in the Portland cement group was
similar to that of the dexamethasone-treated group (Fig. 3). These RT-
PCR results suggested that Portland cement has an inductive effect on
mineralization.
Discussion
Ideally, pulp-capping materials should be biocompatible, of
low toxicity, and capable of facilitating mineralization. Over the past
decade, a new material (MTA) was developed as an endodontic
material. Many in vivo and in vitro studies have reported that this
material is biocompatible (18–20). Recently, findings of studies
where MTA was compared with Portland cement have shown that
these two materials appear to be almost identical (21, 22). Although
Portland cement is considered to be a less-expensive biocompatible
pulp-capping material, its mechanism of action in human pulp cells
is still not completely clear (21, 23). In this study, we attempted to
evaluate the biologic effects of Portland cement on cultured human
pulp cells by means of a cell viability test, SEM observation, and
RT-PCR analysis.
Thecytotoxicityofmaterialsusedinthepulp-cappingprocedureis
of great concern, because damage or irritation could cause degenera-
tion of the pulp tissue and delayed wound healing. In this study, GIC,
IRM, and Dycal induced a strong cytotoxic effect; however, Portland
cement did not interfere with the proliferation of human pulp cells. This
biocompatibility of Portland cement is in agreement with the results
obtained from studies using Chinese hamster ovary cells and human
osteosarcoma cells (9, 11).
Cell adhesion is a complex and dynamic process that plays a
critical role in wound healing and has implications in cell growth,
proliferation, and differentiation (24). In this study, human pulp
cells cultured on Portland cement for 24 hours appeared to be flat
and exhibited well-defined cytoplasmic extensions that projected
from the cells to the surrounding surface or adjacent cells. The
preservation of cytoplasmic extensions is important, because these
extensions form a three-dimensional network within hard tissue and
materials (10).
In this odontoblast differentiation study, we analyzed mineraliza-
tion markers such as ON and DSPP by using cultured human pulp cells
grown on Portland cement. ON, which is a 43-kDa phosphoglycopro-
tein, is a noncollagenous protein synthesized by human osteoblasts. It
represents 2 to 3% of the total protein present in developing bone tissue
Figure 2. SEM observation of cells incubated for 24 hours on (A) Portland cement (ϫ300), (B) GIC (ϫ500), (C) IRM (ϫ500), and (D) Dycal (ϫ500).
Figure 3. Effects of Portland cement on the expression of ON and DSPP mRNAs
in human pulp cells. Total RNA was extracted from the cells and the expression
levels of the mRNAs were determined by RT-PCR as described in Materials and
Methods.
Basic Research—Technology
JOE — Volume 33, Number 2, February 2007 Human Pulp Cells Response to Portland Cement In Vitro 165
4. (25, 26). ON has also been observed in bovine odontoblasts (27, 28)
and cultured human pulp cells (29). In this study, the expression of ON
mRNA on Portland cement was similar to that of the dexamethasone-
treated positive control. This result indicated that Portland cement plays
an important role in the mineralization of tooth structure.
DSPP has been considered to play a regulatory role in the miner-
alization of reparative dentin and can serve as a specific marker for the
odontoblast phenotype. Iohara et al. (30) reported that the expression
of DSPP mRNA confirmed the differentiation of pulp cells into odonto-
blasts. As shown in Fig. 3, DSPP gene expression was observed on
Portland cement and controls. This result suggested that dentin forma-
tion during the pulp-capping procedure might be facilitated in the pres-
ence of Portland cement.
Collectively, our results indicate that Portland cement is not cyto-
toxic and permits cellular attachment and growth. Furthermore, this
study demonstrated that Portland cement allows the expression of
mRNAs of a dentin-specific protein and a noncollagenous protein in-
volved in mineralization in cultured human pulp cells.
Acknowledgments
This paper was supported by Wonkwang University in 2006.
References
1. Schröder U. Effects of calcium hydroxide-containing pulp-capping agents on pulp
cell migration, proliferation, and differentiation. J Dent Res 1985;64:541–8.
2. Mjör IA, Dahl E, Cox CF. Healing of pulp exposures: an ultrastructural study. J Oral
Pathol Med 1991;20:496–501.
3. Dominguez MS, Witherspoon DE, Gutmann JL, Opperman LA. Histological and scan-
ningelectronmicroscopyassessmentofvariousvitalpulp-therapymaterials.JEndod
2003;29:324–33.
4. Faraco IM Jr., Holland R. Response of the pulp of dogs to capping with mineral
trioxide aggregate or a calcium hydroxide cement. Dent Traumatol 2001;17:163–6.
5. Torabinejad M, Hong CU, Pitt Ford TR, Kettering JD. Cytotoxicity of four root end
filling materials. J Endod 1995;21:489–92.
6. Torabinejad M, Smith PW, Kettering JD, Pitt Ford TR. Comparative investigation of
marginal adaptation of mineral trioxide aggregate and other commonly used root-
end filling materials. J Endod 1995;21:295–9.
7. Ribeiro DA, Duarte MA, Matsumoto MA, Marques ME, Salvadori DM. Biocompatibil-
ityinvitrotestsofmineraltrioxideaggregateandregularandwhitePortlandcements.
J Endod 2005;31:605–7.
8. De Deus G, Ximenes R, Gurgel-Filho ED, Plotkowski MC, Coutinho-Filho T. Cytotox-
icity of MTA and Portland cement on human ECV 304 endothelial cells. Int Endod J
2005;38:604–9.
9. Ribeiro DA, Sugui MM, Matsumoto MA, Duarte MA, Marques ME, Salvadori DM.
Genotoxicity and cytotoxicity of mineral trioxide aggregate and regular and white
Portland cements on Chinese hamster ovary (CHO) cells in vitro. Oral Surg Oral Med
Oral Pathol Oral Radiol Endod 2006;101:258–61.
10. Abdullah D, Ford TR, Papaioannou S, Nicholson J, McDonald F. An evaluation of
accelerated Portland cement as a restorative material. Biomaterials 2002;23:
4001–10.
11. Camilleri J, Montesin FE, di Silvio L, Pitt Ford TR. The chemical constitution and
biocompatibility of accelerated Portland cement for endodontic use. Int Endod J
2005;38:834–42.
12. Goldberg M, Lasfargues JJ. Pulpo-dentinal complex revisited. J Dent 1995;23:15–20.
13. Couble ML, Farges JC, Bleicher F, Perrat-Mabillon B, Boudeulle M, Magloire H.
Odontoblast differentiation of human dental pulp cells in explant cultures. Calcif
Tissue Int 2000;66:129–38.
14. Butler WT. Sialoproteins of bone and dentin. J Biol Buccale 1991;19:83–9.
15. Reichert T, Storkel S, Becker K, Fisher LW. The role of osteonectin in human tooth
development: an immunohistological study. Calcif Tissue Int 1992;50:468–72.
16. Chen S, Rani S, Wu Y, et al. Differential regulation of dentin sialophosphoprotein
expression by Runx2 during odontoblast cytodifferentiation. J Biol Chem 2005;
280:29717–27.
17. Papagerakis P, Berdal A, Mesbah M, et al. Investigation of osteocalcin, osteonectin,
and dentin sialophosphoprotein in developing human teeth. Bone 2002;30:377–85.
18. Masuda YM, Wang X, Hossain M, et al. Evaluation of biocompatibility of mineral
trioxide aggregate with an improved rabbit ear chamber. J Oral Rehabil 2005;
32:145–50.
19. Osorio RM, Hefti A, Vertucci F, Shawley AL. Cytotoxicity of endodontic materials.
J Endod 1998;24:91–6.
20. Thomson TS, Berry JE, Somerman MJ, Kirkwood KL. Cementoblasts maintain expres-
sion of osteocalcin in the presence of mineral trioxide aggregate. J Endod
2003;29:407–12.
21. Menezes R, Bramante CM, Letra A, Carvalho VG, Garcia RB. Histologic evaluation of
pulpotomies in dog using two types of mineral trioxide aggregate and regular and
white Portland cements as wound dressings. Oral Surg Oral Med Oral Pathol Oral
Radiol Endod 2004;98:376–9.
22. Saidon J, He J, Zhu Q, Safavi K, Spangberg LSW. Cell and tissue reactions to mineral
trioxide aggregate and Portland cement. Oral Surg Oral Med Oral Pathol Oral Radiol
Endod 2003;95:483–9.
23. Holland R, de Souza V, Murata SS, et al. Healing process of dog dental pulp after
pulpotomy and pulp covering with mineral trioxide aggregate or Portland cement.
Braz Dent J 2001;12:109–13.
24. PérezAL,SpearsR,GutmannJL,OppermanLA.OsteoblastsandMG-63osteosarcoma
cells behave differently when in contact with ProRoot™ MTA and white MTA. Int
Endod J 2003;36:564–70.
25. Termine JD, Kleinman HK, Whitson SW, Conn KM, McGarvey ML, Martin GR. Os-
teonectin, a bone-specific protein linking mineral to collagen. Cell 1981;26:99–105.
26. Romberg RW, Werness PG, Lollar P, Riggs BL, Mann KG. Isolation and characteriza-
tion of native adult osteonectin. J Biol Chem 1985;260:2728–36.
27. Fujisawa R, Kuboki Y. Changes in levels of ON in bovine dentin during tooth devel-
opment. Arch Oral Biol 1989;34:89–92.
28. Jontell M, Linde A. Non-collagenous proteins of predentin from dentinogenically
active bovine teeth. Biochem J 1983;214:769–76.
29. Alliot-Licht B, Bluteau G, Magne D, et al. Dexamethasone stimulates differentiation of
odontoblast-like cells in human dental pulp cultures. Cell Tissue Res 2005;
321:390–400.
30. Iohara K, Nakashima M, Ito M, Ishikawa M, Nakasima A, Akamine A. Dentin regen-
eration by dental pulp stem cell therapy with recombinant human bone morphoge-
netic protein 2. J Dent Res 2004;83:590–5.
Basic Research—Technology
166 Min et al. JOE — Volume 33, Number 2, February 2007