Avanços e perspectivas  em BioinformáticaSemana Acadêmica da Computação   Leandro Lima – 17/08/2012     www.ime.usp.br/~ll...
Quem sou eu* Bacharel em Ciência da ComputaçãoUniversidade Federal do Ceará (2003-2006)* Mestre em Ciência da ComputaçãoUn...
Sumário- Um pouco de Biologia- Informação biológica: gerar, armazenar,   analisar- Genômica- Sequenciamento de DNA- Aplica...
Uma definição de Bioinformática“Uso da Computação e Estatística para gerar, armazenar e analisar        dados biológicos”
Um pouco de Biologia (I)   Gregor Mendel("Ensaios com plantas   híbridas", 1865)
Um pouco de Biologia (II)                 Watson e Crick e a                  estrutura do DNA                       (1953)
Um pouco de Biologia (III)  Imagem: http://pathology.jhu.edu/pc/BasicCauses.php
Dogma Central daBiologia Molecular
Geração de informação biológicaResultado da busca do site do NCBI (National Center for Biotechnology Information)
Geração de informação biológicaPubMed: catálogo dos artigos científicosTaxonomy: classificação de organismosGenome: sequên...
Exemplos de informações: gene BRCA1           (Homo sapiens)Localização: 17q21 (41196312..41277500)Tamanho: 81189 basesTra...
Mais um pouco de Biologia
Mais um pouco de Biologia
O genoma é toda a informação  hereditária de um organismo que    está codificada em seu DNAEtapas de estudo:(1) Sequenciam...
ABCDEFGHIJKLMNOPQRSTUVWXYZ                 Sequenciamento
Sequenciamento de DNA
Sequenciamento de DNA
Um pouco de História    Projeto Genoma Humanoiniciado em 1990 – “concluído” em 2003                         Hoje (2012): 2...
Alguns tamanhos de genomas- HIV (vírus): 9.7kb- Haemophilus influenzae (bactéria): 1.8Mb- Arabidopsis thaliana (planta): 1...
Alinhamento de sequências
Um exemplo usandoprogramação dinâmica Alinhar as sequências GAATTCAGTTA     GGATCGA
ResultadoG _ A A T T C A G T T A|     |   | |   |     |G G _ A _ T C _ G _ _ A       Score = 6
Outros estudos- Single-nucleotide polymorphism (SNP, do  inglês polimorfismo em único nucleotídeo)
Outros estudos (II)- Copy-number variation(CNV, do inglês variaçãono número de cópias)
Dogma Central daBiologia Molecular             Expressão gênica                 (mRNA)
Medida de expressão gênica     (ex: microarrays)          Figuras: http://www.chrisdellavedova.com    http://www.har.mrc.a...
Númerosgene   Am1    Am2    Am3    Am4    Am5    … A      2.5    1.5     5     6.3    3.4   … B      3.2    5.6    4.4    ...
Padrões de expressão
Clustering analysis(análise de agrupamento)
Funções biológicas
Redes biológicas
Redes biológicas
Redes droga-alvos(drug-target networks)
Diseasome (rede das doenças)
Exemplo de uma análise usando      expressão gênica1 - Dada uma doença X, coletamos (os  biólogos, na verdade) amostras de...
Exemplo de uma análise usando      expressão gênica2 – Após verificar que a qualidade dos dados  está boa, analisamos o pa...
Exemplo de uma análise usando      expressão gênica
Exemplo de uma análise usando      expressão gênica3 – Identificar as funções biológicas  relacionadas a esses genes  dife...
Exemplo de uma análise usando      expressão gênica
Exemplo de uma análise usando      expressão gênica4 – Identificar a rede de genes relacionados  a essa lista e identifica...
Exemplo de uma análise usando      expressão gênica
O que estudar?Computação  - programação/análise de algoritmos  - mineração de dados/reconhecimento de padrões  - teoria do...
Linguagens mais usadas
Pós-graduações no Brasil- Programa Interunidades de Pós-Graduação  em Bioinformática-USPhttp://www.ime.usp.br/posbioinfo/-...
Onde trabalhar- Hospitais- Universidades- Instituições de pesquisa (agropecuária,   biomédica, etc.)- Farmacêuticas- Prest...
Outras dicas- Comece a estudar cedo- Procure um grupo de Bioinformática  (Computação, Biologia, Matemática,  Farmácia, Med...
Broad Institute of MIT and Harvard (junho de 2012)
Broad Institute of MIT and Harvard (junho de 2012)
Avanços e perspectivas em Bioinformática
Avanços e perspectivas em Bioinformática
Avanços e perspectivas em Bioinformática
Avanços e perspectivas em Bioinformática
Avanços e perspectivas em Bioinformática
Avanços e perspectivas em Bioinformática
Avanços e perspectivas em Bioinformática
Avanços e perspectivas em Bioinformática
Avanços e perspectivas em Bioinformática
Próximos SlideShares
Carregando em…5

Avanços e perspectivas em Bioinformática

3.276 visualizações

Publicada em

Palestra ministrada na Semana Acadêmica da Computação da Universidade Federal do Ceará (dia 17/08/2012)

Publicada em: Educação
0 comentários
1 gostou
  • Seja o primeiro a comentar

Sem downloads
Visualizações totais
No SlideShare
A partir de incorporações
Número de incorporações
Incorporações 0
Nenhuma incorporação

Nenhuma nota no slide

Avanços e perspectivas em Bioinformática

  1. 1. Avanços e perspectivas em BioinformáticaSemana Acadêmica da Computação Leandro Lima – 17/08/2012 www.ime.usp.br/~llima
  2. 2. Quem sou eu* Bacharel em Ciência da ComputaçãoUniversidade Federal do Ceará (2003-2006)* Mestre em Ciência da ComputaçãoUniversidade de São Paulo (2007-2009)* Doutorando em BioinformáticaUniversidade de São Paulo (2011- ????)Trabalhos atuais:* Hospital AC Camargo – Centro Internacional de Pesquisa e Ensino – Laboratório de Bioinformática e Bioestatística* FMU – Professor do curso de Ciência da Computação
  3. 3. Sumário- Um pouco de Biologia- Informação biológica: gerar, armazenar, analisar- Genômica- Sequenciamento de DNA- Aplicações / análises- Perspectivas / direcionamentos
  4. 4. Uma definição de Bioinformática“Uso da Computação e Estatística para gerar, armazenar e analisar dados biológicos”
  5. 5. Um pouco de Biologia (I) Gregor Mendel("Ensaios com plantas híbridas", 1865)
  6. 6. Um pouco de Biologia (II) Watson e Crick e a estrutura do DNA (1953)
  7. 7. Um pouco de Biologia (III) Imagem: http://pathology.jhu.edu/pc/BasicCauses.php
  8. 8. Dogma Central daBiologia Molecular
  9. 9. Geração de informação biológicaResultado da busca do site do NCBI (National Center for Biotechnology Information)
  10. 10. Geração de informação biológicaPubMed: catálogo dos artigos científicosTaxonomy: classificação de organismosGenome: sequências completas de genomasGene: informações de genesGEO Profiles: perfis de expressão gênicaProtein: banco de sequênciasSNP: variações genéticas curtasPubChem: banco de estruturas e interações químicas (drogas)
  11. 11. Exemplos de informações: gene BRCA1 (Homo sapiens)Localização: 17q21 (41196312..41277500)Tamanho: 81189 basesTranscritos: NM_007300.3, NM_007294.3, ...Interações: ABL1, MSH6, BRCA2, BRIP1, ...Alterações comuns: rs8176320, rs12516, rs34214126, ...Vias metabólicas: reparo de DNA, ciclo celular, …Sequência: GTACCTTGATTTCGTATTCTGAGAGGCTGCTGCT TAG... Fonte: http://www.ncbi.nlm.nih.gov/gene/672
  12. 12. Mais um pouco de Biologia
  13. 13. Mais um pouco de Biologia
  14. 14. O genoma é toda a informação hereditária de um organismo que está codificada em seu DNAEtapas de estudo:(1) Sequenciamento(2) Montagem (com ou sem referência)(3) Anotação
  18. 18. Sequenciamento de DNA
  19. 19. Sequenciamento de DNA
  20. 20. Um pouco de História Projeto Genoma Humanoiniciado em 1990 – “concluído” em 2003 Hoje (2012): 2 dias para sequenciar Tamanho do genoma completo: ~3GB
  21. 21. Alguns tamanhos de genomas- HIV (vírus): 9.7kb- Haemophilus influenzae (bactéria): 1.8Mb- Arabidopsis thaliana (planta): 157Mb- Drosophila melanogaster (mosca): 130Mb- Mus musculus (rato): 2.7Gb- Homo sapiens (você): 3.2Gb- Polychaos dubium (ameba): 670Gb
  22. 22. Alinhamento de sequências
  23. 23. Um exemplo usandoprogramação dinâmica Alinhar as sequências GAATTCAGTTA GGATCGA
  24. 24. ResultadoG _ A A T T C A G T T A| | | | | |G G _ A _ T C _ G _ _ A Score = 6
  25. 25. Outros estudos- Single-nucleotide polymorphism (SNP, do inglês polimorfismo em único nucleotídeo)
  26. 26. Outros estudos (II)- Copy-number variation(CNV, do inglês variaçãono número de cópias)
  27. 27. Dogma Central daBiologia Molecular Expressão gênica (mRNA)
  28. 28. Medida de expressão gênica (ex: microarrays) Figuras: http://www.chrisdellavedova.com http://www.har.mrc.ac.uk/services/MPC/microarray/
  29. 29. Númerosgene Am1 Am2 Am3 Am4 Am5 … A 2.5 1.5 5 6.3 3.4 … B 3.2 5.6 4.4 4 7 … C 4.5 10.3 1.2 5.5 5 … D 1.5 3.2 4.5 3.4 4.5 … E 3.5 6.7 2.6 2.5 2.5 … … … … … … … …
  30. 30. Padrões de expressão
  31. 31. Clustering analysis(análise de agrupamento)
  32. 32. Funções biológicas
  33. 33. Redes biológicas
  34. 34. Redes biológicas
  35. 35. Redes droga-alvos(drug-target networks)
  36. 36. Diseasome (rede das doenças)
  37. 37. Exemplo de uma análise usando expressão gênica1 - Dada uma doença X, coletamos (os biólogos, na verdade) amostras de tecido de 20 pessoas doentes e 20 pessoas sem a doença
  38. 38. Exemplo de uma análise usando expressão gênica2 – Após verificar que a qualidade dos dados está boa, analisamos o padrão de expressão dos genes nos dois grupos e tentamos identificar quais tiveram uma padrão diferente (chamamos esses genes de diferencialmente expressos)
  39. 39. Exemplo de uma análise usando expressão gênica
  40. 40. Exemplo de uma análise usando expressão gênica3 – Identificar as funções biológicas relacionadas a esses genes diferencialmente expressos (tanto os super-expressos quanto os sub- expressos)
  41. 41. Exemplo de uma análise usando expressão gênica
  42. 42. Exemplo de uma análise usando expressão gênica4 – Identificar a rede de genes relacionados a essa lista e identificar os mais importantes usando informações topológicas (exemplos: grau do vértice; centralidade; participação em comunidades; é ponte?)
  43. 43. Exemplo de uma análise usando expressão gênica
  44. 44. O que estudar?Computação - programação/análise de algoritmos - mineração de dados/reconhecimento de padrões - teoria dos grafos - programação paralela e distribuída - bancos de dadosBiologia - Biologia molecular/celularEstatística - análise de gráficos - inferência/teste de hipótese
  45. 45. Linguagens mais usadas
  46. 46. Pós-graduações no Brasil- Programa Interunidades de Pós-Graduação em Bioinformática-USPhttp://www.ime.usp.br/posbioinfo/- Programa de Pós-Graduação em Bioinformática-UFPRhttp://www.bioinfo.ufpr.br- Programa de Pós-Graduação em Bioinformática-UFMGhttp://www.pgbioinfo.icb.ufmg.br/
  47. 47. Onde trabalhar- Hospitais- Universidades- Instituições de pesquisa (agropecuária, biomédica, etc.)- Farmacêuticas- Prestadoras de serviços
  48. 48. Outras dicas- Comece a estudar cedo- Procure um grupo de Bioinformática (Computação, Biologia, Matemática, Farmácia, Medicina)- Estude inglês- Use Linux- Siga blog / perfis do Twitter relacionados a Bioinfo- Pense sobre passar um tempo fora (do Ceará, do Brasil)
  49. 49. Broad Institute of MIT and Harvard (junho de 2012)
  50. 50. Broad Institute of MIT and Harvard (junho de 2012)
  51. 51. Perguntas?
