O slideshow foi denunciado.
Utilizamos seu perfil e dados de atividades no LinkedIn para personalizar e exibir anúncios mais relevantes. Altere suas preferências de anúncios quando desejar.
GABARITO                       Caderno do Aluno                 Biologia – 2a série – Volume 3

GABARITO                      Caderno do Aluno                 Biologia – 2a série – Volume 3


GABARITO                      Caderno do Aluno               Biologia – 2a série – Volume 3

GABARITO                     Caderno do Aluno                 Biologia – 2a série – Volume 3

       Espera-se que eles ...
GABARITO                     Caderno do Aluno                 Biologia – 2a série – Volume 3

entre si. Esse processo de...
GABARITO                   Caderno do Aluno               Biologia – 2a série – Volume 3

• Hipótese: é esperado que os...
GABARITO                           Caderno do Aluno                  Biologia – 2a série – Volume 3

GABARITO                       Caderno do Aluno                 Biologia – 2a série – Volume 3

5. Quais podem ser as f...
GABARITO                       Caderno do Aluno                Biologia – 2a série – Volume 3

9. O texto deve conter to...
GABARITO                        Caderno do Aluno                    Biologia – 2a série – Volume 3

     apresentada con...
GABARITO                           Caderno do Aluno            Biologia – 2a série – Volume 3

     a) AUG AGU UGG CC...
GABARITO                       Caderno do Aluno                 Biologia – 2a série – Volume 3

GABARITO                        Caderno do Aluno                  Biologia – 2a série – Volume 3


GABARITO                      Caderno do Aluno                 Biologia – 2a série – Volume 3

2. Alternativa a.
3. Alt...
GABARITO                     Caderno do Aluno                Biologia – 2a série – Volume 3

  Aprendendo a Aprender

Próximos SlideShares
Carregando em…5

2009 Volume3 C A D E R N O D O A L U N O B I O L O G I A Ensino Medio 2aserie Gabarito

13.356 visualizações

Publicada em

Publicada em: Tecnologia
  • Seja o primeiro a comentar

2009 Volume3 C A D E R N O D O A L U N O B I O L O G I A Ensino Medio 2aserie Gabarito

  1. 1. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 SITUAÇÃO DE APRENDIZAGEM 1 A ESTRUTURA DO DNA Para começo de conversa Página 3 • Espera-se que os alunos abordem temas relacionados a exames de paternidade, genética forense e material genético. Leitura e Análise de Imagem Página 3 1. A imagem é formada com várias fotografias de seres humanos. 2. Um significado possível é que todos os seres humanos compartilham um mesmo tipo de DNA. O significado biológico será apresentado em outro momento, mas, para uma primeira aproximação, essa interpretação é suficiente. 3. O formato da molécula de DNA, que é semelhante a uma “escada” retorcida. Leitura e Análise de Texto Página 5 1. A canção retrata a relação de um pai com sua filha, Daniela. Os versos a seguir reforçam essa ideia: “Quando você nasceu ouvi seu grito”; “Não me sentir capaz de ser seu pai”. 2. Esse elo é o DNA. 3. As palavras são: DANça ; oNDA; NADa; DNA; DANiela. 4. As letras se alternam, da mesma forma que os componentes do DNA se alternam ao longo da molécula. 1
  2. 2. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 LIÇÃO DE CASA Página 8 • Só são formados pares entre cores específicas, como ocorre entre as bases nitrogenadas. VOCÊ APRENDEU? Página 8 1. Alternativa e. 2. Alternativa a. 3. Alternativa c. 4. a) Os “corrimãos” correspondem a uma sucessão alternada de fosfato e desoxirribose (açúcar). Os “degraus” são constituídos por pares de bases nitrogenadas, unidas por ligações de hidrogênio, onde adenina pareia com timina, e citosina com guanina. b) A molécula de DNA contém genes que codificam as proteínas. Primeiramente, a informação contida nos genes é transcrita para uma molécula de RNA mensageiro, que será lido pelos ribossomos no citoplasma. Ao ler os RNAm, os ribossomos sintetizam cadeias de aminoácidos (proteínas), cuja sequência é determinada pela sequência de nucleotídeos do RNAm. c) Duas proteínas podem ser diferenciadas por suas sequências de aminoácidos. Outra diferença diz respeito às suas estruturas tridimensionais, que definirão suas funções. A estrutura tridimensional de uma proteína depende da sequência de seus aminoácidos. 2
  3. 3. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 SITUAÇÃO DE APRENDIZAGEM 2 A DUPLICAÇÃO DO DNA Para começo de conversa Página 10 1. Durante a mitose, a quantidade de DNA da célula duplicada durante a interfase está se dividindo para originar as duas células-filhas. 2. A quantidade de DNA duplicou, passou de C para 2 C. 3. Começa com C e acaba com o mesmo valor, C. Isso mostra que durante a mitose são formadas novas células com a mesma quantidade de DNA da célula original. A duplicação do DNA Página 11 1. Não se espera que o aluno produza uma resposta elaborada sobre a replicação do DNA. No entanto, seria muito salutar que ele pudesse estabelecer alguma relação entre o pareamento de bases (pares A/T e C/G) e o processo de replicação. 2. Neste momento, não são esperadas respostas elaboradas e explicações corretas e detalhadas às questões, pois os alunos ainda não têm elementos para construí-las. Entretanto, as respostas dadas serão muito úteis para relacionar o conhecimento prévio dos alunos e direcionar suas explicações. Atividade coletiva: simulando a replicação do DNA Página 12 Espera-se que os alunos descrevam os passos de formação de novas moléculas de DNA de acordo com a formação das novas fileiras. 3
  4. 4. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 Espera-se que eles compreendam que o processo de replicação do DNA ocorre pela adição de novos nucleotídeos (alunos) à cadeia em formação (fileira). Essa adição é feita tendo como molde a fita antiga de DNA. O que realiza o processo de leitura da fita antiga e construção da nova fita é a enzima DNA polimerase. 1. Espera-se que aqui os alunos possam relacionar o período “S” da mitose com a dramatização que acabaram de realizar e que o aumento na quantidade de DNA (de C para 2C) deve-se à duplicação do DNA. 2. No esquema, a relação entre fita de DNA e fileira de carteiras é que cada sequência de alunos corresponde a uma cadeia da molécula de DNA e o pareamento entre os alunos corresponde ao pareamento de bases entre as duas cadeias complementares do DNA. Uma molécula de DNA com duas cadeias abre-se e gera dois moldes. Paralelamente, a cada molde irá se formar uma nova fita complementar (de acordo com o pareamento AT e CG) e ao término haverá duas moléculas de DNA iguais 4
  5. 5. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 entre si. Esse processo de replicação é denominado semiconservativo, pois as moléculas novas apresentam uma fita nova e outra antiga. LIÇÃO DE CASA Página 14 O aluno deverá estruturar um texto que mostre o processo de replicação do DNA. É importante que esse texto apresente a estrutura da molécula e ressalte o fenômeno da complementaridade entre as bases nitrogenadas. A seguir, o texto deve mostrar como esse fenômeno possibilita a replicação – cada uma das fitas da molécula de DNA servindo de molde para a síntese de duas novas fitas. PESQUISA INDIVIDUAL Página 14 • O aluno deve compreender que o papel da enzima é utilizar nucleotídeos livres obtidos, por exemplo, por meio da alimentação e incorporá-los às fitas de DNA que estão sendo construídas. É importante que o aluno compreenda que a enzima DNA polimerase é dependente de molde, ou seja, ela produz uma nova fita tendo outra por molde. Além disso, o aluno deve construir a ideia de que a replicação deve começar em vários pontos ao longo da molécula de DNA. • Espécie Número de dias 61 Jiboia 90 Ser humano 269 Gafanhoto 521 Cebola 4 630 Salamandra 19 387 Ameba 5
  6. 6. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 • Hipótese: é esperado que os alunos consigam perceber que a velocidade apresentada corresponde à de uma molécula de proteína, mas muitas moléculas de proteínas podem atuar simultaneamente, diminuindo o tempo necessário para duplicar o DNA de uma célula. 6
  7. 7. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 SITUAÇÃO DE APRENDIZAGEM 3 DO DNA À PROTEÍNA VOCÊ APRENDEU? Página 16 1. Alternativa d. 2. Alternativa c. 3. Alternativa b. 4. Uma reta sem as fases S, G2 e M, pois, se a célula não se multiplica, ela não duplicará seu DNA. 5. a) No tubo B, a densidade é intermediária devido à presença do isótopo normal e do isótopo pesado, dada a característica da duplicação do DNA ser semiconservativa, ou seja, uma fita antiga servir de molde para a fita nova. b) Na faixa superior também há X de DNA, com densidade menor (isótopo normal). Página 19 DNA RNA 1. Qual é o significado da sigla? Ácido Ácido ribonucleico desoxirribonucleico 2. O nucleotídio deste ácido nucleico é formado por Desoxirribose Ribose qual tipo de açúcar? 3. Quais são as bases nitrogenadas que podem Adenina, timina, Adenina, uracila, formar um nucleotídio deste ácido nucleico? guanina, citosina guanina, citosina 4. A molécula deste ácido nucleico é formada por Dupla-fita Fita simples fita simples ou dupla-fita? 7
  8. 8. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 5. Quais podem ser as funções desempenhadas por “Armazenar” a Traduzir a informação moléculas deste ácido nucleico? informação genética genética em proteína 6. Em uma célula humana, onde podemos encontrar No núcleo (e No núcleo e no as moléculas deste ácido nucleico? também na citoplasma (e também na mitocôndria) mitocôndria) • Pode ser que alguns alunos interpretem a ideia de que os RNAs mensageiros trazem a informação do núcleo da célula para o citoplasma; porém, normalmente, o termo “mensageiro” suscita várias interpretações dos alunos, alguns acham que deve ser o próprio gene, outros acham que o RNA é quem copia a mensagem, e não que seja uma cópia da mensagem (do gene). Leitura e Análise de Texto Página 20 1. Lembranças de um RNA mensageiro é um texto narrado pelo próprio RNA mensageiro. Nele, o narrador descreve um período de sua vida até o momento de sua “morte”. 2. RNA mensageiro, RNA transportador e RNA ribossômico. O RNA mensageiro é um molde do DNA que leva a informação do DNA até o ribossomo. O RNA transportador identifica sequências do RNA mensageiro e libera o aminoácido correspondente no ribossomo. O RNA ribossômico forma o ribosso, estrutura responsável pela ligação entre o RNA mensageiro e o RNA transportador, além da reunião dos aminoácidos. 3. AUG. 4. No núcleo. 5. No citoplasma. 6. Ao RNA mensageiro e ao ribossomo. 7. Na sequência UAG. 8. Podemos substituí-lo por “polipeptídio” ou por “proteína”. 8
  9. 9. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 9. O texto deve conter todas as etapas descritas que ocorrem no citoplasma, tendo como narrador o ribossomo. Decifrando o código genético Página 22 1. Espera-se que o aluno relacione código a uma linguagem cifrada com símbolos que permitem escrever ou representar algum tipo de informação. 2. Há um equívoco muito comum entre os alunos, e também na mídia, de considerar código genético como sinônimo de DNA ou de genoma. Por isso, caso isso ocorra, não é preciso conceituar precisamente neste momento; porém, é bom chamar a atenção dos alunos para o fato. 3. Da bactéria Xylella, causadora do amarelinho em plantas cítricas, laranja. 4. É uma doença que acomete as plantas de laranja e que é causada por uma bactéria. 5. Projeto científico com o objetivo de mapear o DNA, genoma, da bactéria Xylella. 6. No caso, o genoma da Xylella é o conjunto de informações genéticas contido no DNA da bactéria e que define suas características biológicas. Aprendendo a Aprender Página 23 • Códon: trinca de nucleotídeos presente no RNA mensageiro que codifica um aminoácido na proteína. Leitura e Análise de Texto Página 24 1. A sequência de bases nitrogenadas do DNA humano, chamada de genoma humano, é confundida com a expressão “código genético” da espécie. Esse sequenciamento do genoma humano foi finalizado por volta do ano 2000. Dessa forma, a manchete 9
  10. 10. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 apresentada contém um erro conceitual muito comum em alguns noticiários sobre Ciência. 2. a) AUG. b) Metionina, lisina, glicina. 3. Esse é um códon de parada e define quando a síntese da proteína, adição de novos aminoácidos, se encerra. 4. UGA, UAA. 5. Arginina – CGU, CGC, CGA, CGG; triptofano – UGG. 6. Que o código genético é degenerado, ou seja, existe mais de um códon para codificar o mesmo aminoácido. 7. Dizer que o código genético é universal significa dizer que essa relação entre códons e aminoácidos é encontrada em todos os seres vivos. Ou seja, tanto em seres humanos como em insetos ou plantas, a tradução de uma informação genética em proteína obedece ao mesmo código. 8. De DNA a Proteína Fita do DNA a ser transcrita TAC GGA GTA GCT ATA ATT RNA mensageiro AUG CCU CAU CGA UAU UAA Proteína met – pro – his – arg – tyr VOCÊ APRENDEU? Página 25 1. Alternativa c. 2. Alternativa c. 3. Não. De acordo com o código genético, diferentes trincas de nucleotídeos podem especificar o mesmo aminoácido. 10
  11. 11. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 4. a) AUG AGU UGG CCU G b) Serina – triptofano – prolina c) Metionina – serina – glicina Aprendendo a Aprender Página 28 1. Resposta esperada: valina – histidina – leucina – treonina – prolina – ácido glutâmico – ácido glutâmico – lisina. 2. Resposta esperada: apesar da mutação, não haverá alteração na proteína, porque tanto o códon CAC como o CTC codificam para o mesmo aminoácido – valina. 3. Resposta esperada: nesse caso, a mutação produz um códon que codifica um aminoácido diferente – metionina. Por isso, haverá mudança na proteína. 4. a) Resposta esperada: nesse caso, a primeira mutação causará a produção de um códon de parada e, portanto, os aminoácidos subsequentes não serão adicionados na proteína. b) A segunda mutação acarretará a reorganização de todos os códons a partir da mutação (…CAC – GTG – ACT – GAG – GAC – TCC – TCT – TC…), sendo que a terceira trinca (ACT) codifica um códon de parada. 5. É esperado que os alunos encontrem alguns exemplos de mutações relacionadas à anemia falciforme. O exemplo mais comum é a mutação pontual no gene beta- globina. Esse tipo de hemoglobina é chamado de hemoglobina S. 11
  12. 12. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 SITUAÇÃO DE APRENDIZAGEM 4 DO DNA À CARACTERÍSTICA Para começo de conversa Página 29 • Espera-se que os alunos retomem e relacionem os conceitos anteriormente trabalhados relacionados aos genes como instruções hereditárias das células. Solicite que os alunos prestem especial atenção na relação entre os genes e a manifestação das características. Leitura e Análise de Texto Página 31 1. É uma proteína com função metabólica, controla determinada reação química. No caso da enzima SBE-1, ela controla a adição de novas moléculas de glicose nas ramificações do amido. 2. As células dos cotilédones podem armazenar mais ou menos água ao longo de seu desenvolvimento, dependendo do teor de amido ramificado. Cotilédones com muito amido não ramificado acumulam mais água e, quando secam, ficam com aspecto enrugado. Já os cotilédones com muito amido ramificado acumulam pouca água ao longo do desenvolvimento e, quando secam, perdem pouca água e permanecem com o volume praticamente inalterado, mantendo-se lisos. 3. Fita complementar de DNA: semente lisa: atgagatacttggagcaatttcatgatttgtga; semente rugosa: atgagatacttggagcaatttcatgatttatctttttgaaa. 4. RNA mensageiro: semente lisa: augagauacuuggagcaauuucaugauuuguga; semente rugosa: augagauacuuggagcaauuucaugauuuaucuuuuugaaa. 12
  13. 13. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 5. Sequência de aminoácidos Proteína Resposta met-arg-tyr-leu-glu-gln-phe-his-asp-leu I Semente lisa met-arg-tyr-leu-glu-gln-phe-his-asp-his II met-arg-tyr-leu-glu-gln-phe-his-asp-leu-his III met-arg-tyr-leu-glu-gln-phe-his-asp-leu-ser IV met-arg-tyr-leu-glu-gln-phe-his-asp-leu-ser-phe V Semente rugosa 6. a) • É a sequência de aminoácidos que compõe uma proteína. • Representa a existência de diferentes domínios, regiões, na estrutura de uma proteína, com formatos importantes para a função que a proteína desempenha. • É o formato final de uma proteína e está diretamente associado à função que a proteína executa. b) tactctatgaacctcgttaaagtactaaatagaaaaacttt. c) tactctatgaacctcgttaaagtactaaacact. 7. O alelo R (codifica a proteína I) e o alelo r (codifica a proteína V). 8. Não, pois um tipo possui uma cópia do alelo R, e o outro, duas. Além disso, a ervilha heterozigota deve produzir cerca de metade de suas moléculas de amido com ramificações e a outra metade sem ramificações, enquanto a ervilha homozigota (RR) deve produzir apenas amido com ramificações. VOCÊ APRENDEU? Página 37 1. Alternativa b. 13
  14. 14. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 2. Alternativa a. 3. Alternativa a. 4. a) Gene é um segmento do DNA localizado nos cromossomos. Possui um código químico representado por sequências de bases nitrogenadas (adenina, guanina, citosina e timina). Cada trinca de bases é capaz de codificar um aminoácido de uma proteína. A sequência de trincas determinará a sequência dos aminoácidos de um polipeptídeo. b) Mutações são modificações na sequência ou na composição das bases do DNA (gene), que podem causar a produção de uma proteína alterada ou mesmo a não produção da proteína. c) A substituição de uma base nitrogenada no DNA pode não causar nenhuma alteração na proteína produzida pela célula porque o código genético é degenerado, ou seja, um mesmo aminoácido pode ser codificado por diferentes trincas de bases. 5. a) • Proteína normal: Val – Leu – Tre – Pro – Tir – Val – Lis • Indivíduo A: Val – Leu – Tre – Pro • Indivíduo B: Val – Leu – Tre – Pro – Tir – Val – Lis • Indivíduo C: Val – Met – Tre – Pro – Tir – Val – Lis b) A é afetado porque produz uma proteína menor. B é normal, apesar da substituição de uma base nitrogenada em seu DNA, porque o código genético é degenerado. C é afetado porque possui um aminoácido diferente em sua proteína. 14
  15. 15. GABARITO Caderno do Aluno Biologia – 2a série – Volume 3 Aprendendo a Aprender Página 39 Espera-se que os alunos possam relacionar o papel fundamental das proteínas na organização e no funcionamento das células e dos seres vivos com os processos moleculares envolvendo as informações genéticas: replicação, transcrição e tradução. 15
