Gregor Johann Mendel  - Século XIX
 
GENOMA HUMANO
Bata as claras em neve, junte as gemas e o açúcar aos poucos, sempre batendo. Misture a farinha de trigo juntamente com o ...
<ul><li>Bata as claras em neve, junte as gemas e o açúcar aos poucos, sempre batendo.  </li></ul><ul><li>Misture a farinha...
TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTC...
Duas versões de cada gene (materna + paterna) A 1 A 2 B 1 B 2 C 1 C 2 D 1 D 2 A 3 A 4 B 3 B 4 C 3 C 4 D 3 D 4 A 2 A 4 B 1 ...
 
 
Duas versões de cada gene (materna + paterna) A 1 A 2 B 1 B 2 C 1 C 2 D 1 D 2 A 3 A 4 B 3 B 4 C 3 C 4 D 3 D 4 A 2 A 4 B 1 ...
<ul><li>A 1 </li></ul><ul><li>Bata as claras em neve, junte as gemas e o açúcar aos poucos, sempre batendo.  </li></ul><ul...
<ul><li>A 1 </li></ul><ul><li>Bata as claras em neve, junte as gemas e o açúcar aos poucos, sempre batendo.  </li></ul><ul...
FIGURA 4 - ALELOS  e  SNPs a1 a2 a3 a4 a6 a5  a  Gene “A” : ALELOS do gene “A” ...ATTGGCACG...TGCATTAGCA.....AGTTGCATAGC.....
TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTC...
TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTC...
TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTC...
 
FIGURA 4 - ALELOS  e  SNPs a1 a2 a3 a4 a6 a5  a  Gene “A” : ALELOS do gene “A” ...ATTGGCACG...TGCATTAGCA.....AGTTGCATAGC.....
 
Migração Homo Sapiens
TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTC...
<ul><li>Bata as claras em neve, junte as gemas e o açúcar aos poucos, sempre batendo.  </li></ul><ul><li>Misture a farinha...
 
FUNÇÃO DOS 26.383 GENES HUMANOS
TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTC...
GENE DEFEITUOSO TERAPIA DIRECIONADA TERAPIA GÊNICA Projeto Genoma Humano: DOENÇAS GENÉTICAS DIAGNÓSTICO
“ TUDO” É REGULADO POR GENES! Formato e funcionamento do corpo, dos órgãos Cor da pele, dos olhos, do cabelo ... Cicatriza...
Projeto Genoma Humano: IMPACTO NA MEDICINA “ MEDICINA GENÉTICA” PREVENTIVA Adequar o estilo de vida  de acordo com a genét...
 
 
 
 
FARMACOGENÉTICA Resposta a drogas 6-mercaptopurina leucemia infantil polimorf.  TPMT  -> toxicidade CYP2D6  +  CYP2C19  = ...
 
 
= Projeto Genoma Humano: IMPACTO NA MEDICINA Medicina PÓS-GENOMA Medicina ATUAL Medicina ATUAL Medicina MEDIEVAL
Ethical, Legal, and Social Issues (ELSI) 5% da verba total do PGH Impacto psicológico Privacidade Determinismo Eugenia Com...
DISCRIMINAÇÃO GENÉTICA Seguro de saúde/vida; Emprego; Escolas; PRIVACIDADE GENÉTICA
 
47,XY,+13 47,XY,+18 EUGENIA
EUGENIA Doença Gordura Cor dos olhos QI SEXO DOENÇA  x  VARIAÇÃO NORMAL
DETERMINISMO GENÉTICO GENÉTICA  +  MEIO AMBIENTE
TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTC...
1953 Estrutura do DNA (Watson & Crick) 1972 1 a  molécula DNA recombinante (P.Berg) 1977 Sequenciamento de DNA (Maxam & Gi...
 
BIOLOGIA SINTÉTICA
 
 
 
 
20/5/2010
 
TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTC...
 
CLONAGEM
1997: A REVOLUÇÃO DOLLY !
 
 
músculo pele neurônio Identidade celular: conjunto de genes ligados/desligados.
RAIZ FOLHAS SEMENTES
Transferência Nuclear (1950’s) célula  da pele núcleo óvulo com núcleo transferido Sapo A Sapo B clone transferir núcleo p...
 
1997 1998 2000 A clonagem pós-Dolly ?
PORQUÊ CLONAR HUMANOS ? Copiar alguém “interessante”
 
PORQUÊ CLONAR HUMANOS ? Copiar alguém “interessante” Opção para casais estéreis Gerar “doadores de órgãos”
 
277 29 Matemática da Clonagem ????? “ DAR CERTO” ???
TAXAS DE “SUCESSO” DA CLONAGEM Célula doadora Espécie Oócitos Nascimentos Obs. reconstr. vivos Fetal Fibroblasto Camundong...
“ DAR CERTO” ??? longevidade predisposição para câncer reprodução filhos netos ...
 
CLONAGEM
CLONAGEM REPRODUTIVA CLONAGEM TERAPÊUTICA
RAIZ FOLHAS SEMENTES
CÉLULAS-TRONCO
Fontes de tecidos e órgãos para transplante: doadores (5-10%); órgãos artificiais; órgãos de animais (xenotransplante); en...
CÉLULA TRONCO “  Células com capacidade de   AUTO-RENOVAÇÃO   ilimitada/prolongada, capazes de produzir pelo menos um tipo...
CÉLULAS TRONCO “ADULTAS” vs. CÉLULAS TRONCO EMBRIONÁRIAS
CÉLULAS TRONCO “ADULTAS” CÉLULAS TRONCO EMBRIONÁRIAS
CTs “adultas” – MEDULA ÓSSEA
CTs “adultas” – plasticidade/trans-diferenciação
 
 
 
 
 
 
Ensaios Clínicos em Humanos no Brasil 144 pacientes Brasileiros com cardiopatias e infartos tratados com células tronco:  ...
CTs “adultas” – plasticidade/trans-diferenciação medula óssea
CÉLULAS TRONCO “ADULTAS” NOVAS FONTES
1989:  Sangue do cordão umbilical é fonte de células-tronco hematopoéticas
CÉLULAS TRONCO “ADULTAS” NOVAS FONTES (em desenvolvimento) Lipoaspirado Polpa do dente de leite Líquido amniótico Placenta...
CÉLULAS TRONCO “ADULTAS” CÉLULAS TRONCO EMBRIONÁRIAS
PLURIPOTENTES cultura botão embrionário Células-tronco EMBRIONÁRIAS (ES) – 1980’s
teratoma PLURIPOTENCY  in vivo :  Injection into SCID mice endoderm mesoderm ectoderm
bIII-tub
 
Science vol. 282, 6 Nov., 1998
Tecidos/Células para Terapia Medula Óssea Neurônios Células do Músculo Cardíaco  Células do  Pâncreas Células-Tronco A Pro...
 
 
hES: DESAFIOS SEGURANÇA COMPATIBILIDADE ÉTICA/LEGISLAÇÃO
 
 
DIFERENCIAÇÃO: Desenvolvimento Embrionário Células-Tronco Embrionárias: Lições de 25 Anos de Pesquisa
 
A Importância da  Pesquisa Básica Para a  Célula-Tronco Embrionária   A Importância da  Célula-Tronco Embrionária   Para a...
POLÊMICA: Ser-Humano ou Aglomerado de Células? Células-Tronco Embrionárias: Lições de 25 Anos de Pesquisa
Lei de Biossegurança 2005 embriões FIV > 3 anos e congelados < Março 2005; proíbe clonagem humana.
(ADI) Nº 3.510 contra o Art. 5º da Lei de Biossegurança Nº 11.105 de 24 de março de 2005   <ul><li>“ que a vida humana aco...
<ul><li>“ que a vida humana acontece na, e a partir da, fecundação”; </li></ul><ul><li>“ a pesquisa com  células-tronco ad...
... ... ...? FORMAS de vida humana ?
EXPECTATIVA: Verdades Absolutas ou Transitórias? Células-Tronco Embrionárias: Lições de 25 Anos de Pesquisa
 
 
Transplante de Coração
Cenário 2030 Genoma: susceptibilidade   genética; medicina genética preventiva; medicina personalizada; diagnósticos e dro...
Cenário 2030 Biologia Sintética: novos seres-vivos em função do homem. Clonagem: animal; humana?? Células-tronco: conhecim...
 
CONHECIMENTO PODER   RESPONSABILIDADE
 
Conceito básico: todas as células contém o genoma completo. músculo pele neurônio
músculo pele neurônio Identidade celular: conjunto de genes ligados/desligados.
Expressão alta baixa linfóide mielóide genes pacientes DIAGNÓSTICO “GENÔMICO” Chip de DNA :  leucemia linfóide vs.  mielói...
 
“ Vida” x Vida
LEI DE BIOSSEGURAN Ç A APROVAÇÃO 2005 PERMITE o uso do embri ã o humano CONGELADO > 3ANOS PROIBE a clonagem terapeutica pa...
Reino Unido França  EUA Alemanha Portugal Canadá Bélgica Japão Coréia do Sul clonagem terapêutica embrião Aut.Embr.Fert.Hu...
 
LEI DE BIOSSEGURAN Ç A EXPECTATIVAS DA POPULAÇÃO… Dra. Lygia, agora que o projeto de Lei de Biossegurança foi aprovado,  Q...
New Lines of Human Embryonic Stem Cells
a b c 10x 4x d e f 10x 4x 4x 4x
 
Karyotype passage 5: 46,XY BR-1
TRANSGÊNICOS
PROBLEMA: Alimentar a população mundial. SOLUÇÕES: Aumentar a área plantada;  Diminuir a população; Aumentar a produtivida...
TRANSGÊNICOS São seguros??? Culpados até provem o contrário Liberação facilitada X
PROBLEMA: Alimentar a população mundial. SOLUÇÕES: Aumentar a área plantada;  Diminuir a população; Aumentar a produtivida...
Próximos SlideShares
Carregando em…5
×

Curso de Vereão 2011 - Genoma e células tronco

2.631 visualizações

Publicada em

Curso de Vereão 2011 - Genoma e células tronco

  • Seja o primeiro a comentar

  • Seja a primeira pessoa a gostar disto

Curso de Vereão 2011 - Genoma e células tronco

  1. 1. Gregor Johann Mendel - Século XIX
  2. 3. GENOMA HUMANO
  3. 4. Bata as claras em neve, junte as gemas e o açúcar aos poucos, sempre batendo. Misture a farinha de trigo juntamente com o Chocolate em Pó e o fermento e despeje sobre as claras, misturando delicadamente. Asse em fôrma redonda (25 cm de diâmetro), untada e enfarinhada e asse em forno médio (180º C) preaquecido por cerca de 40 minutos. Desenforme e deixe esfriar. Depois de frio, corte ao meio e umedeça com o rum. Recheie com parte do chantilly e as cerejas. Cubra com o chantilly restante e raspas de chocolate. Decore com as cerejas inteiras. “ GENOMA”
  4. 5. <ul><li>Bata as claras em neve, junte as gemas e o açúcar aos poucos, sempre batendo. </li></ul><ul><li>Misture a farinha de trigo juntamente com o Chocolate em Pó e o fermento e despeje sobre as claras, misturando delicadamente. </li></ul><ul><li>Asse em fôrma redonda (25 cm de diâmetro), untada e enfarinhada e asse em forno médio (180º C) pré-aquecido por cerca de 40 minutos. </li></ul><ul><li>Desenforme e deixe esfriar. </li></ul><ul><li>Depois de frio, corte ao meio e umedeça com o rum. </li></ul><ul><li>Recheie com parte do chantilly e as cerejas. </li></ul><ul><li>Cubra com o chantilly restante e raspas de chocolate. </li></ul><ul><li>Decore com as cerejas inteiras. </li></ul>8 “GENES”
  5. 6. TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAGAGCCCGGCCCGGGGGACGGGCGGCGGGATAGCGGGACCCCGGCGCGGCGGTGCGCTTCAGGGCGCAGCGGCGGCCGCAGACCGAGCCCCGGGCGCGGCAAGAGGCGGCGGGAGCCGGTGGCGGCTCGGCATCATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCTTTTAGCGTCCTACACGAGCCATGGGGCGGACGCCAATTTGGAGGCTGGGAACGTGAAGGAAACCAGAGCCAGTCGGGCCAAGAGAAGAGGCGGTGGAGGACACGACGCGCTTAAAGGACCCAATGTCTGTGGATCACGTTATAATGCTTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTACACAGCTCTGACAAACGGGCGCTGCTCTAACCAGCTGCCACAGTCCATAACCAAAATGCAGTGCTGCTGTGATGCCGGCCGATGCTGGTCTCCAGGGGTCACTGTCGCCCCTGAGATGTGTCCCATCAGAGCAACCGAGGATTTCAACAAGCTGTGCTCTGTTCCTATGGTAATTCCTGGGAGACCAGAATATCCTCCCCCACCCCTTGGCCCCATTCCTCCAGTTCTCCCTGTTCCTCCTGGCTTTCCTCCTGGACCTCAAATTCCGGTCCCTCGACCACCAGTGGAATATCTGTATCCATCTCGGGAGCCACCAAGGGTGCTGCCAGTATTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAAACGTTACTGATTACTGCCAGTTGGTCCGCTATCTCTGTCAAAATGGACGCTGCATTCCAACTCCTGGGAGTTACCGGTGTGAGTGCAACAAAGGGTTCCAGCTGGACCTCCGTGGGGAGTGTATTGATGTTGATGAATGTGAGAAAAACCCCTGTGCTGGTGGTGAGTGTATTAACAACCAGGGTTCGTACACCTGTCAGTGCCGAGCTGGATATCAGAGCACACTCACGCGGACAGAATGCCGAGACATTGATGAGTGTTTGAATGAATGTGAGACTCCTGGAATCTGTGGTCCAGGGACATGTTACAACACCGTTGGCAACTACACCTGTATCTGTCCTCCAGACTACATGCAAGTGAATGGGGGAAATAATTGCATGGATATGAGAAGAAGTTTGTGCTACAGAAACTACTATGCTGACAACCAGACCTGTGATGGAGAATTGTTATTCAACATGACCAAGAAGATGTGCTGCTGTTCCTACAACATTGGCCGGGCGTGGAACAAGCCCTGTGAACAGTGTCCCATCCCAAGTACAGATGAGTTTGCTACACTCTGTGGAAGTCAAAGGCCAGGCT
  6. 7. Duas versões de cada gene (materna + paterna) A 1 A 2 B 1 B 2 C 1 C 2 D 1 D 2 A 3 A 4 B 3 B 4 C 3 C 4 D 3 D 4 A 2 A 4 B 1 B 4 C 1 C 3 D 2 D 4 A 1 A 4 B 1 B 3 C 2 C 4 D 2 D 4
  7. 10. Duas versões de cada gene (materna + paterna) A 1 A 2 B 1 B 2 C 1 C 2 D 1 D 2 A 3 A 4 B 3 B 4 C 3 C 4 D 3 D 4 A 2 A 4 B 1 B 4 C 1 C 3 D 2 D 4 A 1 A 4 B 1 B 3 C 2 C 4 D 2 D 4
  8. 11. <ul><li>A 1 </li></ul><ul><li>Bata as claras em neve, junte as gemas e o açúcar aos poucos, sempre batendo. </li></ul><ul><li>A 2 </li></ul><ul><li>Bata BEM as claras em neve, junte as gemas e o açúcar aos poucos, sempre batendo. </li></ul><ul><li>A 3 </li></ul><ul><li>Bata as claras em neve, junte as gemas e o açúcar aos poucos. </li></ul><ul><li>B 1 </li></ul><ul><li>Asse em fôrma redonda (25 cm de diâmetro), untada e enfarinhada e asse em forno médio (180º C) preaquecido por cerca de 40 minutos. </li></ul><ul><li>B 2 </li></ul><ul><li>Asse em fôrma redonda (40 cm de diâmetro) em forno médio (180º C) preaquecido por cerca de 50 minutos. </li></ul>VERSÕES DOS GENES A e B
  9. 12. <ul><li>A 1 </li></ul><ul><li>Bata as claras em neve, junte as gemas e o açúcar aos poucos, sempre batendo. </li></ul><ul><li>A 2 </li></ul><ul><li>Bata BEM as claras em neve, junte as gemas e o açúcar aos poucos, sempre batendo. </li></ul><ul><li>A 3 </li></ul><ul><li>Junte as gemas e o açúcar aos poucos. </li></ul><ul><li>B 1 </li></ul><ul><li>Asse em fôrma redonda (25 cm de diâmetro), untada e enfarinhada e asse em forno médio (180º C) preaquecido por cerca de 40 minutos. </li></ul><ul><li>B 2 </li></ul><ul><li>Asse em fôrma redonda em forno baixo por 10 minutos. </li></ul>VERSÕES DOS GENES A e B
  10. 13. FIGURA 4 - ALELOS e SNPs a1 a2 a3 a4 a6 a5 a Gene “A” : ALELOS do gene “A” ...ATTGGCACG...TGCATTAGCA.....AGTTGCATAGC..... ...ATTGGCACG...TGCTTTAGCA.....ACTTGCATAGC..... ...ATCGGCACG...TGCATTAGCA.....ACTTGCATAGC..... ...ATTGGCACG...TGCATTAGCA.....ACTTGAATAGC..... SNPs a2 a4 a5 a ...ATTGGCACG...TGCATTAGCA.....ACTTGCATAGC..... Gene “A” :
  11. 14. TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAGAGCCCGGCCCGGGGGACGGGCGGCGGGATAGCGGGACCCCGGCGCGGCGGTGCGCTTCAGGGCGCAGCGGCGGCCGCAGACCGAGCCCCGGGCGCGGCAAGAGGCGGCGGGAGCCGGTGGCGGCTCGGCATCATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCTTTTAGCGTCCTACACGAGCCATGGGGCGGACGCCAATTTGGAGGCTGGGAACGTGAAGGAAACCAGAGCCAGTCGGGCCAAGAGAAGAGGCGGTGGAGGACACGACGCGCTTAAAGGACCCAATGTCTGTGGATCACGTTATAATGCTTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTACACAGCTCTGACAAACGGGCGCTGCTCTAACCAGCTGCCACAGTCCATAACCAAAATGCAGTGCTGCTGTGATGCCGGCCGATGCTGGTCTCCAGGGGTCACTGTCGCCCCTGAGATGTGTCCCATCAGAGCAACCGAGGATTTCAACAAGCTGTGCTCTGTTCCTATGGTAATTCCTGGGAGACCAGAATATCCTCCCCCACCCCTTGGCCCCATTCCTCCAGTTCTCCCTGTTCCTCCTGGCTTTCCTCCTGGACCTCAAATTCCGGTCCCTCGACCACCAGTGGAATATCTGTATCCATCTCGGGAGCCACCAAGGGTGCTGCCAGTATTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAAACGTTACTGATTACTGCCAGTTGGTCCGCTATCTCTGTCAAAATGGACGCTGCATTCCAACTCCTGGGAGTTACCGGTGTGAGTGCAACAAAGGGTTCCAGCTGGACCTCCGTGGGGAGTGTATTGATGTTGATGAATGTGAGAAAAACCCCTGTGCTGGTGGTGAGTGTATTAACAACCAGGGTTCGTACACCTGTCAGTGCCGAGCTGGATATCAGAGCACACTCACGCGGACAGAATGCCGAGACATTGATGAGTGTTTGAATGAATGTGAGACTCCTGGAATCTGTGGTCCAGGGACATGTTACAACACCGTTGGCAACTACACCTGTATCTGTCCTCCAGACTACATGCAAGTGAATGGGGGAAATAATTGCATGGATATGAGAAGAAGTTTGTGCTACAGAAACTACTATGCTGACAACCAGACCTGTGATGGAGAATTGTTATTCAACATGACCAAGAAGATGTGCTGCTGTTCCTACAACATTGGCCGGGCGTGGAACAAGCCCTGTGAACAGTGTCCCATCCCAAGTACAGATGAGTTTGCTACACTCTGTGGAAGTCAAAGGCCAGGCT 3.200.000.000
  12. 15. TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAGAGCCCGGCCCGGGGGACGGGCGGCGGGATAGCGGGACCCCGGCGCGGCGGTGCGCTTCAGGGCGCAGCGGCGGCCGCAGACCGAGCCCCGGGCGCGGCAAGAGGCGGCGGGAGCCGGTGGCGGCTCGGCATCATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCTTTTAGCGTCCTACACGAGCCATGGGGCGGACGCCAATTTGGAGGCTGGGAACGTGAAGGAAACCAGAGCCAGTCGGGCCAAGAGAAGAGGCGGTGGAGGACACGACGCGCTTAAAGGACCCAATGTCTGTGGATCACGTTATAATGCTTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTACACAGCTCTGACAAACGGGCGCTGCTCTAACCAGCTGCCACAGTCCATAACCAAAATGCAGTGCTGCTGTGATGCCGGCCGATGCTGGTCTCCAGGGGTCACTGTCGCCCCTGAGATGTGTCCCATCAGAGCAACCGAGGATTTCAACAAGCTGTGCTCTGTTCCTATGGTAATTCCTGGGAGACCAGAATATCCTCCCCCACCCCTTGGCCCCATTCCTCCAGTTCTCCCTGTTCCTCCTGGCTTTCCTCCTGGACCTCAAATTCCGGTCCCTCGACCACCAGTGGAATATCTGTATCCATCTCGGGAGCCACCAAGGGTGCTGCCAGTATTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAAACGTTACTGATTACTGCCAGTTGGTCCGCTATCTCTGTCAAAATGGACGCTGCATTCCAACTCCTGGGAGTTACCGGTGTGAGTGCAACAAAGGGTTCCAGCTGGACCTCCGTGGGGAGTGTATTGATGTTGATGAATGTGAGAAAAACCCCTGTGCTGGTGGTGAGTGTATTAACAACCAGGGTTCGTACACCTGTCAGTGCCGAGCTGGATATCAGAGCACACTCACGCGGACAGAATGCCGAGACATTGATGAGTGTTTGAATGAATGTGAGACTCCTGGAATCTGTGGTCCAGGGACATGTTACAACACCGTTGGCAACTACACCTGTATCTGTCCTCCAGACTACATGCAAGTGAATGGGGGAAATAATTGCATGGATATGAGAAGAAGTTTGTGCTACAGAAACTACTATGCTGACAACCAGACCTGTGATGGAGAATTGTTATTCAACATGACCAAGAAGATGTGCTGCTGTTCCTACAACATTGGCCGGGCGTGGAACAAGCCCTGTGAACAGTGTCCCATCCCAAGTACAGATGAGTTTGCTACACTCTGTGGAAGTCAAAGGCCAGGCT ~ 25.000 genes
  13. 16. TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAGAGCCCGGCCCGGGGGACGGGCGGCGGGATAGCGGGACCCCGGCGCGGCGGTGCGCTTCAGGGCGCAGCGGCGGCCGCAGACCGAGCCCCGGGCGCGGCAAGAGGCGGCGGGAGCCGGTGGCGGCTCGGCATCATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCTTTTAGCGTCCTACACGAGCCATGGGGCGGACGCCAATTTGGAGGCTGGGAACGTGAAGGAAACCAGAGCCAGTCGGGCCAAGAGAAGAGGCGGTGGAGGACACGACGCGCTTAAAGGACCCAATGTCTGTGGATCACGTTATAATGCTTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTACACAGCTCTGACAAACGGGCGCTGCTCTAACCAGCTGCCACAGTCCATAACCAAAATGCAGTGCTGCTGTGATGCCGGCCGATGCTGGTCTCCAGGGGTCACTGTCGCCCCTGAGATGTGTCCCATCAGAGCAACCGAGGATTTCAACAAGCTGTGCTCTGTTCCTATGGTAATTCCTGGGAGACCAGAATATCCTCCCCCACCCCTTGGCCCCATTCCTCCAGTTCTCCCTGTTCCTCCTGGCTTTCCTCCTGGACCTCAAATTCCGGTCCCTCGACCACCAGTGGAATATCTGTATCCATCTCGGGAGCCACCAAGGGTGCTGCCAGTATTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAAACGTTACTGATTACTGCCAGTTGGTCCGCTATCTCTGTCAAAATGGACGCTGCATTCCAACTCCTGGGAGTTACCGGTGTGAGTGCAACAAAGGGTTCCAGCTGGACCTCCGTGGGGAGTGTATTGATGTTGATGAATGTGAGAAAAACCCCTGTGCTGGTGGTGAGTGTATTAACAACCAGGGTTCGTACACCTGTCAGTGCCGAGCTGGATATCAGAGCACACTCACGCGGACAGAATGCCGAGACATTGATGAGTGTTTGAATGAATGTGAGACTCCTGGAATCTGTGGTCCAGGGACATGTTACAACACCGTTGGCAACTACACCTGTATCTGTCCTCCAGACTACATGCAAGTGAATGGGGGAAATAATTGCATGGATATGAGAAGAAGTTTGTGCTACAGAAACTACTATGCTGACAACCAGACCTGTGATGGAGAATTGTTATTCAACATGACCAAGAAGATGTGCTGCTGTTCCTACAACATTGGCCGGGCGTGGAACAAGCCCTGTGAACAGTGTCCCATCCCAAGTACAGATGAGTTTGCTACACTCTGTGGAAGTCAAAGGCCAGGCT VARIAÇÕES
  14. 18. FIGURA 4 - ALELOS e SNPs a1 a2 a3 a4 a6 a5 a Gene “A” : ALELOS do gene “A” ...ATTGGCACG...TGCATTAGCA.....AGTTGCATAGC..... ...ATTGGCACG...TGCTTTAGCA.....ACTTGCATAGC..... ...ATCGGCACG...TGCATTAGCA.....ACTTGCATAGC..... ...ATTGGCACG...TGCATTAGCA.....ACTTGAATAGC..... SNPs a2 a4 a5 a ...ATTGGCACG...TGCATTAGCA.....ACTTGCATAGC..... Gene “A” :
  15. 20. Migração Homo Sapiens
  16. 21. TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAGAGCCCGGCCCGGGGGACGGGCGGCGGGATAGCGGGACCCCGGCGCGGCGGTGCGCTTCAGGGCGCAGCGGCGGCCGCAGACCGAGCCCCGGGCGCGGCAAGAGGCGGCGGGAGCCGGTGGCGGCTCGGCATCATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCTTTTAGCGTCCTACACGAGCCATGGGGCGGACGCCAATTTGGAGGCTGGGAACGTGAAGGAAACCAGAGCCAGTCGGGCCAAGAGAAGAGGCGGTGGAGGACACGACGCGCTTAAAGGACCCAATGTCTGTGGATCACGTTATAATGCTTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTACACAGCTCTGACAAACGGGCGCTGCTCTAACCAGCTGCCACAGTCCATAACCAAAATGCAGTGCTGCTGTGATGCCGGCCGATGCTGGTCTCCAGGGGTCACTGTCGCCCCTGAGATGTGTCCCATCAGAGCAACCGAGGATTTCAACAAGCTGTGCTCTGTTCCTATGGTAATTCCTGGGAGACCAGAATATCCTCCCCCACCCCTTGGCCCCATTCCTCCAGTTCTCCCTGTTCCTCCTGGCTTTCCTCCTGGACCTCAAATTCCGGTCCCTCGACCACCAGTGGAATATCTGTATCCATCTCGGGAGCCACCAAGGGTGCTGCCAGTATTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAAACGTTACTGATTACTGCCAGTTGGTCCGCTATCTCTGTCAAAATGGACGCTGCATTCCAACTCCTGGGAGTTACCGGTGTGAGTGCAACAAAGGGTTCCAGCTGGACCTCCGTGGGGAGTGTATTGATGTTGATGAATGTGAGAAAAACCCCTGTGCTGGTGGTGAGTGTATTAACAACCAGGGTTCGTACACCTGTCAGTGCCGAGCTGGATATCAGAGCACACTCACGCGGACAGAATGCCGAGACATTGATGAGTGTTTGAATGAATGTGAGACTCCTGGAATCTGTGGTCCAGGGACATGTTACAACACCGTTGGCAACTACACCTGTATCTGTCCTCCAGACTACATGCAAGTGAATGGGGGAAATAATTGCATGGATATGAGAAGAAGTTTGTGCTACAGAAACTACTATGCTGACAACCAGACCTGTGATGGAGAATTGTTATTCAACATGACCAAGAAGATGTGCTGCTGTTCCTACAACATTGGCCGGGCGTGGAACAAGCCCTGTGAACAGTGTCCCATCCCAAGTACAGATGAGTTTGCTACACTCTGTGGAAGTCAAAGGCCAGGCT FUNÇÃO!
  17. 22. <ul><li>Bata as claras em neve, junte as gemas e o açúcar aos poucos, sempre batendo. </li></ul><ul><li>Misture a farinha de trigo juntamente com o Chocolate em Pó e o fermento e despeje sobre as claras, misturando delicadamente. </li></ul><ul><li>Asse em fôrma redonda (25 cm de diâmetro), untada e enfarinhada e asse em forno médio (180º C) pré-aquecido por cerca de 40 minutos. </li></ul><ul><li>Desenforme e deixe esfriar. </li></ul><ul><li>Depois de frio, corte ao meio e umedeça com o rum. </li></ul><ul><li>Recheie com parte do chantilly e as cerejas. </li></ul><ul><li>Cubra com o chantilly restante e raspas de chocolate. </li></ul><ul><li>Decore com as cerejas inteiras. </li></ul>8 “GENES”
  18. 24. FUNÇÃO DOS 26.383 GENES HUMANOS
  19. 25. TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAGAGCCCGGCCCGGGGGACGGGCGGCGGGATAGCGGGACCCCGGCGCGGCGGTGCGCTTCAGGGCGCAGCGGCGGCCGCAGACCGAGCCCCGGGCGCGGCAAGAGGCGGCGGGAGCCGGTGGCGGCTCGGCATCATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCTTTTAGCGTCCTACACGAGCCATGGGGCGGACGCCAATTTGGAGGCTGGGAACGTGAAGGAAACCAGAGCCAGTCGGGCCAAGAGAAGAGGCGGTGGAGGACACGACGCGCTTAAAGGACCCAATGTCTGTGGATCACGTTATAATGCTTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTACACAGCTCTGACAAACGGGCGCTGCTCTAACCAGCTGCCACAGTCCATAACCAAAATGCAGTGCTGCTGTGATGCCGGCCGATGCTGGTCTCCAGGGGTCACTGTCGCCCCTGAGATGTGTCCCATCAGAGCAACCGAGGATTTCAACAAGCTGTGCTCTGTTCCTATGGTAATTCCTGGGAGACCAGAATATCCTCCCCCACCCCTTGGCCCCATTCCTCCAGTTCTCCCTGTTCCTCCTGGCTTTCCTCCTGGACCTCAAATTCCGGTCCCTCGACCACCAGTGGAATATCTGTATCCATCTCGGGAGCCACCAAGGGTGCTGCCAGTATTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAAACGTTACTGATTACTGCCAGTTGGTCCGCTATCTCTGTCAAAATGGACGCTGCATTCCAACTCCTGGGAGTTACCGGTGTGAGTGCAACAAAGGGTTCCAGCTGGACCTCCGTGGGGAGTGTATTGATGTTGATGAATGTGAGAAAAACCCCTGTGCTGGTGGTGAGTGTATTAACAACCAGGGTTCGTACACCTGTCAGTGCCGAGCTGGATATCAGAGCACACTCACGCGGACAGAATGCCGAGACATTGATGAGTGTTTGAATGAATGTGAGACTCCTGGAATCTGTGGTCCAGGGACATGTTACAACACCGTTGGCAACTACACCTGTATCTGTCCTCCAGACTACATGCAAGTGAATGGGGGAAATAATTGCATGGATATGAGAAGAAGTTTGTGCTACAGAAACTACTATGCTGACAACCAGACCTGTGATGGAGAATTGTTATTCAACATGACCAAGAAGATGTGCTGCTGTTCCTACAACATTGGCCGGGCGTGGAACAAGCCCTGTGAACAGTGTCCCATCCCAAGTACAGATGAGTTTGCTACACTCTGTGGAAGTCAAAGGCCAGGCT SAUDE HUMANA
  20. 26. GENE DEFEITUOSO TERAPIA DIRECIONADA TERAPIA GÊNICA Projeto Genoma Humano: DOENÇAS GENÉTICAS DIAGNÓSTICO
  21. 27. “ TUDO” É REGULADO POR GENES! Formato e funcionamento do corpo, dos órgãos Cor da pele, dos olhos, do cabelo ... Cicatrização Envelhecimento Memória Gordura Infecções Câncer ...
  22. 28. Projeto Genoma Humano: IMPACTO NA MEDICINA “ MEDICINA GENÉTICA” PREVENTIVA Adequar o estilo de vida de acordo com a genética
  23. 33. FARMACOGENÉTICA Resposta a drogas 6-mercaptopurina leucemia infantil polimorf. TPMT -> toxicidade CYP2D6 + CYP2C19 = 25% drogas
  24. 36. = Projeto Genoma Humano: IMPACTO NA MEDICINA Medicina PÓS-GENOMA Medicina ATUAL Medicina ATUAL Medicina MEDIEVAL
  25. 37. Ethical, Legal, and Social Issues (ELSI) 5% da verba total do PGH Impacto psicológico Privacidade Determinismo Eugenia Comercialização ...
  26. 38. DISCRIMINAÇÃO GENÉTICA Seguro de saúde/vida; Emprego; Escolas; PRIVACIDADE GENÉTICA
  27. 40. 47,XY,+13 47,XY,+18 EUGENIA
  28. 41. EUGENIA Doença Gordura Cor dos olhos QI SEXO DOENÇA x VARIAÇÃO NORMAL
  29. 42. DETERMINISMO GENÉTICO GENÉTICA + MEIO AMBIENTE
  30. 43. TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAGAGCCCGGCCCGGGGGACGGGCGGCGGGATAGCGGGACCCCGGCGCGGCGGTGCGCTTCAGGGCGCAGCGGCGGCCGCAGACCGAGCCCCGGGCGCGGCAAGAGGCGGCGGGAGCCGGTGGCGGCTCGGCATCATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCTTTTAGCGTCCTACACGAGCCATGGGGCGGACGCCAATTTGGAGGCTGGGAACGTGAAGGAAACCAGAGCCAGTCGGGCCAAGAGAAGAGGCGGTGGAGGACACGACGCGCTTAAAGGACCCAATGTCTGTGGATCACGTTATAATGCTTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTACACAGCTCTGACAAACGGGCGCTGCTCTAACCAGCTGCCACAGTCCATAACCAAAATGCAGTGCTGCTGTGATGCCGGCCGATGCTGGTCTCCAGGGGTCACTGTCGCCCCTGAGATGTGTCCCATCAGAGCAACCGAGGATTTCAACAAGCTGTGCTCTGTTCCTATGGTAATTCCTGGGAGACCAGAATATCCTCCCCCACCCCTTGGCCCCATTCCTCCAGTTCTCCCTGTTCCTCCTGGCTTTCCTCCTGGACCTCAAATTCCGGTCCCTCGACCACCAGTGGAATATCTGTATCCATCTCGGGAGCCACCAAGGGTGCTGCCAGTATTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAAACGTTACTGATTACTGCCAGTTGGTCCGCTATCTCTGTCAAAATGGACGCTGCATTCCAACTCCTGGGAGTTACCGGTGTGAGTGCAACAAAGGGTTCCAGCTGGACCTCCGTGGGGAGTGTATTGATGTTGATGAATGTGAGAAAAACCCCTGTGCTGGTGGTGAGTGTATTAACAACCAGGGTTCGTACACCTGTCAGTGCCGAGCTGGATATCAGAGCACACTCACGCGGACAGAATGCCGAGACATTGATGAGTGTTTGAATGAATGTGAGACTCCTGGAATCTGTGGTCCAGGGACATGTTACAACACCGTTGGCAACTACACCTGTATCTGTCCTCCAGACTACATGCAAGTGAATGGGGGAAATAATTGCATGGATATGAGAAGAAGTTTGTGCTACAGAAACTACTATGCTGACAACCAGACCTGTGATGGAGAATTGTTATTCAACATGACCAAGAAGATGTGCTGCTGTTCCTACAACATTGGCCGGGCGTGGAACAAGCCCTGTGAACAGTGTCCCATCCCAAGTACAGATGAGTTTGCTACACTCTGTGGAAGTCAAAGGCCAGGCT
  31. 44. 1953 Estrutura do DNA (Watson & Crick) 1972 1 a molécula DNA recombinante (P.Berg) 1977 Sequenciamento de DNA (Maxam & Gilbert) ... 1985 1 a discussão sequenciamento G.H. PCR (K. Mullis) HISTÓRIA CIENTÍFICA – TECNOLÓGICA – POLÍTICA DO PGH tec. DNA recombinante
  32. 46. BIOLOGIA SINTÉTICA
  33. 51. 20/5/2010
  34. 53. TTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAGAGCCCGGCCCGGGGGACGGGCGGCGGGATAGCGGGACCCCGGCGCGGCGGTGCGCTTCAGGGCGCAGCGGCGGCCGCAGACCGAGCCCCGGGCGCGGCAAGAGGCGGCGGGAGCCGGTGGCGGCTCGGCATCATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCTTTTAGCGTCCTACACGAGCCATGGGGCGGACGCCAATTTGGAGGCTGGGAACGTGAAGGAAACCAGAGCCAGTCGGGCCAAGAGAAGAGGCGGTGGAGGACACGACGCGCTTAAAGGACCCAATGTCTGTGGATCACGTTATAATGCTTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTACACAGCTCTGACAAACGGGCGCTGCTCTAACCAGCTGCCACAGTCCATAACCAAAATGCAGTGCTGCTGTGATGCCGGCCGATGCTGGTCTCCAGGGGTCACTGTCGCCCCTGAGATGTGTCCCATCAGAGCAACCGAGGATTTCAACAAGCTGTGCTCTGTTCCTATGGTAATTCCTGGGAGACCAGAATATCCTCCCCCACCCCTTGGCCCCATTCCTCCAGTTCTCCCTGTTCCTCCTGGCTTTCCTCCTGGACCTCAAATTCCGGTCCCTCGACCACCAGTGGAATATCTGTATCCATCTCGGGAGCCACCAAGGGTGCTGCCAGTATTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAACAGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTAAACGTTACTGATTACTGCCAGTTGGTCCGCTATCTCTGTCAAAATGGACGCTGCATTCCAACTCCTGGGAGTTACCGGTGTGAGTGCAACAAAGGGTTCCAGCTGGACCTCCGTGGGGAGTGTATTGATGTTGATGAATGTGAGAAAAACCCCTGTGCTGGTGGTGAGTGTATTAACAACCAGGGTTCGTACACCTGTCAGTGCCGAGCTGGATATCAGAGCACACTCACGCGGACAGAATGCCGAGACATTGATGAGTGTTTGAATGAATGTGAGACTCCTGGAATCTGTGGTCCAGGGACATGTTACAACACCGTTGGCAACTACACCTGTATCTGTCCTCCAGACTACATGCAAGTGAATGGGGGAAATAATTGCATGGATATGAGAAGAAGTTTGTGCTACAGAAACTACTATGCTGACAACCAGACCTGTGATGGAGAATTGTTATTCAACATGACCAAGAAGATGTGCTGCTGTTCCTACAACATTGGCCGGGCGTGGAACAAGCCCTGTGAACAGTGTCCCATCCCAAGTACAGATGAGTTTGCTACACTCTGTGGAAGTCAAAGGCCAGGCT
  35. 55. CLONAGEM
  36. 56. 1997: A REVOLUÇÃO DOLLY !
  37. 59. músculo pele neurônio Identidade celular: conjunto de genes ligados/desligados.
  38. 60. RAIZ FOLHAS SEMENTES
  39. 61. Transferência Nuclear (1950’s) célula da pele núcleo óvulo com núcleo transferido Sapo A Sapo B clone transferir núcleo para óvulo óvulo enucleado óvulo
  40. 63. 1997 1998 2000 A clonagem pós-Dolly ?
  41. 64. PORQUÊ CLONAR HUMANOS ? Copiar alguém “interessante”
  42. 66. PORQUÊ CLONAR HUMANOS ? Copiar alguém “interessante” Opção para casais estéreis Gerar “doadores de órgãos”
  43. 68. 277 29 Matemática da Clonagem ????? “ DAR CERTO” ???
  44. 69. TAXAS DE “SUCESSO” DA CLONAGEM Célula doadora Espécie Oócitos Nascimentos Obs. reconstr. vivos Fetal Fibroblasto Camundongo 3057 5 (0.2%) Bovino 276 4 (1.4%) 1 † 1896 6 (0.3%) Cabra 285 3 (1.1%) Porco 210 1 (0.5%) Ovelha 417 14 (3.4%) 11 † Adulta Gld. Mamária Ovelha 227 1 (0.4%) Granulosa Camundongo 2468 31 (1.3%) Fibroblasto Bovino 440 6 (1.4%) 2 † 664 8 (1.2%)
  45. 70. “ DAR CERTO” ??? longevidade predisposição para câncer reprodução filhos netos ...
  46. 72. CLONAGEM
  47. 73. CLONAGEM REPRODUTIVA CLONAGEM TERAPÊUTICA
  48. 74. RAIZ FOLHAS SEMENTES
  49. 75. CÉLULAS-TRONCO
  50. 76. Fontes de tecidos e órgãos para transplante: doadores (5-10%); órgãos artificiais; órgãos de animais (xenotransplante); engenharia de tecidos: células-tronco
  51. 77. CÉLULA TRONCO “ Células com capacidade de AUTO-RENOVAÇÃO ilimitada/prolongada, capazes de produzir pelo menos um tipo de DESCENDENTE ALTAMENTE DIFERENCIADO “
  52. 78. CÉLULAS TRONCO “ADULTAS” vs. CÉLULAS TRONCO EMBRIONÁRIAS
  53. 79. CÉLULAS TRONCO “ADULTAS” CÉLULAS TRONCO EMBRIONÁRIAS
  54. 80. CTs “adultas” – MEDULA ÓSSEA
  55. 81. CTs “adultas” – plasticidade/trans-diferenciação
  56. 88. Ensaios Clínicos em Humanos no Brasil 144 pacientes Brasileiros com cardiopatias e infartos tratados com células tronco: vida normal e bom estado de saúde <ul><li>Chagas e Hepatite - FioCruz Salvador </li></ul><ul><li>Infarto e Derrame- Pró-cardíaco e UFRJ </li></ul><ul><li>Doenças Coronarianas - INCOR-SP </li></ul><ul><li>Trauma de Medula Espinhal - FM-USP </li></ul><ul><li>Diabetes, Lupus, e outras doenças auto-imunes - USP-RP </li></ul><ul><li>Insuficiência Vascular Periférica - SJRP </li></ul><ul><li>Regeneração Neural - UFRGS </li></ul>Salvador São Paulo Rio de Janeiro Porto Alegre
  57. 89. CTs “adultas” – plasticidade/trans-diferenciação medula óssea
  58. 90. CÉLULAS TRONCO “ADULTAS” NOVAS FONTES
  59. 91. 1989: Sangue do cordão umbilical é fonte de células-tronco hematopoéticas
  60. 92. CÉLULAS TRONCO “ADULTAS” NOVAS FONTES (em desenvolvimento) Lipoaspirado Polpa do dente de leite Líquido amniótico Placenta Cordão umblical ...
  61. 93. CÉLULAS TRONCO “ADULTAS” CÉLULAS TRONCO EMBRIONÁRIAS
  62. 94. PLURIPOTENTES cultura botão embrionário Células-tronco EMBRIONÁRIAS (ES) – 1980’s
  63. 95. teratoma PLURIPOTENCY in vivo : Injection into SCID mice endoderm mesoderm ectoderm
  64. 96. bIII-tub
  65. 98. Science vol. 282, 6 Nov., 1998
  66. 99. Tecidos/Células para Terapia Medula Óssea Neurônios Células do Músculo Cardíaco Células do Pâncreas Células-Tronco A Promessa das CT Embrionárias Humanas
  67. 102. hES: DESAFIOS SEGURANÇA COMPATIBILIDADE ÉTICA/LEGISLAÇÃO
  68. 105. DIFERENCIAÇÃO: Desenvolvimento Embrionário Células-Tronco Embrionárias: Lições de 25 Anos de Pesquisa
  69. 107. A Importância da Pesquisa Básica Para a Célula-Tronco Embrionária A Importância da Célula-Tronco Embrionária Para a Pesquisa Básica
  70. 108. POLÊMICA: Ser-Humano ou Aglomerado de Células? Células-Tronco Embrionárias: Lições de 25 Anos de Pesquisa
  71. 109. Lei de Biossegurança 2005 embriões FIV > 3 anos e congelados < Março 2005; proíbe clonagem humana.
  72. 110. (ADI) Nº 3.510 contra o Art. 5º da Lei de Biossegurança Nº 11.105 de 24 de março de 2005 <ul><li>“ que a vida humana acontece na, e a partir da, fecundação”; </li></ul><ul><li>“ a pesquisa com células-tronco adultas é, objetiva e certamente, mais promissora do que a pesquisa com células-tronco embrionárias , até porque com as primeiras, resultados auspiciosos acontecem, do que não se tem registro com as segundas”. </li></ul>
  73. 111. <ul><li>“ que a vida humana acontece na, e a partir da, fecundação”; </li></ul><ul><li>“ a pesquisa com células-tronco adultas é, objetiva e certamente, mais promissora do que a pesquisa com células-tronco embrionárias , até porque com as primeiras, resultados auspiciosos acontecem, do que não se tem registro com as segundas”. </li></ul>X (ADI) Nº 3.510 contra o Art. 5º da Lei de Biossegurança Nº 11.105 de 24 de março de 2005
  74. 112. ... ... ...? FORMAS de vida humana ?
  75. 113. EXPECTATIVA: Verdades Absolutas ou Transitórias? Células-Tronco Embrionárias: Lições de 25 Anos de Pesquisa
  76. 116. Transplante de Coração
  77. 117. Cenário 2030 Genoma: susceptibilidade genética; medicina genética preventiva; medicina personalizada; diagnósticos e drogas inteligentes; descriminação “genética”; “ eugenia” (seleção de embriões). Transgênicos: aumento produtividade; proteção meio-ambiente; controle.
  78. 118. Cenário 2030 Biologia Sintética: novos seres-vivos em função do homem. Clonagem: animal; humana?? Células-tronco: conhecimento da biologia humana “ reposição de peças”? medicina personalizada? regeneração – células vs. drogas. Comunicação de Ciência
  79. 120. CONHECIMENTO PODER RESPONSABILIDADE
  80. 122. Conceito básico: todas as células contém o genoma completo. músculo pele neurônio
  81. 123. músculo pele neurônio Identidade celular: conjunto de genes ligados/desligados.
  82. 124. Expressão alta baixa linfóide mielóide genes pacientes DIAGNÓSTICO “GENÔMICO” Chip de DNA : leucemia linfóide vs. mielóide.
  83. 126. “ Vida” x Vida
  84. 127. LEI DE BIOSSEGURAN Ç A APROVAÇÃO 2005 PERMITE o uso do embri ã o humano CONGELADO > 3ANOS PROIBE a clonagem terapeutica para obtenç ã o de células tronco
  85. 128. Reino Unido França EUA Alemanha Portugal Canadá Bélgica Japão Coréia do Sul clonagem terapêutica embrião Aut.Embr.Fert.Hum. 5 anos – exced. $$ privada importar < 2002; s/colab. lei ? exced. exced. ou não
  86. 130. LEI DE BIOSSEGURAN Ç A EXPECTATIVAS DA POPULAÇÃO… Dra. Lygia, agora que o projeto de Lei de Biossegurança foi aprovado, QUANTAS PESSOAS SAIRÃO DAS FILAS DE TRANSPLANTE? SEGURANÇA COMPATIBILIDADE
  87. 131. New Lines of Human Embryonic Stem Cells
  88. 132. a b c 10x 4x d e f 10x 4x 4x 4x
  89. 134. Karyotype passage 5: 46,XY BR-1
  90. 135. TRANSGÊNICOS
  91. 136. PROBLEMA: Alimentar a população mundial. SOLUÇÕES: Aumentar a área plantada; Diminuir a população; Aumentar a produtividade: Agrotóxicos; TRANSGÊNICOS PREOCUPAÇÕES: Saúde humana e meio-ambiente
  92. 137. TRANSGÊNICOS São seguros??? Culpados até provem o contrário Liberação facilitada X
  93. 138. PROBLEMA: Alimentar a população mundial. SOLUÇÕES: Aumentar a área plantada; Diminuir a população; Aumentar a produtividade: Agrotóxicos; TRANSGÊNICOS PREOCUPAÇÕES: Saúde humana e meio-ambiente

×